The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047192	Klebsiella pneumoniae strain Kp36 chromosome, complete genome	5517016	448676	481934	5517016	capsid,protease,tail,tRNA,terminase,integrase,head,portal	uncultured_Caudovirales_phage(73.33%)	33	466284:466301	482279:482296
WP_002919147.1|448676_449624_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|449638_450148_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|450276_451401_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|451372_451846_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|451871_452414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|452418_452991_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|452994_453813_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|453809_454067_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|454042_454597_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|460392_460614_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|460907_464018_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|464030_465170_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|465548_466199_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
466284:466301	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|466474_467701_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|467793_468735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|468916_469201_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|469211_469991_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_106918304.1|470442_470712_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|470704_470893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|470885_471200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|471196_471565_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|471561_471927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|471926_474062_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|474404_474740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|474788_475301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|475564_476731_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|476782_477343_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|477344_478586_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|478582_478918_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|478914_479214_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|479213_479657_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_000113647.1|479932_480289_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|480272_481934_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
482279:482296	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 2
NZ_CP047192	Klebsiella pneumoniae strain Kp36 chromosome, complete genome	5517016	733827	813709	5517016	transposase,integrase,tail,plate	Burkholderia_virus(41.03%)	96	736566:736583	742296:742313
WP_001135926.1|733827_734517_-	DUF2786 domain-containing protein	NA	A0A1W6DYA0	Aeromonas_phage	33.9	5.9e-26
WP_001569383.1|734503_734800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021553508.1|734815_735088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001569384.1|735084_735273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000005725.1|735351_735963_-	DUF3164 family protein	NA	A0A2D1GNM4	Pseudomonas_phage	68.5	7.2e-76
WP_000835317.1|735980_736250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011410679.1|736252_737419_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	61.1	1.3e-121
736566:736583	attL	AGTTTGTCCGCCAGTTCA	NA	NA	NA	NA
WP_011410680.1|737429_739199_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	67.8	6.2e-229
WP_006687266.1|739202_740111_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	55.4	6.3e-76
WP_000042842.1|740120_740426_-	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	58.0	9.2e-24
WP_001041677.1|740422_740647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159351713.1|740735_741146_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_159351715.1|741181_741715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159351717.1|741762_742533_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	65.7	2.6e-99
742296:742313	attR	TGAACTGGCGGACAAACT	NA	NA	NA	NA
WP_000793140.1|742780_743131_+	membrane protein	NA	A4JWP3	Burkholderia_virus	54.8	4.0e-23
WP_159351719.1|743130_743868_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	58.8	4.2e-62
WP_159351721.1|743857_744511_+	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	31.1	5.3e-08
WP_000175096.1|744507_744840_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	47.7	1.1e-17
WP_000227551.1|744832_745144_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	7.2e-32
WP_000124057.1|745143_745689_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	1.2e-58
WP_000080258.1|745685_747209_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.2	1.7e-182
WP_006687283.1|747208_748705_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	61.5	2.8e-174
WP_006687285.1|748685_749507_+	hypothetical protein	NA	Q6QIB9	Burkholderia_phage	62.3	6.9e-98
WP_000135510.1|749509_749968_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	43.0	3.8e-29
WP_011410687.1|750182_751280_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	49.6	5.0e-96
WP_159351723.1|751293_752247_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.6	1.7e-63
WP_011410689.1|752257_752614_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_000271666.1|752615_753062_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	51.7	1.1e-33
WP_001101809.1|753061_753526_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	4.1e-39
WP_001446463.1|753522_753777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729861.1|753766_755194_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	78.6	3.4e-217
WP_001062395.1|755193_755715_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	68.8	1.0e-67
WP_000215406.1|755717_755999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011410690.1|756097_756412_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001148841.1|756377_756515_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_159351725.1|756607_759073_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	42.8	3.3e-172
WP_006687304.1|759072_759957_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.0	2.6e-50
WP_006687305.1|759953_760169_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_006687307.1|760156_761326_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	48.9	4.6e-87
WP_109549633.1|761325_761838_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	38.5	9.4e-21
WP_000859115.1|761892_762240_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	63.3	7.8e-35
WP_109549632.1|762230_763334_+|plate	baseplate protein	plate	A4JWL6	Burkholderia_virus	53.8	1.9e-106
WP_063617130.1|763326_763905_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.3	1.3e-66
WP_159351727.1|764718_765114_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	42.0	1.1e-19
WP_159038693.1|765374_765476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064669696.1|765447_765933_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	36.4	9.6e-15
WP_159351729.1|765946_766405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047668260.1|766394_766976_+	DNA-invertase Hin	NA	A0A0A7NPV4	Enterobacteria_phage	71.5	2.2e-66
WP_002916739.1|768757_769939_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_002916738.1|770115_770304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004174409.1|770503_770848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062954968.1|770934_771537_-	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_004188550.1|771634_772546_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004150915.1|772546_773695_-	PLP-dependent transferase	NA	NA	NA	NA	NA
WP_004150913.1|773705_775076_-	pyridoxal-phosphate dependent enzyme	NA	A0A1W6JIM2	Lactococcus_phage	37.3	6.6e-45
WP_004150912.1|775726_776020_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004150910.1|776016_776502_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004188553.1|777205_777799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085666571.1|778259_778445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071838928.1|778422_778608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004188557.1|778717_779590_+	ParA family protein	NA	NA	NA	NA	NA
WP_004150906.1|779589_779973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150905.1|779965_781333_+	replicative DNA helicase	NA	O80281	Escherichia_phage	53.0	3.7e-120
WP_004150904.1|781329_782952_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_004150903.1|782951_783536_+	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
WP_004150902.1|783535_784753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150901.1|784837_785713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150900.1|785894_787223_+	WG repeat-containing protein	NA	NA	NA	NA	NA
WP_022644655.1|787613_788369_+	DUF2321 domain-containing protein	NA	Q6SEF3	Lactobacillus_prophage	34.7	6.9e-12
WP_004150898.1|788444_789317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150897.1|789310_790396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150896.1|790789_791512_+	TIGR03761 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_004150895.1|792228_792681_+	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_004150894.1|792804_793374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150893.1|793373_794114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153005.1|794227_794845_+	TIGR03759 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_004150891.1|794823_795393_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_004153655.1|795389_795902_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_094820963.1|795939_798039_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_004150888.1|798035_798299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150887.1|798298_799057_+	TIGR03747 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
