The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP032240	Klebsiella pneumoniae strain XJ-K2 chromosome, complete genome	5503278	453245	486498	5503278	integrase,protease,portal,capsid,tail,head,tRNA,terminase	uncultured_Caudovirales_phage(73.33%)	33	470848:470865	486843:486860
WP_002919147.1|453245_454193_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|454207_454717_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|454845_455970_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|455941_456415_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|456440_456983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|456987_457560_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|457563_458382_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|458378_458636_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|458611_459166_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|464956_465178_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|465471_468582_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|468594_469734_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|470112_470763_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
470848:470865	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|471038_472265_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|472357_473299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|473480_473765_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|473775_474555_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_106918304.1|475006_475276_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|475268_475457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|475449_475764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|475760_476129_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|476125_476491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|476490_478626_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|478968_479304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|479352_479865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|480128_481295_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|481346_481907_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|481908_483150_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|483146_483482_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|483478_483778_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|483777_484221_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_000113647.1|484496_484853_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|484836_486498_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
486843:486860	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 2
NZ_CP032240	Klebsiella pneumoniae strain XJ-K2 chromosome, complete genome	5503278	1179563	1264894	5503278	integrase,transposase,tRNA,coat,portal,lysis,capsid,tail,head,terminase,plate	Salmonella_phage(68.63%)	96	1193317:1193336	1241995:1242014
WP_002914765.1|1179563_1182191_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	4.9e-81
WP_000906486.1|1182554_1182740_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_002914359.1|1184261_1184576_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_002914357.1|1184701_1185268_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_002914355.1|1185264_1185693_+	DedA family protein	NA	NA	NA	NA	NA
WP_002914353.1|1185759_1187316_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_002914351.1|1187472_1187988_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_002914345.1|1188040_1188808_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002914344.1|1188786_1190463_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_002914342.1|1190599_1192138_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_002914339.1|1192153_1193326_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
1193317:1193336	attL	TTGCACTCATGTTATTCTCC	NA	NA	NA	NA
WP_002914337.1|1193451_1193982_-	transcriptional repressor MprA	NA	NA	NA	NA	NA
WP_002914335.1|1194072_1194408_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_002914333.1|1194397_1195144_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_002914330.1|1195321_1196320_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_004151038.1|1196398_1197466_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_002914328.1|1197458_1198661_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.8	1.2e-26
WP_002914327.1|1199017_1199980_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	72.2	1.5e-131
WP_002914325.1|1199990_1202132_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	46.4	2.5e-184
WP_002914321.1|1202104_1202515_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_002914320.1|1202511_1202757_-	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	41.1	5.5e-11
WP_004151037.1|1202940_1203372_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_004149442.1|1203460_1204813_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_002914293.1|1204956_1205304_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_002914291.1|1205453_1205816_+	YgaC family protein	NA	NA	NA	NA	NA
WP_002914289.1|1205901_1206351_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_002914287.1|1207079_1207481_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_002914284.1|1207553_1207733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914281.1|1207938_1208841_+	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	40.2	2.6e-37
WP_002914279.1|1208821_1209367_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_002914277.1|1209374_1209674_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002914274.1|1209749_1210355_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_004145715.1|1210458_1211367_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004151036.1|1211449_1213237_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_004151035.1|1213500_1215021_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000019473.1|1215752_1216733_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_062955148.1|1216778_1217777_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	94.5	2.2e-183
WP_004151019.1|1217779_1218409_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_001397669.1|1218531_1218774_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151018.1|1218806_1219316_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_004151017.1|1219323_1219524_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004144796.1|1219487_1219826_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151016.1|1219893_1220127_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004151014.1|1220126_1220354_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151013.1|1220350_1221202_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151012.1|1221198_1223583_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004152765.1|1224062_1225547_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151011.1|1225653_1225842_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151010.1|1225853_1226087_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151009.1|1226182_1226866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|1226852_1227932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151007.1|1227931_1228933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940854.1|1229454_1229724_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151006.1|1229780_1230824_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_019405037.1|1230823_1232587_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151004.1|1232727_1233561_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_004151003.1|1233577_1234630_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004134644.1|1234633_1235287_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151002.1|1235382_1235847_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004151001.1|1235846_1236050_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004134639.1|1236053_1236269_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151000.1|1236249_1236759_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004150999.1|1236763_1237147_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004150998.1|1237143_1237572_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_004150997.1|1237667_1238090_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150996.1|1238082_1238529_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150995.1|1238551_1239418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150994.1|1239512_1240085_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150993.1|1240081_1240444_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150992.1|1240430_1241339_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004152935.1|1241331_1242003_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150990.1|1242004_1243954_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
