The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047318	Streptomyces sp. HM190 chromosome, complete genome	7762826	1116383	1174536	7762826	transposase,protease	Streptomyces_phage(37.5%)	58	NA	NA
WP_159766024.1|1116383_1117025_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	G7YZ59	Streptococcus_phage	28.5	1.4e-05
WP_159766025.1|1117032_1117350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159766026.1|1118044_1118518_+	NlpC/P60 family protein	NA	A0A222YZ81	Streptomyces_phage	48.7	5.8e-25
WP_159766027.1|1119203_1119662_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_159766028.1|1119908_1120874_+	helix-turn-helix domain-containing protein	NA	A0A1J0MCL6	Streptomyces_phage	43.6	1.4e-49
WP_055512956.1|1120789_1121014_+	DUF397 domain-containing protein	NA	NA	NA	NA	NA
WP_159766029.1|1121071_1122199_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_159766030.1|1122399_1123644_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_159766031.1|1123636_1124926_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.9	3.3e-14
WP_159766032.1|1124927_1125647_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_159775611.1|1125703_1127797_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_159766033.1|1128356_1129043_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_159766034.1|1129216_1129888_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_159766035.1|1129909_1130284_-	fic family toxin-antitoxin system, toxin component	NA	NA	NA	NA	NA
WP_159766036.1|1130288_1130564_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_159766037.1|1130838_1131711_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	32.6	1.1e-13
WP_159766038.1|1131715_1134286_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_159766039.1|1134389_1135268_+	TIGR03621 family F420-dependent LLM class oxidoreductase	NA	NA	NA	NA	NA
WP_159766040.1|1135991_1136414_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_159766041.1|1136388_1137381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159766042.1|1137541_1138276_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_159766043.1|1138347_1139046_-	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_159766044.1|1139399_1142060_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_159766045.1|1142092_1142467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159766046.1|1142725_1143145_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_159766047.1|1143435_1144773_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_159766048.1|1144769_1145786_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_159766049.1|1145848_1146655_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_159766050.1|1146699_1147038_+	DUF4326 domain-containing protein	NA	Q6UYH1	Burkholderia_phage	45.8	7.9e-16
WP_159766051.1|1147166_1148609_+	adenylosuccinate lyase	NA	NA	NA	NA	NA
WP_159775613.1|1148605_1149184_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_159775615.1|1149212_1149938_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_159766052.1|1149951_1151109_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_159766053.1|1151326_1151671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159766054.1|1151667_1152270_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_159766055.1|1153031_1154627_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_159766056.1|1154613_1155648_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_159766057.1|1155713_1156724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159766058.1|1156901_1157240_+	Lsr2 family protein	NA	A0A1B1PA60	Streptomyces_phage	40.7	1.6e-13
WP_159766059.1|1157335_1157926_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_159766060.1|1158124_1158862_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_159766061.1|1159074_1159353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159766062.1|1159352_1159571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159766063.1|1159585_1159807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159766064.1|1159996_1160155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159766065.1|1160157_1160787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159766066.1|1160826_1161600_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_159766067.1|1161652_1163203_+	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_159775617.1|1163655_1163931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159775619.1|1164381_1164600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159766066.1|1164666_1165440_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_159766068.1|1165736_1167113_+|transposase	IS1380 family transposase	transposase	A0A222ZN33	Mycobacterium_phage	55.2	2.1e-123
WP_159766069.1|1167302_1167926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159766066.1|1167979_1168753_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_159766070.1|1169134_1171561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159766071.1|1171913_1172114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159766072.1|1172846_1173611_+	DUF4263 domain-containing protein	NA	NA	NA	NA	NA
WP_159766066.1|1173762_1174536_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP047318	Streptomyces sp. HM190 chromosome, complete genome	7762826	2918359	2983703	7762826	transposase,tRNA,protease	Streptococcus_phage(22.22%)	48	NA	NA
WP_159767354.1|2918359_2921233_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.7	5.6e-211
WP_159775841.1|2921764_2923030_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_159767355.1|2923026_2924643_+	oxidoreductase	NA	NA	NA	NA	NA
WP_005479297.1|2925028_2925262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159767356.1|2925863_2926532_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_159767357.1|2926528_2926975_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_159767358.1|2927138_2929022_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_159775843.1|2929038_2929794_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_159767359.1|2930428_2931571_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_159767360.1|2931717_2932788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159767361.1|2932889_2933468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159767362.1|2933646_2934933_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	49.1	4.2e-94
WP_159775845.1|2935182_2935647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159767363.1|2935808_2936990_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	35.9	3.5e-50