WP_004150886.1|799158_799635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004217767.1|799894_800569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150884.1|801017_801335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150883.1|801331_801568_+	TIGR03758 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_004150882.1|801582_801936_+	TIGR03745 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
WP_004150881.1|801945_802317_+	TIGR03750 family conjugal transfer protein	NA	NA	NA	NA	NA
WP_004150880.1|802313_802967_+	TIGR03746 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_004150879.1|802966_803812_+	TIGR03749 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_004217763.1|803808_805293_+	TIGR03752 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_004150877.1|805306_805705_+	TIGR03751 family conjugal transfer lipoprotein	NA	NA	NA	NA	NA
WP_004150876.1|805704_808479_+	conjugative transfer ATPase	NA	NA	NA	NA	NA
WP_004150874.1|808979_809684_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_004150873.1|809923_811291_-	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	34.2	5.9e-62
WP_004150872.1|811343_812516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073547080.1|812728_813709_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.5e-184
>prophage 3
NZ_CP047192	Klebsiella pneumoniae strain Kp36 chromosome, complete genome	5517016	1207010	1292343	5517016	transposase,capsid,tail,plate,tRNA,coat,terminase,integrase,lysis,head,portal	Salmonella_phage(68.63%)	96	1220764:1220783	1269444:1269463
WP_002914765.1|1207010_1209638_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	4.9e-81
WP_000906486.1|1210001_1210187_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_002914359.1|1211708_1212023_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_002914357.1|1212148_1212715_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_002914355.1|1212711_1213140_+	DedA family protein	NA	NA	NA	NA	NA
WP_002914353.1|1213206_1214763_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_002914351.1|1214919_1215435_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_002914345.1|1215487_1216255_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002914344.1|1216233_1217910_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_002914342.1|1218046_1219585_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_002914339.1|1219600_1220773_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
1220764:1220783	attL	TTGCACTCATGTTATTCTCC	NA	NA	NA	NA
WP_002914337.1|1220898_1221429_-	transcriptional repressor MprA	NA	NA	NA	NA	NA
WP_002914335.1|1221519_1221855_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_002914333.1|1221844_1222591_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_002914330.1|1222768_1223767_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_004151038.1|1223845_1224913_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_002914328.1|1224905_1226108_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.8	1.2e-26
WP_002914327.1|1226464_1227427_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	72.2	1.5e-131
WP_002914325.1|1227437_1229579_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	46.4	2.5e-184
WP_002914321.1|1229551_1229962_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_002914320.1|1229958_1230204_-	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	41.1	5.5e-11
WP_004151037.1|1230387_1230819_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_004149442.1|1230907_1232260_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_002914293.1|1232403_1232751_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_002914291.1|1232900_1233263_+	YgaC family protein	NA	NA	NA	NA	NA
WP_002914289.1|1233348_1233798_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_002914287.1|1234526_1234928_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_002914284.1|1235000_1235180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914281.1|1235385_1236288_+	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	40.2	2.6e-37
WP_002914279.1|1236268_1236814_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_002914277.1|1236821_1237121_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002914274.1|1237196_1237802_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_004145715.1|1237905_1238814_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004151036.1|1238896_1240684_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_004151035.1|1240947_1242468_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000019473.1|1243199_1244180_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_062955148.1|1244225_1245224_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	94.5	2.2e-183
WP_004151019.1|1245226_1245856_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_001397669.1|1245978_1246221_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151018.1|1246253_1246763_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_004151017.1|1246770_1246971_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004144796.1|1246934_1247273_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151016.1|1247340_1247574_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004151014.1|1247573_1247801_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151013.1|1247797_1248649_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151012.1|1248645_1251030_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004152765.1|1251510_1252995_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151011.1|1253102_1253291_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151010.1|1253302_1253536_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151009.1|1253631_1254315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|1254301_1255381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151007.1|1255380_1256382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940854.1|1256903_1257173_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151006.1|1257229_1258273_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_019405037.1|1258272_1260036_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151004.1|1260176_1261010_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_004151003.1|1261026_1262079_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004134644.1|1262082_1262736_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151002.1|1262831_1263296_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004151001.1|1263295_1263499_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004134639.1|1263502_1263718_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151000.1|1263698_1264208_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004150999.1|1264212_1264596_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004150998.1|1264592_1265021_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_004150997.1|1265116_1265539_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150996.1|1265531_1265978_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150995.1|1266000_1266867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150994.1|1266961_1267534_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150993.1|1267530_1267893_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150992.1|1267879_1268788_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004152935.1|1268780_1269452_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150990.1|1269453_1271403_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
1269444:1269463	attR	GGAGAATAACATGAGTGCAA	NA	NA	NA	NA
WP_004200602.1|1271412_1272531_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150988.1|1272582_1273656_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004150987.1|1273804_1274977_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150986.1|1274986_1275502_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150985.1|1275554_1275854_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_002896220.1|1275868_1275988_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150984.1|1275980_1278611_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
WP_004150983.1|1278607_1279093_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150982.1|1279089_1280184_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150981.1|1280250_1280469_+	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150980.1|1280496_1280874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|1281477_1281960_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
WP_004188817.1|1282070_1282547_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914161.1|1282536_1282827_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1282893_1283235_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914159.1|1283382_1285044_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1285130_1286009_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|1286133_1286724_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|1286843_1288130_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1288149_1288941_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1289104_1290469_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1290728_1290977_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1290995_1291544_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|1291575_1292343_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP047192	Klebsiella pneumoniae strain Kp36 chromosome, complete genome	5517016	1398365	1453018	5517016	transposase,tail,holin,terminase,integrase	Salmonella_phage(37.25%)	58	1391700:1391714	1421805:1421819
1391700:1391714	attL	TGAGCAGGTTCGCGA	NA	NA	NA	NA
WP_004151980.1|1398365_1399832_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_004151979.1|1399899_1401477_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_062955102.1|1401668_1402919_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	84.4	5.8e-205
WP_063002073.1|1402861_1403104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197356.1|1403100_1403694_-	MT-A70 family protein	NA	T1SA14	Salmonella_phage	91.9	6.3e-109
WP_062955103.1|1403690_1404353_-	hypothetical protein	NA	A0A059VF56	Pseudomonas_phage	46.6	1.2e-47
WP_048264082.1|1404349_1404508_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.1e-17
WP_009485475.1|1404500_1404794_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