1241995:1242014	attR	GGAGAATAACATGAGTGCAA	NA	NA	NA	NA
WP_004200602.1|1243963_1245082_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150988.1|1245133_1246207_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004150987.1|1246355_1247528_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150986.1|1247537_1248053_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150985.1|1248105_1248405_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_002896220.1|1248419_1248539_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150984.1|1248531_1251162_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
WP_004150983.1|1251158_1251644_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150982.1|1251640_1252735_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150981.1|1252801_1253020_+	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150980.1|1253047_1253425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|1254028_1254511_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
WP_004188817.1|1254621_1255098_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914161.1|1255087_1255378_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1255444_1255786_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914159.1|1255933_1257595_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1257681_1258560_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|1258684_1259275_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|1259394_1260681_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1260700_1261492_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1261655_1263020_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1263279_1263528_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1263546_1264095_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|1264126_1264894_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP032240	Klebsiella pneumoniae strain XJ-K2 chromosome, complete genome	5503278	1370914	1425567	5503278	transposase,integrase,holin,tail,terminase	Salmonella_phage(37.25%)	58	1364249:1364263	1394354:1394368
1364249:1364263	attL	TGAGCAGGTTCGCGA	NA	NA	NA	NA
WP_004151980.1|1370914_1372381_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_004151979.1|1372448_1374026_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_062955102.1|1374217_1375468_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	84.4	5.8e-205
WP_063002073.1|1375410_1375653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197356.1|1375649_1376243_-	MT-A70 family protein	NA	T1SA14	Salmonella_phage	91.9	6.3e-109
WP_062955103.1|1376239_1376902_-	hypothetical protein	NA	A0A059VF56	Pseudomonas_phage	46.6	1.2e-47
WP_048264082.1|1376898_1377057_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.1e-17
WP_009485475.1|1377049_1377343_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
WP_062955104.1|1377452_1377701_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	76.8	4.9e-31
WP_062955105.1|1377749_1378631_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	84.3	8.9e-136
WP_062955106.1|1378627_1379449_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	80.2	1.8e-130
WP_004164029.1|1379445_1379745_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004144290.1|1380111_1380693_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
WP_004152538.1|1380847_1381081_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152537.1|1381227_1381437_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004207253.1|1381436_1382204_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_032418532.1|1382200_1382986_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
WP_048328152.1|1383105_1383453_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	6.5e-50
WP_062955107.1|1383645_1384056_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	45.1	4.3e-16
WP_032441402.1|1384039_1384231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441401.1|1384227_1384872_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	79.3	8.0e-110
WP_072200041.1|1385165_1385633_+	hypothetical protein	NA	A0A2R2Z312	Escherichia_phage	51.7	1.3e-37
WP_029602865.1|1385632_1385926_+	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	86.6	2.7e-44
WP_050491799.1|1385922_1386543_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	40.7	1.0e-29
WP_032441458.1|1386542_1386746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023339258.1|1386738_1387077_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	1.8e-44
WP_004152765.1|1387173_1388658_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_032418540.1|1389061_1389319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441400.1|1389396_1389981_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.6	2.2e-90
WP_062955142.1|1389977_1391453_+	hypothetical protein	NA	Q858H3	Salmonella_phage	93.1	6.4e-280
WP_004200550.1|1391496_1391868_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	91.9	3.7e-59
WP_004141368.1|1392621_1392828_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
WP_032441398.1|1392842_1394525_+|tail	tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.4	1.5e-264
1394354:1394368	attR	TGAGCAGGTTCGCGA	NA	NA	NA	NA
WP_004152446.1|1394521_1394818_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
WP_032441397.1|1394820_1395501_+	peptidase	NA	G9L6C4	Escherichia_phage	84.0	6.1e-76
WP_004200546.1|1395515_1396502_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	94.2	2.5e-179
WP_020953461.1|1396555_1396993_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.7	1.3e-66
WP_062955141.1|1397003_1397345_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	2.4e-36
WP_004152441.1|1397395_1397719_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
WP_062955139.1|1397718_1398324_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	77.0	4.0e-87
WP_062955138.1|1398323_1400801_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.4	0.0e+00
WP_004152438.1|1400800_1401265_+	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
WP_032447858.1|1401264_1401804_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	8.0e-71
WP_062955137.1|1401814_1404349_+	hypothetical protein	NA	Q858G0	Salmonella_phage	84.1	0.0e+00
WP_062955136.1|1404348_1406259_+	hypothetical protein	NA	Q858F9	Salmonella_phage	82.7	5.4e-287
WP_062955135.1|1406258_1409015_+	hypothetical protein	NA	Q858F8	Salmonella_phage	95.4	0.0e+00
WP_094820965.1|1409491_1409767_-	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	62.8	4.9e-24
WP_004152765.1|1409829_1411314_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_062955131.1|1414525_1414789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153233543.1|1414829_1416095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073547080.1|1416076_1417057_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.5e-184
