The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP033623	Serratia marcescens strain N10A28 chromosome, complete genome	5276341	1040030	1049109	5276341		Hokovirus(16.67%)	8	NA	NA
WP_100396910.1|1040030_1041455_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.3	8.1e-54
WP_159317843.1|1041469_1042843_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	29.0	1.8e-34
WP_100396912.1|1042988_1044005_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.5	4.7e-80
WP_049202254.1|1044419_1044953_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	59.8	2.8e-60
WP_060440339.1|1044952_1045819_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	39.8	2.2e-38
WP_060440338.1|1045989_1046838_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_060440337.1|1046960_1047794_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_033637760.1|1047783_1049109_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	1.1e-15
>prophage 2
NZ_CP033623	Serratia marcescens strain N10A28 chromosome, complete genome	5276341	1391023	1435578	5276341	holin,terminase,head,integrase	Pectobacterium_phage(23.91%)	55	1390922:1390946	1435748:1435772
1390922:1390946	attL	AGGAATCGTATTCGGTCTTTTTTTG	NA	NA	NA	NA
WP_103682073.1|1391023_1392106_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.7	5.3e-98
WP_080435747.1|1392080_1392422_-	hypothetical protein	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	39.5	2.2e-10
WP_103682074.1|1392387_1392594_-	hypothetical protein	NA	H9C154	Pectobacterium_phage	55.6	8.7e-10
WP_103682075.1|1392863_1393364_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	68.7	4.4e-55
WP_103682076.1|1393360_1395517_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.7	1.9e-99
WP_103682077.1|1395568_1395847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060435313.1|1395857_1396175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079451881.1|1396660_1397062_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	59.4	9.3e-40
WP_072269387.1|1397140_1397341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151888345.1|1397402_1397855_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	56.1	2.2e-29
WP_103682079.1|1397879_1398098_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	59.4	5.4e-18
WP_103682080.1|1398100_1398859_+	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	52.9	1.3e-61
WP_103682081.1|1398848_1400264_+	AAA family ATPase	NA	H9C165	Pectobacterium_phage	67.5	8.3e-176
WP_103682082.1|1400307_1400730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103682083.1|1400733_1400979_+	hypothetical protein	NA	H9C167	Pectobacterium_phage	47.6	5.0e-12
WP_103682084.1|1400975_1403150_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	52.8	1.3e-228
WP_159317906.1|1403190_1404231_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_103682087.1|1404809_1405403_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	66.5	3.1e-76
WP_103682088.1|1405399_1405684_+	DUF1364 domain-containing protein	NA	H9C174	Pectobacterium_phage	75.5	3.7e-35
WP_103682089.1|1405683_1406082_+	antitermination protein Q	NA	B6SCY2	Bacteriophage	56.7	6.4e-33
WP_143778881.1|1407323_1407662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103682091.1|1407835_1408183_+|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	65.5	5.4e-28
WP_103682092.1|1408169_1408610_+	lysozyme	NA	A0A0M5M782	Salmonella_phage	68.5	7.8e-48
WP_103682118.1|1408633_1408990_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_103682093.1|1409230_1409560_+	TonB family protein	NA	H6WZK5	Escherichia_phage	37.3	4.6e-13
WP_103682094.1|1409706_1410708_+|terminase	terminase	terminase	A0A0U2RXW9	Escherichia_phage	49.1	3.8e-50
WP_089191841.1|1410637_1412050_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.9	1.4e-186
WP_103682095.1|1412049_1413594_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	42.2	2.0e-98
WP_103682119.1|1413634_1414318_+|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	50.0	1.9e-56
WP_103682096.1|1414321_1415647_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	40.9	1.4e-71
WP_038875760.1|1415648_1416131_+	hypothetical protein	NA	E2GLV4	Acinetobacter_phage	51.5	3.0e-29
WP_103682097.1|1416130_1417159_+	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	49.4	7.8e-83
WP_103682098.1|1417162_1417507_+	hypothetical protein	NA	A0A1X9SFA9	Acinetobacter_phage	40.5	5.7e-14
WP_038875751.1|1417510_1417981_+	DUF4054 domain-containing protein	NA	K4HYQ8	Acinetobacter_phage	37.0	4.8e-11
WP_103682099.1|1417981_1418461_+	hypothetical protein	NA	K4PB52	Acinetobacter_phage	33.1	1.6e-09