WP_062955104.1|1404903_1405152_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	76.8	4.9e-31
WP_062955105.1|1405200_1406082_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	84.3	8.9e-136
WP_062955106.1|1406078_1406900_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	80.2	1.8e-130
WP_004164029.1|1406896_1407196_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004144290.1|1407562_1408144_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
WP_004152538.1|1408298_1408532_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152537.1|1408678_1408888_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004207253.1|1408887_1409655_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_032418532.1|1409651_1410437_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
WP_048328152.1|1410556_1410904_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	6.5e-50
WP_062955107.1|1411096_1411507_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	45.1	4.3e-16
WP_032441402.1|1411490_1411682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441401.1|1411678_1412323_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	79.3	8.0e-110
WP_072200041.1|1412616_1413084_+	hypothetical protein	NA	A0A2R2Z312	Escherichia_phage	51.7	1.3e-37
WP_029602865.1|1413083_1413377_+	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	86.6	2.7e-44
WP_050491799.1|1413373_1413994_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	40.7	1.0e-29
WP_032441458.1|1413993_1414197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023339258.1|1414189_1414528_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	1.8e-44
WP_004152765.1|1414624_1416109_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_032418540.1|1416512_1416770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441400.1|1416847_1417432_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.6	2.2e-90
WP_062955142.1|1417428_1418904_+	hypothetical protein	NA	Q858H3	Salmonella_phage	93.1	6.4e-280
WP_004200550.1|1418947_1419319_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	91.9	3.7e-59
WP_004141368.1|1420072_1420279_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
WP_032441398.1|1420293_1421976_+|tail	tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.4	1.5e-264
1421805:1421819	attR	TGAGCAGGTTCGCGA	NA	NA	NA	NA
WP_004152446.1|1421972_1422269_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
WP_032441397.1|1422271_1422952_+	peptidase	NA	G9L6C4	Escherichia_phage	84.0	6.1e-76
WP_004200546.1|1422966_1423953_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	94.2	2.5e-179
WP_020953461.1|1424006_1424444_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.7	1.3e-66
WP_062955141.1|1424454_1424796_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	2.4e-36
WP_004152441.1|1424846_1425170_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
WP_062955139.1|1425169_1425775_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	77.0	4.0e-87
WP_062955138.1|1425774_1428252_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.4	0.0e+00
WP_004152438.1|1428251_1428716_+	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
WP_032447858.1|1428715_1429255_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	8.0e-71
WP_062955137.1|1429265_1431800_+	hypothetical protein	NA	Q858G0	Salmonella_phage	84.1	0.0e+00
WP_062955136.1|1431799_1433710_+	hypothetical protein	NA	Q858F9	Salmonella_phage	82.7	5.4e-287
WP_062955135.1|1433709_1436466_+	hypothetical protein	NA	Q858F8	Salmonella_phage	95.4	0.0e+00
WP_094820965.1|1436942_1437218_-	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	62.8	4.9e-24
WP_004152765.1|1437280_1438765_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_062955131.1|1441976_1442240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153233543.1|1442280_1443546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073547080.1|1443527_1444508_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.5e-184
WP_000608644.1|1445376_1446639_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_077265603.1|1447747_1449064_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A0K2FI18	Enterobacter_phage	32.3	2.3e-34
WP_062955010.1|1449150_1449555_+	hypothetical protein	NA	T1SA79	Salmonella_phage	81.1	8.7e-54
WP_023339240.1|1449541_1449847_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	2.7e-39
WP_062955009.1|1449836_1450466_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.9	1.8e-90
WP_062955008.1|1450462_1450963_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	76.9	1.3e-59
WP_004152009.1|1451149_1453018_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 5
NZ_CP047192	Klebsiella pneumoniae strain Kp36 chromosome, complete genome	5517016	1788241	1795146	5517016	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_072353998.1|1788241_1789105_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	7.4e-10
WP_094818808.1|1789115_1789889_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	5.1e-26
WP_002912636.1|1790129_1791023_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1791268_1792630_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|1792948_1793671_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_072353997.1|1793667_1795146_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.9e-29
>prophage 6
NZ_CP047192	Klebsiella pneumoniae strain Kp36 chromosome, complete genome	5517016	1838491	1849515	5517016	transposase	Escherichia_phage(33.33%)	9	NA	NA
WP_000043543.1|1838491_1839898_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_004180506.1|1840124_1841540_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
WP_039819506.1|1841561_1842932_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	25.9	6.4e-32
WP_039819536.1|1843086_1844151_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	9.8e-105
WP_023278825.1|1844164_1845034_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	1.7e-110
WP_004175259.1|1845065_1845956_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
WP_039819508.1|1845970_1846525_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	2.9e-52
WP_072353991.1|1846704_1847871_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	9.1e-112
WP_000019445.1|1848534_1849515_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 7
NZ_CP047192	Klebsiella pneumoniae strain Kp36 chromosome, complete genome	5517016	2843064	2853951	5517016		Escherichia_phage(87.5%)	9	NA	NA
WP_004151613.1|2843064_2846172_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|2846226_2847492_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2847522_2848611_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|2848697_2848958_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|2849255_2850116_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2850136_2850898_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_159351735.1|2851158_2852061_+	NAD-binding protein	NA	A0A077SLF7	Escherichia_phage	99.0	1.1e-157
WP_004151609.1|2852072_2853338_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_002210516.1|2853330_2853951_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 8
NZ_CP047192	Klebsiella pneumoniae strain Kp36 chromosome, complete genome	5517016	3082647	3121113	5517016	terminase,integrase	uncultured_Caudovirales_phage(34.04%)	56	3112226:3112240	3118235:3118249
WP_004152576.1|3082647_3083514_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152575.1|3083513_3084287_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|3084283_3085480_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|3085479_3085833_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|3085834_3086488_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152571.1|3086541_3087108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199301.1|3087150_3087333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|3087382_3087724_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|3087723_3088746_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152568.1|3088748_3089051_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_004152567.1|3089051_3089651_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152566.1|3089650_3091654_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|3091643_3091796_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|3091831_3092257_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004199809.1|3092260_3092701_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152177.1|3092711_3093857_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|3093860_3094301_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|3094395_3094782_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|3094781_3095288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|3095284_3095704_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|3095672_3095954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|3095993_3096935_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|3096946_3097441_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|3097444_3098647_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|3098698_3099247_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|3099302_3100754_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|3100991_3102392_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152171.1|3102342_3103095_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
WP_004152170.1|3103196_3103517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|3103751_3104141_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|3104137_3104668_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|3104670_3104919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152167.1|3105324_3106107_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|3106103_3106580_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|3106576_3107539_-	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|3107540_3109199_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|3109775_3109997_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|3110094_3110763_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|3110933_3111248_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|3111240_3111429_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|3111598_3111964_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152157.1|3111956_3112211_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004177208.1|3112182_3112401_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