WP_000608644.1|1417925_1419188_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_077265603.1|1420296_1421613_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A0K2FI18	Enterobacter_phage	32.3	2.3e-34
WP_062955010.1|1421699_1422104_+	hypothetical protein	NA	T1SA79	Salmonella_phage	81.1	8.7e-54
WP_023339240.1|1422090_1422396_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	2.7e-39
WP_062955009.1|1422385_1423015_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.9	1.8e-90
WP_062955008.1|1423011_1423512_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	76.9	1.3e-59
WP_004152009.1|1423698_1425567_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 4
NZ_CP032240	Klebsiella pneumoniae strain XJ-K2 chromosome, complete genome	5503278	1509738	1573586	5503278	integrase,protease,tRNA,holin,portal,capsid,tail,head,terminase	Enterobacteria_phage(24.44%)	69	1532745:1532768	1574986:1575009
WP_002913437.1|1509738_1511157_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002913435.1|1511208_1511601_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002913434.1|1511604_1511958_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004151096.1|1512579_1514751_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_002913423.1|1514799_1516002_-	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_002913421.1|1516348_1517590_+	Mn(2+) uptake NRAMP transporter MntH	NA	NA	NA	NA	NA
WP_002913419.1|1517647_1518007_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_002913417.1|1518137_1519130_-	L-glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_004159719.1|1519310_1520972_+	indolepyruvate decarboxylase	NA	NA	NA	NA	NA
WP_004154521.1|1520968_1522204_-	ion channel protein	NA	NA	NA	NA	NA
WP_002913377.1|1522467_1523433_+	glucokinase	NA	NA	NA	NA	NA
WP_002913374.1|1523486_1524224_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	26.3	1.5e-14
WP_004149230.1|1524235_1525933_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.5	6.7e-47
WP_002913372.1|1526315_1527530_+	alanine transaminase	NA	NA	NA	NA	NA
WP_099119320.1|1527600_1527672_-	membrane protein YpdK	NA	NA	NA	NA	NA
WP_004151099.1|1528010_1529207_-	MFS transporter	NA	NA	NA	NA	NA
WP_002913370.1|1529203_1529662_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	32.3	1.2e-11
WP_002913369.1|1529794_1530703_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	7.8e-10
WP_071177718.1|1530772_1531594_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.4e-05
WP_002913367.1|1531961_1532444_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
1532745:1532768	attL	TATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
WP_109026994.1|1532962_1534132_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	86.9	1.3e-203
WP_029497176.1|1534115_1534301_-	hypothetical protein	NA	G3CFG7	Escherichia_phage	61.4	4.7e-15
WP_147007170.1|1534323_1534881_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	63.8	1.2e-66
WP_147007160.1|1535130_1535364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101865739.1|1535857_1536238_-	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	94.4	1.8e-64
WP_077265949.1|1536602_1536827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060591480.1|1537141_1538002_-	hypothetical protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	54.7	2.3e-72
WP_004104279.1|1538084_1538897_-	DUF2303 family protein	NA	NA	NA	NA	NA
WP_060591474.1|1538940_1539300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042921064.1|1539962_1540238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048333910.1|1540629_1540836_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	56.7	5.1e-10
WP_048333909.1|1540873_1541908_-	hypothetical protein	NA	A4KWR9	Enterobacteria_phage	43.2	3.9e-74
WP_048333964.1|1541965_1542670_-	helix-turn-helix domain-containing protein	NA	G8C7U1	Escherichia_phage	60.1	3.7e-68
WP_048333908.1|1542775_1543036_+	hypothetical protein	NA	A0A1B5FPK9	Escherichia_phage	42.0	1.2e-08
WP_048333906.1|1543064_1543595_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	61.8	7.9e-55
WP_040176286.1|1544077_1544353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147007161.1|1544345_1545875_+	DEAD/DEAH box helicase family protein	NA	A0A286N2P9	Klebsiella_phage	66.5	4.3e-202
WP_038806620.1|1545871_1546843_+	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	61.6	3.9e-108
WP_147007162.1|1546812_1547457_+	NinG family protein	NA	A0A1W6JNX3	Morganella_phage	54.3	3.3e-39
WP_147007163.1|1547453_1548098_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	66.8	2.1e-81
WP_004104264.1|1548087_1548492_+	antitermination protein	NA	S5M7R9	Escherichia_phage	53.2	9.4e-32
WP_001294159.1|1548701_1549088_+	membrane protein	NA	A0A192Y8P2	Salmonella_phage	90.6	1.6e-57
WP_071603196.1|1549074_1549356_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	47.3	2.4e-18
WP_147007164.1|1549355_1549985_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	74.9	4.2e-87
WP_085808056.1|1549987_1550263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147007171.1|1550717_1551068_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	79.1	3.5e-51
WP_032408649.1|1551225_1551723_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	72.1	1.1e-61
WP_109027003.1|1551722_1553480_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	90.4	0.0e+00
WP_072071815.1|1553490_1553676_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	63.3	4.7e-15
WP_147007165.1|1553675_1554905_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	83.4	1.1e-203
WP_109027004.1|1554891_1555545_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	86.9	1.0e-104
WP_040186336.1|1555559_1556768_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	84.2	1.7e-193
WP_074384536.1|1556794_1557010_+	hypothetical protein	NA	M1FN89	Enterobacteria_phage	42.4	2.5e-07
WP_110917619.1|1557006_1557327_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	39.8	1.7e-15
WP_109027008.1|1557335_1557674_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	73.2	2.4e-41
WP_109027010.1|1557670_1558120_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	83.2	3.0e-63
WP_109027011.1|1558116_1558464_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	62.8	2.3e-31
WP_032412035.1|1558520_1559225_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.5	9.5e-80
WP_048984683.1|1559255_1559660_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	57.7	1.1e-32
WP_042936677.1|1559662_1559968_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	3.6e-28
WP_019706055.1|1560042_1560564_+	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	45.2	2.2e-09
WP_109027013.1|1560626_1564205_+|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	64.0	2.4e-251
WP_147007166.1|1564226_1564700_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	60.8	1.2e-54
WP_023301978.1|1564686_1565172_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	66.2	4.0e-53
WP_021313617.1|1565181_1565562_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	80.2	2.1e-57
WP_147007167.1|1565558_1568642_+	kinase	NA	A0A286S259	Klebsiella_phage	71.7	0.0e+00
WP_117092178.1|1571154_1571358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147007168.1|1571395_1571599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147007169.1|1571609_1573586_-	hypothetical protein	NA	A0A1I9SEI8	Klebsiella_phage	26.5	2.1e-44
1574986:1575009	attR	TATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
>prophage 5
NZ_CP032240	Klebsiella pneumoniae strain XJ-K2 chromosome, complete genome	5503278	1804333	1811238	5503278	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_072353998.1|1804333_1805197_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	7.4e-10
WP_094818808.1|1805207_1805981_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	5.1e-26
WP_002912636.1|1806221_1807115_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1807360_1808722_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|1809040_1809763_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_072353997.1|1809759_1811238_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.9e-29