WP_159767364.1|2937362_2939444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159767365.1|2939852_2941289_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_055515300.1|2941429_2941684_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003990208.1|2941698_2942019_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_159767366.1|2942222_2943569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159767367.1|2943869_2948129_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_159767368.1|2948374_2949172_-	DUF2344 domain-containing protein	NA	NA	NA	NA	NA
WP_159767369.1|2949220_2950363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159767370.1|2950724_2951315_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_159775847.1|2951495_2951738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159767371.1|2952044_2953997_-	TIGR03960 family B12-binding radical SAM protein	NA	NA	NA	NA	NA
WP_159767372.1|2954093_2955659_-	CHAD domain-containing protein	NA	NA	NA	NA	NA
WP_159767373.1|2955757_2956954_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_159767374.1|2956950_2959353_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_159767375.1|2959508_2960180_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_159767376.1|2960208_2961159_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_004931372.1|2961333_2962353_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_159767377.1|2962742_2963156_-	nucleoside-diphosphate kinase	NA	A0A2K9L0Y6	Tupanvirus	46.2	1.6e-26
WP_159767378.1|2963270_2963633_-	DUF4233 domain-containing protein	NA	NA	NA	NA	NA
WP_159767379.1|2963640_2965149_-	dihydrofolate synthase	NA	NA	NA	NA	NA
WP_159767380.1|2965346_2967998_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	41.6	3.4e-146
WP_159767381.1|2968135_2969083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159767382.1|2969144_2969411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107464051.1|2969586_2970873_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	61.4	1.4e-145
WP_159767383.1|2971076_2971757_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	47.4	8.4e-41
WP_099964527.1|2971997_2972666_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	47.7	2.0e-42
WP_159767384.1|2973045_2974503_-	trigger factor	NA	NA	NA	NA	NA
WP_159767385.1|2975301_2975496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159767386.1|2976075_2977269_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_159767387.1|2977272_2977755_-	HD domain-containing protein	NA	A0A0M3LQS1	Mannheimia_phage	37.7	2.2e-11
WP_159767388.1|2977899_2979072_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_159767389.1|2979286_2980525_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_159775849.1|2980663_2982106_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_159775849.1|2982260_2983703_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP047318	Streptomyces sp. HM190 chromosome, complete genome	7762826	7085846	7142565	7762826	plate,integrase,tail	Antheraea_pernyi_nuclear_polyhedrosis_virus(20.0%)	45	7080579:7080599	7126727:7126747
7080579:7080599	attL	CCCGCGCGCTGCTCGCCCGGC	NA	NA	NA	NA
WP_159776542.1|7085846_7086068_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_159774587.1|7086140_7087061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159774589.1|7087057_7087354_+	SelT/SelW/SelH family protein	NA	NA	NA	NA	NA
WP_159774591.1|7087343_7088978_-	malate synthase A	NA	NA	NA	NA	NA
WP_159774593.1|7089177_7089948_-	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_159776544.1|7090279_7090567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159776546.1|7090632_7091412_-	maleylpyruvate isomerase family mycothiol-dependent enzyme	NA	NA	NA	NA	NA
WP_159774595.1|7091514_7092312_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_159774597.1|7092588_7093968_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_159774599.1|7093973_7095089_+	allantoicase	NA	NA	NA	NA	NA
WP_159774601.1|7095181_7095808_+	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_159774603.1|7096063_7096267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159774605.1|7096438_7097701_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_159774607.1|7097941_7098967_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_159774609.1|7099091_7099763_+	response regulator	NA	NA	NA	NA	NA
WP_159774611.1|7100087_7101278_+	cytochrome P450	NA	NA	NA	NA	NA
WP_159774613.1|7101333_7101834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159774615.1|7101849_7102860_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_159776548.1|7102977_7103727_+	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_159774617.1|7103857_7105003_+	ROK family glucokinase	NA	NA	NA	NA	NA
WP_159774619.1|7104999_7105581_+	sugar kinase	NA	NA	NA	NA	NA
WP_159776551.1|7105776_7108596_+	ATP-dependent helicase	NA	A8C6A2	Antheraea_pernyi_nuclear_polyhedrosis_virus	32.5	5.9e-48
WP_159776550.1|7108955_7110950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159774621.1|7111567_7112062_+	electron transporter	NA	NA	NA	NA	NA
WP_159774623.1|7112079_7112310_-	anti-sigma factor	NA	NA	NA	NA	NA
WP_159774625.1|7112306_7112978_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_159774627.1|7113849_7114986_-	peptidoglycan DD-metalloendopeptidase family protein	NA	G9BW84	Planktothrix_phage	44.9	1.2e-20
WP_159774629.1|7115407_7117177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159774630.1|7117379_7118528_+	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_159774632.1|7120500_7121073_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_159776553.1|7121221_7122076_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_159774634.1|7122107_7124927_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_159776555.1|7125150_7125765_+	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_159774636.1|7125934_7126660_+	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_159774638.1|7126656_7128702_+	AAA family ATPase	NA	A0A0R6PCP6	Moraxella_phage	30.1	1.7e-20
7126727:7126747	attR	CCCGCGCGCTGCTCGCCCGGC	NA	NA	NA	NA
WP_159774640.1|7128714_7130202_-	hydrogenase expression protein	NA	NA	NA	NA	NA
WP_159774643.1|7130458_7132039_+|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	34.8	1.1e-67
WP_067228587.1|7132109_7132553_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_159774645.1|7132552_7133080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159774647.1|7136092_7136923_+	extensin	NA	NA	NA	NA	NA
WP_067228593.1|7136984_7137410_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_159774649.1|7137422_7138154_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_159774651.1|7138153_7140058_+	VgrG-related protein	NA	NA	NA	NA	NA
WP_159774653.1|7140166_7140607_+|plate	baseplate protein	plate	A0A1D7SP91	Cyanophage	33.7	2.0e-11
WP_159774655.1|7140606_7142565_+|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