3112226:3112240	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
WP_004152156.1|3112397_3112823_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|3112819_3113014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|3113010_3113838_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|3113942_3114461_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|3114466_3115177_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|3115166_3115391_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004152150.1|3115387_3115600_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152149.1|3115596_3116076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152148.1|3116254_3116497_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|3116477_3117659_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|3117855_3118404_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
3118235:3118249	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
WP_004152145.1|3118602_3120135_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|3120351_3121113_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 9
NZ_CP047192	Klebsiella pneumoniae strain Kp36 chromosome, complete genome	5517016	3154046	3180864	5517016	transposase,integrase,holin	Enterobacteria_phage(34.48%)	37	3153828:3153843	3178170:3178185
3153828:3153843	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_002901815.1|3154046_3154718_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
WP_071531199.1|3154904_3155732_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901813.1|3155807_3157073_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_002901812.1|3157074_3157494_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_001067855.1|3159247_3159952_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_062955100.1|3159988_3160276_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	95.4	4.4e-36
WP_004218565.1|3160272_3160812_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_024940884.1|3160808_3161108_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_022644626.1|3161586_3162633_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
WP_004232548.1|3162858_3163548_-	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
WP_004218534.1|3163547_3163688_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004218533.1|3163684_3164323_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
WP_004218532.1|3164315_3164984_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
WP_004243010.1|3164980_3165148_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_004218531.1|3165128_3165596_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
WP_004218530.1|3166116_3167145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196831.1|3167352_3167598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218528.1|3167653_3167956_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004201118.1|3167952_3168801_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
WP_004201117.1|3168797_3169658_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_001548453.1|3169743_3169965_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201115.1|3170005_3170233_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_004201113.1|3170344_3171043_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_019405077.1|3171065_3171185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201109.1|3171330_3172407_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_004201108.1|3172488_3172692_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004135674.1|3173120_3173315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201105.1|3173403_3173688_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004201103.1|3173703_3174549_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_088224434.1|3174545_3174833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201102.1|3174834_3175515_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_004151898.1|3175511_3175940_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004151899.1|3175936_3176599_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004153574.1|3176806_3177994_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
WP_004151901.1|3178170_3179061_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
3178170:3178185	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_004140266.1|3179060_3180053_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|3180054_3180864_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 10
NZ_CP047192	Klebsiella pneumoniae strain Kp36 chromosome, complete genome	5517016	3308536	3439325	5517016	transposase,capsid,tail,protease,holin,tRNA,terminase,integrase,lysis,head,portal	Klebsiella_phage(31.11%)	147	3335339:3335353	3437136:3437150
WP_002901088.1|3308536_3309037_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|3309153_3309600_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901073.1|3309583_3310375_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004150777.1|3310476_3311661_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140471.1|3311692_3312385_-	CTP synthase	NA	NA	NA	NA	NA
WP_004150778.1|3312530_3313040_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004150779.1|3313026_3313383_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004150780.1|3313372_3313612_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004150781.1|3313912_3314926_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.4e-12
WP_004150782.1|3314983_3315085_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_099119317.1|3315084_3315159_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|3315276_3315402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|3315461_3315725_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|3315855_3316494_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|3316583_3317498_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150784.1|3318159_3319203_-	type II asparaginase	NA	NA	NA	NA	NA
WP_004150785.1|3319505_3320714_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004150787.1|3320787_3322572_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004150788.1|3322578_3323469_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004140497.1|3323589_3325098_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150790.1|3325408_3326095_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_153233540.1|3326544_3326733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|3326711_3327344_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140506.1|3327910_3328108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140509.1|3328223_3329234_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004150793.1|3329230_3330637_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004140512.1|3330692_3331580_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140514.1|3331596_3332103_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150794.1|3332129_3332624_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150795.1|3332714_3332900_-	general stress protein	NA	NA	NA	NA	NA
WP_004140529.1|3333521_3334715_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004140530.1|3334827_3335055_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
3335339:3335353	attL	TGGCTGGCGTTCTTT	NA	NA	NA	NA
WP_004150797.1|3335491_3335815_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004150798.1|3335807_3336200_+	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004150799.1|3336196_3336910_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004892953.1|3337182_3337335_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_023328083.1|3337489_3338986_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	63.7	1.4e-125
WP_062955111.1|3339054_3351759_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	47.1	0.0e+00
WP_023328085.1|3351821_3352415_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	76.6	8.0e-80
WP_047666390.1|3352441_3352864_-	hypothetical protein	NA	J9Q806	Salmonella_phage	50.0	5.9e-29
WP_047666389.1|3352905_3353616_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	90.3	1.9e-136
WP_023328087.1|3353617_3354373_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.5	4.6e-125
WP_023328088.1|3354369_3354708_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	1.4e-57
WP_023328089.1|3354707_3358043_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.3	0.0e+00
WP_014228914.1|3358275_3358641_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_023328090.1|3358698_3359160_-	hypothetical protein	NA	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_023328091.1|3359191_3359593_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	2.3e-62
WP_017880258.1|3359589_3359979_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
WP_023328092.1|3359959_3360298_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	90.2	2.8e-53
WP_020317538.1|3360294_3360612_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
WP_049010370.1|3360592_3360853_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	60.5	7.4e-22
WP_023328094.1|3360911_3362198_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.0	9.8e-216
WP_014907815.1|3362275_3363196_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
WP_023279520.1|3363232_3364492_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.8	1.8e-222
WP_017898992.1|3364491_3364671_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
WP_021462603.1|3364664_3366386_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.5e-190
WP_012542168.1|3366385_3366820_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_014907818.1|3367068_3367500_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.6	1.8e-41
WP_023297386.1|3367496_3367820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032428746.1|3367771_3368134_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