>prophage 6
NZ_CP032240	Klebsiella pneumoniae strain XJ-K2 chromosome, complete genome	5503278	1855782	1866806	5503278	transposase	Escherichia_phage(33.33%)	9	NA	NA
WP_000043543.1|1855782_1857189_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_004180506.1|1857415_1858831_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
WP_039819506.1|1858852_1860223_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	25.9	6.4e-32
WP_039819536.1|1860377_1861442_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	9.8e-105
WP_023278825.1|1861455_1862325_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	1.7e-110
WP_004175259.1|1862356_1863247_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
WP_039819508.1|1863261_1863816_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	2.9e-52
WP_072353991.1|1863995_1865162_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	9.1e-112
WP_000019445.1|1865825_1866806_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 7
NZ_CP032240	Klebsiella pneumoniae strain XJ-K2 chromosome, complete genome	5503278	2860352	2871239	5503278		Escherichia_phage(87.5%)	9	NA	NA
WP_004151613.1|2860352_2863460_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|2863514_2864780_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2864810_2865899_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|2865985_2866246_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|2866543_2867404_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2867424_2868186_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|2868446_2869349_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004151609.1|2869360_2870626_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_002210516.1|2870618_2871239_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 8
NZ_CP032240	Klebsiella pneumoniae strain XJ-K2 chromosome, complete genome	5503278	3098736	3137202	5503278	integrase,terminase	uncultured_Caudovirales_phage(34.04%)	56	3128315:3128329	3134324:3134338
WP_004152576.1|3098736_3099603_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152575.1|3099602_3100376_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|3100372_3101569_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|3101568_3101922_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|3101923_3102577_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152571.1|3102630_3103197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199301.1|3103239_3103422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|3103471_3103813_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|3103812_3104835_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152568.1|3104837_3105140_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_004152567.1|3105140_3105740_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152566.1|3105739_3107743_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|3107732_3107885_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|3107920_3108346_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004199809.1|3108349_3108790_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152177.1|3108800_3109946_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|3109949_3110390_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|3110484_3110871_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|3110870_3111377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|3111373_3111793_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|3111761_3112043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|3112082_3113024_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|3113035_3113530_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|3113533_3114736_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|3114787_3115336_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|3115391_3116843_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|3117080_3118481_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152171.1|3118431_3119184_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
WP_004152170.1|3119285_3119606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|3119840_3120230_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|3120226_3120757_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|3120759_3121008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152167.1|3121413_3122196_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|3122192_3122669_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|3122665_3123628_-	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|3123629_3125288_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|3125864_3126086_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|3126183_3126852_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|3127022_3127337_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|3127329_3127518_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|3127687_3128053_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152157.1|3128045_3128300_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004177208.1|3128271_3128490_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
3128315:3128329	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
WP_004152156.1|3128486_3128912_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|3128908_3129103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|3129099_3129927_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|3130031_3130550_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|3130555_3131266_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|3131255_3131480_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004152150.1|3131476_3131689_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152149.1|3131685_3132165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152148.1|3132343_3132586_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|3132566_3133748_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|3133944_3134493_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
3134324:3134338	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
WP_004152145.1|3134691_3136224_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|3136440_3137202_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 9
NZ_CP032240	Klebsiella pneumoniae strain XJ-K2 chromosome, complete genome	5503278	3300281	3431067	5503278	transposase,integrase,protease,holin,portal,lysis,tail,capsid,head,tRNA,terminase	Klebsiella_phage(31.11%)	147	3327082:3327096	3428878:3428892
WP_002901088.1|3300281_3300782_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|3300898_3301345_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901073.1|3301328_3302120_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004150777.1|3302221_3303406_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140471.1|3303437_3304130_-	CTP synthase	NA	NA	NA	NA	NA
WP_004150778.1|3304275_3304785_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004150779.1|3304771_3305128_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004150780.1|3305117_3305357_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004150781.1|3305656_3306670_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.4e-12
WP_004150782.1|3306727_3306829_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_099119317.1|3306828_3306903_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|3307020_3307146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|3307205_3307469_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|3307598_3308237_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|3308326_3309241_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150784.1|3309902_3310946_-	type II asparaginase	NA	NA	NA	NA	NA