WP_049194153.1|1418457_1418823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047730616.1|1418807_1419359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103682100.1|1419339_1420824_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	38.2	2.3e-91
WP_038875737.1|1420823_1421261_+	hypothetical protein	NA	A0A077K9T0	Edwardsiella_phage	38.1	2.3e-20
WP_049194151.1|1421260_1421665_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.5	4.1e-19
WP_103682101.1|1421879_1423808_+	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	59.8	3.8e-54
WP_103682102.1|1423804_1424611_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	36.9	4.8e-27
WP_047730622.1|1424610_1424913_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	52.5	1.3e-25
WP_060419438.1|1424909_1425755_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.6	1.1e-34
WP_103682103.1|1425756_1426434_+	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	39.8	9.5e-37
WP_103682120.1|1426442_1426799_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	3.5e-22
WP_103682104.1|1426795_1428043_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	49.8	1.0e-100
WP_103682105.1|1428044_1428632_+	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	38.7	3.5e-35
WP_103682106.1|1428633_1430145_+	hypothetical protein	NA	H9C0Y2	Aeromonas_phage	50.8	1.3e-25
WP_103682107.1|1430147_1430702_+	hypothetical protein	NA	A0A0C4UQZ5	Shigella_phage	38.8	4.3e-27
WP_159318949.1|1430718_1432161_-	hypothetical protein	NA	A8CG94	Salmonella_phage	23.2	6.8e-16
WP_060447306.1|1432174_1433086_-	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	76.9	4.6e-135
WP_072271515.1|1433082_1433439_-	GtrA family protein	NA	B9UDL8	Salmonella_phage	57.1	3.1e-31
WP_033637997.1|1433887_1434310_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	55.0	3.0e-33
WP_103682108.1|1434309_1435578_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	71.3	3.3e-176
1435748:1435772	attR	AGGAATCGTATTCGGTCTTTTTTTG	NA	NA	NA	NA
>prophage 3
NZ_CP033623	Serratia marcescens strain N10A28 chromosome, complete genome	5276341	1575548	1616518	5276341	protease,coat	Moraxella_phage(25.0%)	38	NA	NA
WP_159317940.1|1575548_1576967_+|protease	serralysin family metalloprotease	protease	NA	NA	NA	NA
WP_004931526.1|1577113_1577323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004931522.1|1578099_1578492_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_159317941.1|1578496_1579096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004931517.1|1579151_1579391_-	YebV family protein	NA	NA	NA	NA	NA
WP_159317942.1|1579526_1580459_-	fimbrial major subunit CsuA/B family protein	NA	NA	NA	NA	NA
WP_159318951.1|1580478_1582821_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_049201714.1|1582972_1583740_-	molecular chaperone	NA	NA	NA	NA	NA
WP_038882152.1|1583761_1584304_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_038877669.1|1584297_1584801_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_060440090.1|1584803_1585340_-	fimbrial major subunit CsuA/B family protein	NA	NA	NA	NA	NA
WP_060419268.1|1585614_1586151_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_060440089.1|1586423_1587860_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_159317943.1|1587962_1590593_-	MCE family protein	NA	NA	NA	NA	NA
WP_049198592.1|1590561_1591809_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_060440088.1|1592064_1592562_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_033638287.1|1592658_1593369_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_033642845.1|1593388_1595437_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.9	1.5e-85
WP_159317944.1|1595504_1596350_-	EamA family transporter	NA	NA	NA	NA	NA
WP_159317945.1|1596346_1597654_-	opine metallophore biosynthesis dehydrogenase	NA	NA	NA	NA	NA
WP_060440085.1|1597646_1598444_-	nicotianamine synthase	NA	NA	NA	NA	NA
WP_060440084.1|1598431_1599217_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.4	5.2e-10
WP_060440083.1|1599213_1600254_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_159317946.1|1600256_1601348_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033638291.1|1601718_1602597_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_159317947.1|1602648_1604043_-	MFS transporter	NA	NA	NA	NA	NA
WP_038877637.1|1604273_1605065_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_159317948.1|1605111_1605915_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_141959037.1|1605917_1606781_-	2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_159317949.1|1606782_1607919_-	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	33.7	7.4e-26