WP_032749552.1|3368460_3368685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049115059.1|3368723_3369161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016160650.1|3370110_3370461_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	38.1	7.9e-11
WP_032432826.1|3370457_3370955_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.6	1.1e-77
WP_016160648.1|3370954_3371170_-|lysis	phage S lysis protein	lysis	A5LH82	Enterobacteria_phage	88.7	2.7e-30
WP_004147999.1|3372087_3372237_+	small membrane protein	NA	NA	NA	NA	NA
WP_004147997.1|3372974_3373178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025861432.1|3373421_3374024_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.6	1.1e-76
WP_062955112.1|3374040_3375072_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	4.7e-96
WP_025861428.1|3375271_3375664_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	8.0e-12
WP_077255782.1|3375704_3375995_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	8.0e-17
WP_025368263.1|3376006_3376240_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	3.7e-25
WP_004152765.1|3376318_3377803_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_062954975.1|3378643_3380005_-	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_062954976.1|3380178_3380892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019445.1|3381556_3382537_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_062954977.1|3383401_3384793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032443841.1|3385141_3385582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047667474.1|3385595_3386060_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	72.2	4.1e-63
WP_077265602.1|3386052_3387057_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	40.0	1.0e-31
WP_046622349.1|3387116_3387671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071561166.1|3387673_3387898_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	62.5	1.3e-19
WP_077257742.1|3387986_3388424_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	62.2	1.3e-39
WP_040234937.1|3388745_3389060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023279538.1|3389450_3389645_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_014228879.1|3389687_3390032_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_062954978.1|3390173_3392312_+	exodeoxyribonuclease VIII	NA	S4TNL0	Salmonella_phage	42.7	5.6e-99
WP_012542206.1|3392364_3392610_+	excisionase	NA	NA	NA	NA	NA
WP_032418030.1|3392590_3393718_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.4	4.4e-119
WP_094818795.1|3393835_3394018_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	3.7e-20
WP_049182670.1|3394399_3395161_-	hypothetical protein	NA	Q6J1W3	Lactobacillus_phage	29.4	2.5e-09
WP_094818794.1|3396195_3396921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094818793.1|3396972_3398238_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.9	8.1e-207
WP_042934076.1|3398240_3398660_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	56.7	1.2e-34
WP_064155591.1|3398738_3398981_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	81.0	1.6e-31
WP_031592310.1|3398980_3399223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094818792.1|3399998_3400751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094818791.1|3400761_3402930_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	45.1	6.7e-100
WP_094818790.1|3403007_3406076_-	kinase	NA	A0A286S259	Klebsiella_phage	66.3	0.0e+00
WP_094818789.1|3406072_3406459_-	nitrite transporter	NA	H2BD94	Pseudomonas_phage	35.7	4.0e-16
WP_038433285.1|3406466_3406949_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	67.7	8.5e-56
WP_032420722.1|3406935_3407409_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	63.5	3.9e-53
WP_094818788.1|3407408_3410105_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	62.4	4.9e-201
WP_032420719.1|3410085_3410403_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	51.5	1.4e-19
WP_025714420.1|3410423_3410819_-|tail	phage tail protein	tail	M9NZD7	Enterobacteria_phage	27.5	1.9e-08
WP_023304948.1|3410861_3411344_-	hypothetical protein	NA	M9NYX0	Enterobacteria_phage	68.6	5.7e-60
WP_020804325.1|3411351_3411750_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	57.8	3.2e-40
WP_048291628.1|3411746_3412298_-|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	67.3	1.6e-53
WP_020317349.1|3412287_3412581_-	sugar ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_049186541.1|3412573_3412900_-	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	66.4	4.0e-33
WP_094818787.1|3412980_3414996_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	84.2	0.0e+00
WP_020317329.1|3414940_3416440_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.6	1.1e-247
WP_094818786.1|3416436_3416652_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	75.7	6.5e-24
WP_094818785.1|3416648_3418757_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	83.5	0.0e+00
WP_014228567.1|3418756_3419248_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	84.0	6.4e-67
WP_072002796.1|3419568_3419754_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	61.1	2.4e-11
WP_108918987.1|3419821_3420082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004216876.1|3420308_3420554_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	3.0e-33
WP_116723292.1|3420943_3421132_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	89.8	6.3e-23
WP_094818783.1|3421082_3421358_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	46.7	8.6e-13
WP_094818782.1|3421354_3421702_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	78.3	3.0e-39
WP_019704505.1|3421698_3422238_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.3	5.7e-101
WP_024176410.1|3422234_3422534_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	83.8	4.5e-39
WP_040210598.1|3422703_3422943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094818781.1|3423093_3423672_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.7	2.2e-50
WP_094818780.1|3423685_3424666_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	67.5	2.7e-133
WP_065519871.1|3424678_3425056_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	3.9e-48
WP_094818779.1|3425065_3425875_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	68.9	5.9e-110
WP_094818778.1|3425871_3426786_-	transcriptional regulator	NA	H2DE83	Erwinia_phage	60.6	1.8e-30
WP_023317571.1|3426742_3426955_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	72.7	2.2e-16
WP_004213338.1|3427192_3427654_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_024176406.1|3427679_3427889_-	cell division protein	NA	NA	NA	NA	NA
WP_019705289.1|3427983_3428628_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	40.7	8.2e-38
WP_094818777.1|3428927_3429851_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	62.9	1.5e-104
WP_040186300.1|3429936_3430236_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	47.8	1.0e-14
WP_094818776.1|3430235_3431021_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.6	1.3e-61
WP_094818775.1|3431148_3431640_+	hypothetical protein	NA	E7C9P6	Salmonella_phage	53.4	5.1e-32
WP_064151808.1|3431636_3431900_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	78.0	1.1e-30
WP_094818774.1|3431892_3432537_+	hypothetical protein	NA	A0A2R2Z312	Escherichia_phage	42.8	1.1e-39
WP_004141386.1|3432536_3432749_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_038435237.1|3433544_3433763_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	51.7	3.0e-08
WP_000089156.1|3434063_3434300_+	excisionase	NA	NA	NA	NA	NA
WP_000741346.1|3434289_3435432_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	82.2	9.1e-173
WP_094818773.1|3435545_3436796_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
WP_004150801.1|3437036_3437687_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
3437136:3437150	attR	AAAGAACGCCAGCCA	NA	NA	NA	NA
WP_004150802.1|3437703_3438162_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150803.1|3438218_3439325_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 11
NZ_CP047192	Klebsiella pneumoniae strain Kp36 chromosome, complete genome	5517016	3658960	3751911	5517016	capsid,tail,protease,plate,tRNA,terminase,integrase,lysis,head,portal	Salmonella_phage(56.9%)	93	3714486:3714504	3751986:3752004
WP_002898139.1|3658960_3660253_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3660343_3661687_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3661695_3662307_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|3662429_3666683_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|3666818_3667313_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004141839.1|3667818_3668814_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.3e-62
WP_002898017.1|3668928_3670695_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|3670695_3672417_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3672461_3673163_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3673516_3673735_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3673855_3676135_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3676165_3676483_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3676808_3677030_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3677106_3679047_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3679043_3680159_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|3680305_3681964_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3682383_3683079_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3683194_3684094_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|3684237_3685890_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|3685900_3686869_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|3687080_3687515_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|3687666_3689385_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|3689423_3690425_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|3690435_3691878_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3691965_3692979_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|3692975_3693806_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|3693837_3694977_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|3695854_3696370_+	lipoprotein	NA	NA	NA	NA	NA