WP_004150785.1|3311248_3312457_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004150787.1|3312530_3314315_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004150788.1|3314321_3315212_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004140497.1|3315332_3316841_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150790.1|3317151_3317838_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_153233540.1|3318287_3318476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|3318454_3319087_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140506.1|3319653_3319851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140509.1|3319966_3320977_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004150793.1|3320973_3322380_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004140512.1|3322435_3323323_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140514.1|3323339_3323846_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150794.1|3323872_3324367_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150795.1|3324457_3324643_-	general stress protein	NA	NA	NA	NA	NA
WP_004140529.1|3325264_3326458_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004140530.1|3326570_3326798_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
3327082:3327096	attL	TGGCTGGCGTTCTTT	NA	NA	NA	NA
WP_004150797.1|3327234_3327558_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004150798.1|3327550_3327943_+	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004150799.1|3327939_3328653_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004892953.1|3328925_3329078_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_023328083.1|3329232_3330729_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	63.7	1.4e-125
WP_062955111.1|3330797_3343502_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	47.1	0.0e+00
WP_023328085.1|3343564_3344158_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	76.6	8.0e-80
WP_047666390.1|3344184_3344607_-	hypothetical protein	NA	J9Q806	Salmonella_phage	50.0	5.9e-29
WP_047666389.1|3344648_3345359_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	90.3	1.9e-136
WP_023328087.1|3345360_3346116_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.5	4.6e-125
WP_023328088.1|3346112_3346451_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	1.4e-57
WP_023328089.1|3346450_3349786_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.3	0.0e+00
WP_014228914.1|3350018_3350384_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_023328090.1|3350441_3350903_-	hypothetical protein	NA	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_023328091.1|3350934_3351336_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	2.3e-62
WP_017880258.1|3351332_3351722_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
WP_023328092.1|3351702_3352041_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	90.2	2.8e-53
WP_020317538.1|3352037_3352355_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
WP_049010370.1|3352335_3352596_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	60.5	7.4e-22
WP_023328094.1|3352654_3353941_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.0	9.8e-216
WP_014907815.1|3354018_3354939_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
WP_023279520.1|3354975_3356235_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.8	1.8e-222
WP_017898992.1|3356234_3356414_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
WP_021462603.1|3356407_3358129_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.5e-190
WP_012542168.1|3358128_3358563_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_014907818.1|3358811_3359243_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.6	1.8e-41
WP_023297386.1|3359239_3359563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032428746.1|3359514_3359877_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
WP_032749552.1|3360203_3360428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049115059.1|3360466_3360904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016160650.1|3361853_3362204_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	38.1	7.9e-11
WP_032432826.1|3362200_3362698_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.6	1.1e-77
WP_016160648.1|3362697_3362913_-|lysis	phage S lysis protein	lysis	A5LH82	Enterobacteria_phage	88.7	2.7e-30
WP_004147999.1|3363830_3363980_+	small membrane protein	NA	NA	NA	NA	NA
WP_004147997.1|3364717_3364921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025861432.1|3365164_3365767_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.6	1.1e-76
WP_062955112.1|3365783_3366815_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	4.7e-96
WP_025861428.1|3367014_3367407_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	8.0e-12
WP_077255782.1|3367447_3367738_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	8.0e-17
WP_025368263.1|3367749_3367983_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	3.7e-25
WP_004152765.1|3368060_3369545_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_062954975.1|3370385_3371747_-	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_062954976.1|3371920_3372634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019445.1|3373298_3374279_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_062954977.1|3375143_3376535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032443841.1|3376883_3377324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047667474.1|3377337_3377802_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	72.2	4.1e-63
WP_077265602.1|3377794_3378799_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	40.0	1.0e-31
WP_046622349.1|3378858_3379413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071561166.1|3379415_3379640_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	62.5	1.3e-19
WP_077257742.1|3379728_3380166_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	62.2	1.3e-39
WP_040234937.1|3380487_3380802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023279538.1|3381192_3381387_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_014228879.1|3381429_3381774_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_062954978.1|3381915_3384054_+	exodeoxyribonuclease VIII	NA	S4TNL0	Salmonella_phage	42.7	5.6e-99
WP_012542206.1|3384106_3384352_+	excisionase	NA	NA	NA	NA	NA
WP_032418030.1|3384332_3385460_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.4	4.4e-119
WP_094818795.1|3385577_3385760_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	3.7e-20
WP_049182670.1|3386141_3386903_-	hypothetical protein	NA	Q6J1W3	Lactobacillus_phage	29.4	2.5e-09
WP_094818794.1|3387937_3388663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094818793.1|3388714_3389980_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.9	8.1e-207
WP_042934076.1|3389982_3390402_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	56.7	1.2e-34
WP_064155591.1|3390480_3390723_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	81.0	1.6e-31
WP_031592310.1|3390722_3390965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094818792.1|3391740_3392493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094818791.1|3392503_3394672_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	45.1	6.7e-100
WP_094818790.1|3394749_3397818_-	kinase	NA	A0A286S259	Klebsiella_phage	66.3	0.0e+00
WP_094818789.1|3397814_3398201_-	nitrite transporter	NA	H2BD94	Pseudomonas_phage	35.7	4.0e-16
WP_038433285.1|3398208_3398691_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	67.7	8.5e-56
WP_032420722.1|3398677_3399151_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	63.5	3.9e-53
WP_094818788.1|3399150_3401847_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	62.4	4.9e-201
WP_032420719.1|3401827_3402145_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	51.5	1.4e-19
WP_025714420.1|3402165_3402561_-|tail	phage tail protein	tail	M9NZD7	Enterobacteria_phage	27.5	1.9e-08
WP_023304948.1|3402603_3403086_-	hypothetical protein	NA	M9NYX0	Enterobacteria_phage	68.6	5.7e-60