WP_145958028.1|1607915_1608926_-	2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_102984780.1|1609100_1609820_-	phosphonate utilization transcriptional regulator PhnR	NA	NA	NA	NA	NA
WP_060440080.1|1609975_1611079_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_060419240.1|1611088_1611898_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_089185892.1|1611961_1613359_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_004931456.1|1613534_1614083_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	35.1	1.4e-06
WP_049198577.1|1614507_1615173_-	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_060419239.1|1615237_1616518_-|protease	protease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP033623	Serratia marcescens strain N10A28 chromosome, complete genome	5276341	2932801	2953249	5276341	tail,holin	Klebsiella_phage(29.41%)	22	NA	NA
WP_159318288.1|2932801_2934823_-|tail	phage tail protein	tail	A0A1I9SF20	Klebsiella_phage	47.3	4.0e-30
WP_102984349.1|2934819_2935977_-|tail	tail fiber domain-containing protein	tail	A0A1V0E5M2	Salmonella_phage	59.3	3.3e-45
WP_060420117.1|2939617_2940244_-|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	53.7	1.4e-50
WP_154618175.1|2940286_2940637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159318289.1|2940674_2941379_-	peptidase P60	NA	K7PGR2	Enterobacteria_phage	75.3	1.8e-107
WP_070915341.1|2941388_2942138_-|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	65.7	4.8e-98
WP_033639815.1|2942150_2942489_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	60.0	1.4e-33
WP_159318290.1|2942488_2944780_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	43.1	2.2e-16
WP_019453673.1|2944772_2944994_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	49.3	7.7e-12
WP_060420111.1|2945011_2945377_-|tail	phage tail protein	tail	Q7Y401	Yersinia_phage	44.2	1.9e-23
WP_016926946.1|2945500_2945956_-|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	74.8	1.2e-56
WP_060420109.1|2945997_2946390_-	hypothetical protein	NA	Q7Y404	Yersinia_phage	46.8	3.6e-20
WP_159318292.1|2946386_2946776_-	hypothetical protein	NA	Q7Y405	Yersinia_phage	41.3	4.1e-24
WP_159318294.1|2946833_2947274_-	glycoside hydrolase family protein	NA	A0A0M5M782	Salmonella_phage	63.0	2.6e-43
WP_019453678.1|2947260_2947581_-|holin	holin	holin	F1C5D1	Cronobacter_phage	81.0	2.5e-40
WP_047730873.1|2948271_2948634_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	64.6	1.6e-38
WP_060420100.1|2948843_2949521_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	45.7	6.0e-07
WP_019453681.1|2949947_2950277_-	osmotically-inducible lipoprotein OsmE	NA	NA	NA	NA	NA
WP_070915333.1|2950404_2950872_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_060439390.1|2950979_2951558_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047730203.1|2951551_2951968_-	glyoxalase	NA	NA	NA	NA	NA
WP_038876356.1|2952118_2953249_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	53.3	5.7e-103
>prophage 5
NZ_CP033623	Serratia marcescens strain N10A28 chromosome, complete genome	5276341	3346285	3351689	5276341	holin	Klebsiella_phage(33.33%)	7	NA	NA
WP_159318422.1|3346285_3346546_-	hypothetical protein	NA	A0A248XCT8	Klebsiella_phage	55.2	1.9e-14
WP_159318424.1|3346542_3346917_-	hypothetical protein	NA	A0A248XD11	Klebsiella_phage	34.7	1.4e-05
WP_159318426.1|3346901_3347417_-	glycoside hydrolase family protein	NA	Q71TF3	Escherichia_phage	54.7	7.0e-48
WP_159318427.1|3347400_3347634_-|holin	holin	holin	H9C183	Pectobacterium_phage	69.6	1.2e-20
WP_159318429.1|3347656_3350161_-	hypothetical protein	NA	W6PEG9	Cronobacter_phage	36.1	2.8e-94
WP_159318431.1|3350349_3350598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159318985.1|3350957_3351689_+	anti-repressor protein	NA	G9L6E2	Escherichia_phage	38.8	3.5e-37
>prophage 6
NZ_CP033623	Serratia marcescens strain N10A28 chromosome, complete genome	5276341	3360111	3388425	5276341	tail,terminase,integrase	Escherichia_phage(25.0%)	41	3379313:3379330	3387552:3387569
WP_159318441.1|3360111_3360681_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	47.9	2.8e-29
WP_159318443.1|3360673_3361147_-	hypothetical protein	NA	Q858G2	Salmonella_phage	64.7	4.7e-51
WP_159318444.1|3361146_3363648_-	hypothetical protein	NA	A0A0F6TJD3	Escherichia_coli_O157_typing_phage	61.0	3.4e-305
WP_033648873.1|3363647_3364256_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	61.4	7.7e-62