WP_032419144.1|3696596_3697325_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3697345_3698077_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3698083_3698800_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|3698799_3699468_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3699651_3700383_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|3700425_3701898_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3701894_3702611_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3702689_3703817_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|3703858_3704347_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3704404_3705250_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3705246_3706200_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|3706210_3707344_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|3707507_3708620_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3708968_3709448_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3709536_3710439_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|3711260_3711548_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3711750_3712014_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3712020_3712404_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|3712670_3714356_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3714486:3714504	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|3714575_3714794_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|3714885_3715986_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|3715982_3716468_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896222.1|3716464_3719092_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896220.1|3719084_3719204_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|3719218_3719518_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|3719570_3720086_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|3720095_3721268_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|3721406_3722483_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896188.1|3722512_3722716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|3722712_3723444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152882.1|3723447_3726399_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_004150856.1|3726400_3727000_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|3726992_3727901_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_032441567.1|3727887_3728250_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	4.9e-48
WP_002896177.1|3728246_3728819_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004150857.1|3728913_3729606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|3729602_3730049_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|3730041_3730473_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896168.1|3730568_3730997_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|3730993_3731377_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|3731381_3731891_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|3731871_3732087_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|3732090_3732294_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|3732293_3732758_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|3732853_3733504_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|3733507_3734566_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|3734582_3735416_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|3735558_3737325_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|3737324_3738350_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|3738411_3740154_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|3740429_3741107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3741221_3741455_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3741465_3741654_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004150862.1|3741807_3744222_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|3744218_3745076_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|3745072_3745300_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|3745299_3745533_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|3745600_3745942_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|3745905_3746106_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|3746113_3746623_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|3746655_3746877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|3747022_3747901_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|3747912_3748857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|3748955_3750440_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151720.1|3750858_3751911_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
3751986:3752004	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 12
NZ_CP047192	Klebsiella pneumoniae strain Kp36 chromosome, complete genome	5517016	4406384	4418038	5517016	integrase	Enterobacteria_phage(70.0%)	13	4406834:4406848	4429891:4429905
WP_004144574.1|4406384_4407488_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4406834:4406848	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_002889940.1|4407498_4408752_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4409104_4410295_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4410282_4411233_+	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_004152979.1|4411232_4411658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152202.1|4412225_4412792_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152203.1|4412809_4413055_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_062956184.1|4413051_4413789_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.9e-70
WP_002889915.1|4414331_4414598_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_024940872.1|4414594_4415152_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|4415148_4415376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4415372_4415693_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|4415704_4418038_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
4429891:4429905	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 13
NZ_CP047192	Klebsiella pneumoniae strain Kp36 chromosome, complete genome	5517016	4886285	4895810	5517016	transposase	Enterobacteria_phage(83.33%)	10	NA	NA
WP_004152207.1|4886285_4888619_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
WP_004152206.1|4888633_4888954_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152205.1|4888950_4889178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153681.1|4889174_4889723_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_004152204.1|4890546_4891284_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004152203.1|4891280_4891526_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152202.1|4891543_4892110_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152201.1|4892850_4893930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152200.1|4893930_4894467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019445.1|4894829_4895810_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 1
NZ_CP047193	Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence	219800	11643	137592	219800	transposase,protease	Bacillus_phage(15.15%)	106	NA	NA
WP_004213850.1|11643_12567_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	1.7e-166
WP_094818822.1|12678_13245_+	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
WP_011251259.1|15860_16514_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000019445.1|16849_17830_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_004213609.1|18256_18889_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_004213611.1|19269_19821_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004213613.1|19893_20796_+	DMT family transporter	NA	NA	NA	NA	NA
WP_004213615.1|20938_21160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019445.1|22594_23575_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_004026357.1|24384_24828_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_004026354.1|24824_25295_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_004212794.1|28653_29148_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	38.6	5.9e-20
WP_004212796.1|29484_29883_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_000427619.1|30329_31334_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_004212797.1|31527_32367_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	35.7	3.7e-46
WP_004212799.1|32363_32843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045145446.1|32839_33025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011154571.1|33427_33658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004212803.1|33843_35619_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004212804.1|35637_37164_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004212807.1|37174_38419_-	MFS transporter	NA	NA	NA	NA	NA
WP_004212808.1|38445_39279_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.0	1.1e-10
WP_004212810.1|39275_40121_-	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	26.0	1.9e-10
WP_004212814.1|40313_40988_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_011154565.1|41698_42184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004212823.1|43642_44143_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_004212825.1|44287_44689_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_004212827.1|44725_45946_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_004212831.1|46214_47864_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_094818814.1|47874_49005_-	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011251268.1|50536_50989_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_014599314.1|51086_52286_+	cobalamin biosynthesis protein CobW	NA	NA	NA	NA	NA
WP_004214547.1|52356_52779_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_011251270.1|52842_53778_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_004214543.1|53767_54328_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_004214541.1|54394_55324_+	hypothetical protein	NA	A0A140B3P3	Vibrio_phage	25.2	1.5e-11
WP_004214540.1|55340_56165_-	DUF1460 domain-containing protein	NA	NA	NA	NA	NA
WP_011251272.1|56594_57596_+	TGS domain-containing protein	NA	A0A2K9L6B6	Tupanvirus	41.5	9.7e-54