WP_020804325.1|3403093_3403492_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	57.8	3.2e-40
WP_048291628.1|3403488_3404040_-|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	67.3	1.6e-53
WP_020317349.1|3404029_3404323_-	sugar ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_049186541.1|3404315_3404642_-	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	66.4	4.0e-33
WP_094818787.1|3404722_3406738_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	84.2	0.0e+00
WP_020317329.1|3406682_3408182_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.6	1.1e-247
WP_094818786.1|3408178_3408394_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	75.7	6.5e-24
WP_094818785.1|3408390_3410499_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	83.5	0.0e+00
WP_014228567.1|3410498_3410990_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	84.0	6.4e-67
WP_072002796.1|3411310_3411496_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	61.1	2.4e-11
WP_108918987.1|3411563_3411824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004216876.1|3412050_3412296_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	3.0e-33
WP_116723292.1|3412685_3412874_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	89.8	6.3e-23
WP_094818783.1|3412824_3413100_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	46.7	8.6e-13
WP_094818782.1|3413096_3413444_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	78.3	3.0e-39
WP_019704505.1|3413440_3413980_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.3	5.7e-101
WP_024176410.1|3413976_3414276_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	83.8	4.5e-39
WP_040210598.1|3414445_3414685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094818781.1|3414835_3415414_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.7	2.2e-50
WP_094818780.1|3415427_3416408_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	67.5	2.7e-133
WP_065519871.1|3416420_3416798_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	3.9e-48
WP_094818779.1|3416807_3417617_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	68.9	5.9e-110
WP_094818778.1|3417613_3418528_-	transcriptional regulator	NA	H2DE83	Erwinia_phage	60.6	1.8e-30
WP_023317571.1|3418484_3418697_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	72.7	2.2e-16
WP_004213338.1|3418934_3419396_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_024176406.1|3419421_3419631_-	cell division protein	NA	NA	NA	NA	NA
WP_019705289.1|3419725_3420370_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	40.7	8.2e-38
WP_094818777.1|3420669_3421593_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	62.9	1.5e-104
WP_040186300.1|3421678_3421978_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	47.8	1.0e-14
WP_094818776.1|3421977_3422763_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.6	1.3e-61
WP_094818775.1|3422890_3423382_+	hypothetical protein	NA	E7C9P6	Salmonella_phage	53.4	5.1e-32
WP_064151808.1|3423378_3423642_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	78.0	1.1e-30
WP_094818774.1|3423634_3424279_+	hypothetical protein	NA	A0A2R2Z312	Escherichia_phage	42.8	1.1e-39
WP_004141386.1|3424278_3424491_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_038435237.1|3425286_3425505_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	51.7	3.0e-08
WP_000089156.1|3425805_3426042_+	excisionase	NA	NA	NA	NA	NA
WP_000741346.1|3426031_3427174_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	82.2	9.1e-173
WP_094818773.1|3427287_3428538_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
WP_004150801.1|3428778_3429429_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
3428878:3428892	attR	AAAGAACGCCAGCCA	NA	NA	NA	NA
WP_004150802.1|3429445_3429904_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150803.1|3429960_3431067_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP032240	Klebsiella pneumoniae strain XJ-K2 chromosome, complete genome	5503278	3647401	3740351	5503278	integrase,protease,portal,lysis,tail,terminase,head,capsid,tRNA,plate	Salmonella_phage(56.9%)	93	3702927:3702945	3740426:3740444
WP_002898139.1|3647401_3648694_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3648784_3650128_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3650136_3650748_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|3650870_3655124_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|3655259_3655754_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004141839.1|3656259_3657255_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.3e-62
WP_002898017.1|3657369_3659136_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|3659136_3660858_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3660902_3661604_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3661957_3662176_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3662296_3664576_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3664606_3664924_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3665249_3665471_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3665547_3667488_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3667484_3668600_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|3668746_3670405_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3670824_3671520_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3671635_3672535_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|3672678_3674331_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|3674341_3675310_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|3675521_3675956_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|3676107_3677826_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|3677864_3678866_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|3678876_3680319_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3680406_3681420_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|3681416_3682247_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|3682278_3683418_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|3684295_3684811_+	lipoprotein	NA	NA	NA	NA	NA
WP_032419144.1|3685037_3685766_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3685786_3686518_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3686524_3687241_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|3687240_3687909_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3688092_3688824_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|3688866_3690339_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3690335_3691052_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3691130_3692258_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|3692299_3692788_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3692845_3693691_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3693687_3694641_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|3694651_3695785_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|3695948_3697061_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3697409_3697889_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3697977_3698880_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|3699701_3699989_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3700191_3700455_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3700461_3700845_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|3701111_3702797_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3702927:3702945	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|3703016_3703235_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|3703326_3704427_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|3704423_3704909_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896222.1|3704905_3707533_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896220.1|3707525_3707645_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|3707659_3707959_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|3708011_3708527_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|3708536_3709709_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|3709847_3710924_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896188.1|3710953_3711157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|3711153_3711885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152882.1|3711888_3714840_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_004150856.1|3714841_3715441_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|3715433_3716342_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_032441567.1|3716328_3716691_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	4.9e-48