WP_159318446.1|3364255_3364579_-	hypothetical protein	NA	T1SBJ0	Salmonella_phage	56.0	1.2e-21
WP_159318987.1|3364618_3364903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159318448.1|3364913_3365360_-	hypothetical protein	NA	G9L6C6	Escherichia_phage	61.9	1.4e-33
WP_060418227.1|3365413_3366400_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	71.6	1.5e-139
WP_159318450.1|3366405_3367113_-	peptidase	NA	G9L6C4	Escherichia_phage	68.0	3.5e-50
WP_159318452.1|3367123_3367390_-	hypothetical protein	NA	V5KSC6	Escherichia_phage	88.1	1.2e-22
WP_060430634.1|3367355_3367652_-	hypothetical protein	NA	Q2A090	Sodalis_phage	72.9	7.1e-29
WP_159318454.1|3367651_3369337_-|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	58.5	1.6e-186
WP_159318456.1|3370060_3371533_-|terminase	terminase	terminase	G9L6B8	Escherichia_phage	78.0	2.8e-235
WP_159318458.1|3371529_3372084_-|terminase	terminase small subunit	terminase	G9L6B7	Escherichia_phage	61.3	5.7e-56
WP_049234898.1|3372190_3372448_-	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	51.8	1.2e-16
WP_159318460.1|3372520_3372907_-	hypothetical protein	NA	H9C172	Pectobacterium_phage	36.2	4.6e-12
WP_159318461.1|3372899_3373505_-	hypothetical protein	NA	R9W0X9	Serratia_phage	39.8	2.6e-17
WP_159318463.1|3373514_3373766_-	hypothetical protein	NA	A0A2H4EW60	Aeromonas_phage	51.2	1.1e-14
WP_159318465.1|3373779_3373929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159318467.1|3373925_3374312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159318469.1|3374301_3374502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159318470.1|3374498_3374651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159318471.1|3374643_3375402_-	Dcm methylase	NA	A0A0N7CDR2	Salmonella_phage	63.7	2.9e-82
WP_159318473.1|3375343_3375697_-	hypothetical protein	NA	A0A2I7RVG6	Vibrio_phage	55.1	4.8e-16
WP_159318475.1|3375671_3375893_-	hypothetical protein	NA	J7I0T4	Pseudomonas_phage	55.2	8.8e-08
WP_159318477.1|3375889_3376315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159318478.1|3376325_3376538_-	TraR/DksA family transcriptional regulator	NA	Q9ZXI6	Pseudomonas_virus	49.2	9.0e-10
WP_159318988.1|3376540_3376840_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	72.7	9.3e-37
WP_159318480.1|3377103_3377547_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	38.1	3.4e-19
WP_033632341.1|3378477_3378684_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	45.0	2.5e-09
WP_159318482.1|3378828_3379047_-	hypothetical protein	NA	Q858D6	Salmonella_phage	58.0	4.3e-15
WP_159318484.1|3379195_3379792_+	helix-turn-helix domain-containing protein	NA	G9L6A6	Escherichia_phage	52.3	1.9e-49
3379313:3379330	attL	CGCTGGCTGAAGCCGGCG	NA	NA	NA	NA
WP_159318486.1|3380212_3380518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159318488.1|3380801_3381623_+	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	77.6	3.5e-126
WP_159318490.1|3381619_3382498_+	recombinase RecT	NA	G9L6A2	Escherichia_phage	73.7	8.9e-120
WP_100396649.1|3382538_3382790_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	48.8	9.3e-14
WP_159318989.1|3382934_3383570_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	68.3	4.2e-79
WP_159318491.1|3383566_3383851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159318493.1|3383854_3385057_-|integrase	tyrosine-type recombinase/integrase	integrase	T1S9J3	Salmonella_phage	69.0	1.1e-155
WP_159318495.1|3385281_3386859_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004941460.1|3386961_3388425_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.5	2.0e-87
3387552:3387569	attR	CGCCGGCTTCAGCCAGCG	NA	NA	NA	NA
>prophage 7
NZ_CP033623	Serratia marcescens strain N10A28 chromosome, complete genome	5276341	4259152	4268083	5276341		environmental_Halophage(16.67%)	7	NA	NA
WP_060424556.1|4259152_4261231_+	hypothetical protein	NA	H9YQA8	environmental_Halophage	71.9	1.0e-52
WP_159318720.1|4261271_4262489_-	acetylornithine/succinylornithine family transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.4	6.1e-26
WP_049198366.1|4262620_4263196_-	aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	63.2	6.1e-69
WP_033649312.1|4263268_4264795_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	42.6	1.9e-77
WP_047729698.1|4264946_4265672_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_033636285.1|4265671_4267357_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	72.8	8.8e-225
WP_038878108.1|4267513_4268083_-	peptidylprolyl isomerase A	NA	A0A1V0S9I2	Catovirus	31.7	1.3e-07