WP_004214538.1|57588_58440_+	M14 family metallocarboxypeptidase	NA	NA	NA	NA	NA
WP_011154555.1|58436_59783_+	dihydroorotase	NA	NA	NA	NA	NA
WP_004214536.1|59846_60869_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_011251273.1|63031_63346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011251275.1|63854_64295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011251280.1|64719_65676_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_011251281.1|65735_66077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011251282.1|66090_66402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011251285.1|68343_68655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011251286.1|68651_69071_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_048333456.1|69262_70186_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.5	7.3e-165
WP_040217257.1|70636_71425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159351770.1|71445_71889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048333570.1|73432_73903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213850.1|73969_74893_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	1.7e-166
WP_004213594.1|75126_75621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000427619.1|75906_76911_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_004213592.1|76989_79959_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.3	0.0e+00
WP_004213590.1|79961_80519_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	2.6e-48
WP_000118563.1|80648_81725_-	signal peptidase II	NA	NA	NA	NA	NA
WP_004213585.1|81721_84127_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	46.1	1.0e-141
WP_000405672.1|84212_84647_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000427619.1|84737_85742_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_004152084.1|86269_87670_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_001188930.1|87666_88347_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004213583.1|88401_89331_-	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_000025662.1|89335_89716_-	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_011251290.1|89755_90652_-	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_004213580.1|90651_92469_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_048336866.1|92702_93170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118669.1|93436_94174_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_000843497.1|94207_94405_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004098955.1|94445_96893_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000758228.1|97019_97460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004098958.1|97546_100693_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_004213579.1|100703_101996_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004213578.1|102109_102472_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004213577.1|102500_103886_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_004213574.1|104075_104756_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.7	1.3e-30
WP_000555737.1|104748_106224_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_023302802.1|106474_106906_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_004213569.1|107049_107400_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	53.3	3.2e-20
WP_023302803.1|107786_108695_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_004213565.1|109331_110306_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_004213078.1|110609_110900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004225022.1|110889_111789_+	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_004215174.1|111837_114063_-	exclusion suppressor FxsA	NA	NA	NA	NA	NA
WP_004215173.1|114064_114967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004225020.1|115050_115233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004215188.1|115251_115713_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004215186.1|115828_116776_+	DMT family transporter	NA	NA	NA	NA	NA
WP_004225018.1|117111_118107_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.7	3.1e-20
WP_004210218.1|118312_119326_-	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	26.0	5.8e-06
WP_004210220.1|119438_119966_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_077250518.1|119979_122937_+|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	22.8	2.3e-50
WP_004144375.1|123778_124639_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	21.7	9.0e-08
WP_011251321.1|126370_127006_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_011251320.1|127342_128584_-	tellurium resistance protein TerF	NA	A0A2D1GNA9	Pseudoalteromonas_phage	27.2	2.2e-10
WP_000301240.1|128668_129244_-	tellurium resistance cAMP binding protein TerE	NA	K4JRX3	Caulobacter_phage	41.6	9.6e-30
WP_004026609.1|129330_129909_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	40.8	1.9e-33
WP_004026607.1|129947_130988_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	46.5	1.8e-71
WP_004026604.1|131011_131467_-	tellurium resistance membrane protein TerB	NA	NA	NA	NA	NA
WP_011251319.1|131489_132641_-	tellurium resistance system protein TerA	NA	NA	NA	NA	NA
WP_004196925.1|132637_133222_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	29.4	2.0e-11
WP_011251317.1|133532_134591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181731.1|134602_135745_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	28.5	3.7e-33
WP_004181732.1|135737_136511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026596.1|136512_137592_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	1.7e-40
>prophage 2
NZ_CP047193	Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence	219800	175055	184224	219800	transposase	Stx2-converting_phage(25.0%)	8	NA	NA
WP_004213807.1|175055_176024_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	7.3e-14
WP_004902302.1|176351_177944_-|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	3.2e-176
WP_004189161.1|177974_178325_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_004215130.1|178321_178762_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	53.8	4.4e-19
WP_004902307.1|178958_179141_+	DUF4113 domain-containing protein	NA	A0A1W6JNT0	Morganella_phage	57.1	9.1e-11
WP_004117790.1|180346_181318_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
WP_004211841.1|181317_182484_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.4	2.0e-223
WP_004211839.1|183213_184224_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	53.5	1.1e-86
>prophage 1
NZ_CP047194	Klebsiella pneumoniae strain Kp36 plasmid unnamed2, complete sequence	142228	2671	50197	142228	transposase,integrase	Escherichia_phage(35.0%)	58	3016:3075	48574:49393
WP_159351772.1|2671_3028_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A077SL39	Escherichia_phage	99.1	5.5e-60
3016:3075	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067855.1|3067_3772_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_159351774.1|3783_4107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040245917.1|4121_4472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040245921.1|4468_4741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014343509.1|5433_5592_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_014343510.1|5819_6194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013023807.1|6249_6576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568058.1|6572_7301_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001568057.1|7297_7729_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_015493064.1|7773_9831_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	25.4	1.2e-21
WP_001568055.1|9900_10149_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_014343512.1|10197_10740_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	4.6e-50
WP_014343514.1|11572_12136_-	methyltransferase	NA	A0A2I7RHK4	Vibrio_phage	34.3	7.4e-19
WP_014343515.1|12183_13539_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_001568051.1|13590_13821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568050.1|13912_14140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568049.1|14819_15140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011977779.1|15174_15429_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	48.8	4.0e-12
WP_001568047.1|15616_15808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013214014.1|15850_16357_-	antirestriction protein	NA	G9FHQ1	Rhodococcus_virus	31.4	1.2e-07
WP_013023797.1|16399_17065_-	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_013214013.1|17508_18276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568043.1|18329_18749_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001568042.1|18758_18980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568041.1|18979_19681_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
WP_001568040.1|20117_20348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013214012.1|20410_21082_-	mediator of plasmid stability	NA	NA	NA	NA	NA
WP_004152353.1|21084_22056_-	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_004152765.1|22304_23789_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_001568036.1|24198_24630_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_013214011.1|24629_25901_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	7.5e-152
WP_086523286.1|25982_26960_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	53.8	1.4e-86
WP_011977818.1|26956_28162_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	5.3e-163
WP_004118283.1|29271_30138_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_013214010.1|30915_31173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013214009.1|31218_31998_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.4e-52
WP_011977814.1|32181_33186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011977813.1|33215_33419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013214008.1|33464_33986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032738650.1|34043_34394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011977810.1|34472_35417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261282.1|35995_36226_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044770.1|36222_36639_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_004206609.1|36712_38275_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000361404.1|38259_39282_+	helicase UvrD	NA	NA	NA	NA	NA