WP_002896177.1|3716687_3717260_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004150857.1|3717354_3718047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|3718043_3718490_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|3718482_3718914_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896168.1|3719009_3719438_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|3719434_3719818_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|3719822_3720332_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|3720312_3720528_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|3720531_3720735_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|3720734_3721199_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|3721294_3721945_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|3721948_3723007_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|3723023_3723857_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|3723999_3725766_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|3725765_3726791_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|3726852_3728595_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|3728870_3729548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3729662_3729896_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3729906_3730095_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004150862.1|3730248_3732663_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|3732659_3733517_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|3733513_3733741_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|3733740_3733974_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|3734041_3734383_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|3734346_3734547_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|3734554_3735064_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|3735096_3735318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|3735463_3736342_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|3736353_3737298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|3737395_3738880_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151720.1|3739298_3740351_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
3740426:3740444	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 11
NZ_CP032240	Klebsiella pneumoniae strain XJ-K2 chromosome, complete genome	5503278	4393458	4405111	5503278	integrase	Enterobacteria_phage(70.0%)	13	4393908:4393922	4416964:4416978
WP_004144574.1|4393458_4394562_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4393908:4393922	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_002889940.1|4394572_4395826_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4396178_4397369_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4397356_4398307_+	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_004152979.1|4398306_4398732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152202.1|4399299_4399866_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152203.1|4399883_4400129_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_062956184.1|4400125_4400863_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.9e-70
WP_002889915.1|4401404_4401671_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_024940872.1|4401667_4402225_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|4402221_4402449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4402445_4402766_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|4402777_4405111_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
4416964:4416978	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 1
NZ_CP032241	Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence	219775	3741	77906	219775	integrase,transposase	Macacine_betaherpesvirus(16.67%)	57	23003:23026	69083:69106
WP_004213833.1|3741_4878_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004213829.1|4943_5261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197568.1|5412_5736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011251302.1|6487_7447_-	DNA replication protein	NA	NA	NA	NA	NA
WP_004186937.1|7489_7897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213821.1|7906_8350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213807.1|9613_10582_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	7.3e-14
WP_004902302.1|10909_12502_-|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	3.2e-176
WP_004189161.1|12532_12883_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_004215130.1|12879_13320_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	53.8	4.4e-19
WP_004902307.1|13516_13699_+	DUF4113 domain-containing protein	NA	A0A1W6JNT0	Morganella_phage	57.1	9.1e-11
WP_004117790.1|14904_15876_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
WP_004211841.1|15875_17042_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.4	2.0e-223
WP_004211839.1|17771_18782_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	53.5	1.1e-86
WP_004211835.1|21101_21638_-	hypothetical protein	NA	NA	NA	NA	NA
23003:23026	attL	GCACTGTTTTCAGGGAGGAGATCA	NA	NA	NA	NA
WP_004214667.1|24388_25171_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.1	3.0e-135
WP_004902343.1|27517_27955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004902347.1|27954_28986_-	ParB/RepB/Spo0J family partition protein	NA	S5WII0	Leptospira_phage	26.1	2.9e-08
WP_011251296.1|28985_29852_-	ParA family protein	NA	NA	NA	NA	NA
WP_011251294.1|30375_30621_-	molecular chaperone DnaJ	NA	NA	NA	NA	NA
WP_077250517.1|32536_32695_-	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.7	2.2e-05
WP_004213558.1|33007_33937_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.4	5.6e-72
WP_004213560.1|34081_34861_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.4	6.0e-51
WP_077250520.1|34857_35670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213077.1|36650_36857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213076.1|36846_37140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213075.1|37155_38289_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_004213073.1|38896_39127_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004213072.1|39123_39567_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_004213938.1|41860_42136_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_004213934.1|42357_43278_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_011251327.1|43326_43818_-	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_004213932.1|43880_44156_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_004902152.1|44239_44668_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_004213927.1|44705_45266_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004213925.1|45307_45568_-	DUF1471 domain-containing protein	NA	A0A1B2IE60	Erwinia_phage	51.0	1.1e-06
WP_004213924.1|46234_48436_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_004213923.1|48517_49795_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_004213922.1|49798_51532_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_004213921.1|51531_52479_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_004213920.1|52479_54204_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_004213919.1|54336_55560_+	MFS transporter	NA	NA	NA	NA	NA