WP_000427619.1|40815_41820_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000429836.1|41898_42333_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|42404_42755_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732292.1|42768_43044_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|43079_43502_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|43553_45248_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|45265_45628_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|45624_45861_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000204520.1|45857_46565_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|47876_48581_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014343468.1|48620_49094_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	99.3	3.3e-76
WP_013213985.1|49216_50197_+|transposase	IS481-like element ISKpn27 family transposase	transposase	A8RHK4	Spiroplasma_virus	27.4	2.9e-10
48574:49393	attR	AAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCTCTTTACCGACAAGGCATCCGGCAGTTCAACAGATCGGGAAGGGCTGGATTTGCTGAGGATGAAGGTGGAGGAAGGTGATGTCATTCTGGTGAAGAAGCTCGACCGTCTTGGCCGCGACACCGCCGACATGATCCAACTGATAAAAGAGTTTGATGCTCAGGGTGTCGCGGTTCGGTTTATTGACGACGGGATCAGTACCGACGGTGATATGGGGCAAATGGTGGTCACCATCCTGTCGGCTGTGGCACAAGCTGAACGCCGGAGGATCCTAGAGCGCACGAATGAGGGCCGACAGGAAGCAAAGCTGAAAGGAATCAAATTTGGCCGCAGGCGTACCGTGGACAGGAACGTCGTGCTGACGCTTCATCAGAAGGGCACTGGTGCAACGGAAATTGCTCATCAGCTCAGTATTGCCCGCTCCACGGTTTATAAAATTCTTGAAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTGTCTGGACTCGTGGGATCATGTACCCATGCGTAGCTGGCCGCTCTTCAAGGCCAGACACGTTTTGCGTACACTGTTCCAATCCGACTCTTCACTGGCAACTCGATGACCCAGGCACTGCACAGCCAAGCCCGTACTACCCACCTGATCCGTGAGGAAATCAGGAACTCGACGCTCCCGCAGGCCGAACTGGCCAGGATGTACAACGTCACCCGCCAAACCATCCGAAAGTGGCAAAACCGCGAGTCTCCTGAAGACAAGTCGCATGCGCCGAACAAGATG	NA	NA	NA	NA
>prophage 2
NZ_CP047194	Klebsiella pneumoniae strain Kp36 plasmid unnamed2, complete sequence	142228	53213	62148	142228	transposase	Escherichia_phage(50.0%)	7	NA	NA
WP_013213989.1|53213_53639_-	antirestriction protein	NA	A0A2D0W8Z5	Bordetella_virus	37.3	5.3e-17
WP_013213990.1|53749_54028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001161490.1|55570_56131_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001138014.1|56134_59101_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_002904004.1|59341_60202_+	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|60222_60984_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|61245_62148_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
>prophage 3
NZ_CP047194	Klebsiella pneumoniae strain Kp36 plasmid unnamed2, complete sequence	142228	112667	126742	142228	transposase	Escherichia_phage(60.0%)	13	NA	NA
WP_001067858.1|112667_113372_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_012372818.1|113821_114577_-	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_000027057.1|114746_115607_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_064441864.1|115789_116326_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	2.8e-84
WP_000957857.1|116417_116606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|117283_117988_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014839980.1|118373_118790_+	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_014839979.1|118794_119313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|119378_120083_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|121193_121898_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_012579081.1|123648_124572_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
WP_013188475.1|124651_125527_-	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
WP_001067855.1|126037_126742_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 4
NZ_CP047194	Klebsiella pneumoniae strain Kp36 plasmid unnamed2, complete sequence	142228	134809	140743	142228	transposase	Escherichia_phage(33.33%)	8	NA	NA
WP_000205770.1|134809_135556_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	4.2e-09
WP_001067855.1|135800_136505_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014343501.1|137451_137808_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	7.5e-25
WP_014343500.1|137868_138081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343499.1|138091_138316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343498.1|138396_138717_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	1.5e-08
WP_004152721.1|138706_138985_+	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
WP_004152492.1|139921_140743_+	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.1	1.2e-44
>prophage 1
NZ_CP047195	Klebsiella pneumoniae strain Kp36 plasmid unnamed3, complete sequence	87117	0	3769	87117		Enterobacteria_phage(100.0%)	2	NA	NA
WP_001516695.1|657_1314_-	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_012477595.1|2911_3769_-	class A beta-lactamase LAP-2	NA	Q1MVP3	Enterobacteria_phage	61.1	2.0e-92
>prophage 2
NZ_CP047195	Klebsiella pneumoniae strain Kp36 plasmid unnamed3, complete sequence	87117	10277	30534	87117	integrase,transposase	Escherichia_phage(35.71%)	22	12432:12491	25718:26539
WP_001067855.1|10277_10982_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001011939.1|11125_11767_-	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
WP_001239317.1|11916_12417_-	hypothetical protein	NA	NA	NA	NA	NA
12432:12491	attL	AGGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGC	NA	NA	NA	NA
WP_001067855.1|12496_13201_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001044210.1|13206_13347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001446887.1|13832_14570_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000743213.1|14566_14791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|15001_16495_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_071881958.1|16525_16777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|16670_16973_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|17059_17875_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000954592.1|18204_18381_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_000427619.1|18562_19567_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|21463_22168_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004201280.1|22414_22888_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_000845048.1|23043_24057_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_094818827.1|24449_24974_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	48.4	1.2e-31
WP_001067855.1|25007_25712_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_053897648.1|25736_27293_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.1e-83
25718:26539	attR	GCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCTTTCGACTACCTCCCCTCAAAGCCATATCACGTACGTTAATCCTGACTTCATTAAAATCAGTGGTTTCACTGAGGAAGAACTATTAGGCCAGCCTCACAACATCGTAAGACACCCAGATATGCCGCCTGCTGCATTTGAGCATATGTGGAGTACATTAAAATCTGGCCGCTCATGGATGGGGCTAGTAAAAAATCGCTGTAAAAATGGCGACCACTATTGGGTAAGTGCTTATGTAACGCCAATAGCTAAGAATGGTTCGATTGTTGAATACCAGTCTGTAAGGACCAAGCCTGAACCTGAGCAGGTTTTGGCTGCGGAAAAATTATATGCTCAATTGAGAAGCGGGAAGGCCGCGAGGCCGAAATTGGCTGCTAGCTTTTCCGTGAAAATACTCTTGCTCATATGGGGTAGTATTATATCAAGCGCAATGGCTGCCGGCATGCTTACTGATACATCAATAAGCAGCTTATTGTTAGCCACTTTAATGTCAGGAAGCTTAAGCTCTGTTAGTGTTTTGGCTATTCTCTCTCCTCTTGGAAGACTGGTTGAAAGAGCCAGGAATATTTCCAATAACCCATTAAGTCAATCCCTCTACACTGGGCGCACCGATGAGTTTGGCCAAATAGAGTTTGCTTTACGAATGATGCAAGCTGAAACAGGCGCCATAGTAGGTCGCATAGGTGATGCATCAAATCGGCTTAGCGAACACACCCGAGGCCTACTAAAGGATATTGAGTCAAGCAATGTACTTACAGTTGAGCA	NA	NA	NA	NA
WP_108970993.1|27440_28220_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	51.0	3.7e-69
WP_045325066.1|28219_28645_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	49.3	3.7e-31
WP_004152765.1|29049_30534_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
>prophage 3
NZ_CP047195	Klebsiella pneumoniae strain Kp36 plasmid unnamed3, complete sequence	87117	33609	34143	87117		Wolbachia_phage(100.0%)	1	NA	NA
WP_032440594.1|33609_34143_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	34.6	7.0e-19
>prophage 4
NZ_CP047195	Klebsiella pneumoniae strain Kp36 plasmid unnamed3, complete sequence	87117	52638	56052	87117		Alteromonas_phage(100.0%)	1	NA	NA
WP_052145516.1|52638_56052_-	hypothetical protein	NA	A0A1J0GWC9	Alteromonas_phage	44.2	2.5e-16
>prophage 5
NZ_CP047195	Klebsiella pneumoniae strain Kp36 plasmid unnamed3, complete sequence	87117	63165	64860	87117		Hokovirus(100.0%)	1	NA	NA
WP_032440570.1|63165_64860_+	response regulator	NA	A0A1V0SGX0	Hokovirus	27.9	2.1e-24
>prophage 6
NZ_CP047195	Klebsiella pneumoniae strain Kp36 plasmid unnamed3, complete sequence	87117	72368	73229	87117		Marinomonas_phage(100.0%)	1	NA	NA
WP_032440562.1|72368_73229_-	DUF4942 domain-containing protein	NA	I6RTT5	Marinomonas_phage	29.9	2.8e-17
>prophage 7
NZ_CP047195	Klebsiella pneumoniae strain Kp36 plasmid unnamed3, complete sequence	87117	76624	79465	87117	integrase	Enterobacteria_phage(33.33%)	4	75830:75845	83371:83386
75830:75845	attL	TTATTTCCCGCCTGGA	NA	NA	NA	NA
WP_032440558.1|76624_77599_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	51.7	7.2e-86
WP_086556681.1|77839_78517_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	51.6	8.7e-22
WP_032440556.1|78646_79132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032440555.1|79216_79465_-	helix-turn-helix transcriptional regulator	NA	A0A248SLB9	Klebsiella_phage	51.5	1.6e-10
83371:83386	attR	TTATTTCCCGCCTGGA	NA	NA	NA	NA
>prophage 8
NZ_CP047195	Klebsiella pneumoniae strain Kp36 plasmid unnamed3, complete sequence	87117	82882	85546	87117		Shigella_phage(25.0%)	5	NA	NA
WP_000493286.1|82882_83212_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_000780222.1|83192_83474_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_077256884.1|83620_84196_-	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	59.3	1.6e-45
WP_012477564.1|84246_84837_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_001493762.1|84973_85546_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