WP_004213918.1|56257_56452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004145290.1|57312_57822_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	8.8e-19
WP_004213915.1|58371_58689_-	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_004902159.1|58925_59312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213424.1|61052_61760_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_032412871.1|62422_63421_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_004213250.1|63426_64383_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004213252.1|64404_65232_-	ABC transporter ATP-binding protein	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	28.4	2.2e-11
WP_004213850.1|65976_66900_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	1.7e-166
WP_094818822.1|67011_67578_+	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
WP_011251259.1|70193_70847_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
69083:69106	attR	GCACTGTTTTCAGGGAGGAGATCA	NA	NA	NA	NA
WP_004213611.1|73600_74152_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004213613.1|74224_75127_+	DMT family transporter	NA	NA	NA	NA	NA
WP_004213615.1|75269_75491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|76925_77906_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 2
NZ_CP032241	Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence	219775	130233	191919	219775	transposase,protease	Bacillus_phage(22.73%)	52	NA	NA
WP_000427619.1|130233_131238_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_004213592.1|131316_134286_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.3	0.0e+00
WP_004213590.1|134288_134846_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	2.6e-48
WP_000118563.1|134975_136052_-	signal peptidase II	NA	NA	NA	NA	NA
WP_004213585.1|136048_138454_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	46.1	1.0e-141
WP_000405672.1|138539_138974_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000427619.1|139064_140069_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_004152084.1|140596_141997_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_001188930.1|141993_142674_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004213583.1|142728_143658_-	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_000025662.1|143662_144043_-	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_011251290.1|144082_144979_-	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_004213580.1|144978_146796_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_048336866.1|147029_147497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118669.1|147763_148501_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_000843497.1|148534_148732_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004098955.1|148772_151220_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000758228.1|151346_151787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004098958.1|151873_155020_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_004213579.1|155030_156323_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004213578.1|156436_156799_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004213577.1|156827_158213_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_004213574.1|158402_159083_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.7	1.3e-30
WP_000555737.1|159075_160551_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_023302802.1|160801_161233_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_004213569.1|161376_161727_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	53.3	3.2e-20
WP_023302803.1|162113_163022_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_004213565.1|163658_164633_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_004213078.1|164936_165227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004225022.1|165216_166116_+	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_004215174.1|166164_168390_-	exclusion suppressor FxsA	NA	NA	NA	NA	NA
WP_004215173.1|168391_169294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004225020.1|169377_169560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004215188.1|169578_170040_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004215186.1|170155_171103_+	DMT family transporter	NA	NA	NA	NA	NA
WP_004225018.1|171438_172434_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.7	3.1e-20
WP_004210218.1|172639_173653_-	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	26.0	5.8e-06
WP_004210220.1|173765_174293_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_077250518.1|174306_177264_+|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	22.8	2.3e-50
WP_004144375.1|178105_178966_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	21.7	9.0e-08
WP_011251321.1|180697_181333_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_011251320.1|181669_182911_-	tellurium resistance protein TerF	NA	A0A2D1GNA9	Pseudoalteromonas_phage	27.2	2.2e-10
WP_000301240.1|182995_183571_-	tellurium resistance cAMP binding protein TerE	NA	K4JRX3	Caulobacter_phage	41.6	9.6e-30
WP_004026609.1|183657_184236_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	40.8	1.9e-33
WP_004026607.1|184274_185315_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	46.5	1.8e-71
WP_004026604.1|185338_185794_-	tellurium resistance membrane protein TerB	NA	NA	NA	NA	NA
WP_011251319.1|185816_186968_-	tellurium resistance system protein TerA	NA	NA	NA	NA	NA
WP_004196925.1|186964_187549_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	29.4	2.0e-11
WP_011251317.1|187859_188918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181731.1|188929_190072_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	28.5	3.7e-33
WP_004181732.1|190064_190838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026596.1|190839_191919_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	1.7e-40
>prophage 1
NZ_CP032242	Klebsiella pneumoniae strain XJ-K2 plasmid unnamed2, complete sequence	96030	1485	61735	96030	integrase,transposase	Escherichia_phage(43.48%)	51	12189:12203	50315:50329
WP_012579081.1|1485_2409_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
WP_001067855.1|4151_4856_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014839979.1|6735_7254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839980.1|7258_7675_-	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_001067855.1|8060_8765_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000957857.1|9442_9631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064441864.1|9722_10259_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	2.8e-84
WP_000027057.1|10441_11302_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_012372818.1|11471_12227_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
12189:12203	attL	GGAACAGAACTTATA	NA	NA	NA	NA
WP_001067858.1|12676_13381_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_159227438.1|13439_16253_+	conjugal transfer mating pair stabilization protein TraG	NA	NA	NA	NA	NA
WP_000632668.1|16285_16807_+	conjugal transfer entry exclusion protein TraS	NA	NA	NA	NA	NA
WP_021559024.1|16831_17563_+	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_137570799.1|17860_18502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059274178.1|18552_20769_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_071177725.1|20768_25904_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_001067855.1|25937_26642_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_013213989.1|27082_27508_+	antirestriction protein	NA	A0A2D0W8Z5	Bordetella_virus	37.3	5.3e-17
WP_004199234.1|29367_30249_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_013213985.1|30524_31505_-|transposase	IS481-like element ISKpn27 family transposase	transposase	A8RHK4	Spiroplasma_virus	27.4	2.9e-10
WP_014343468.1|31627_32101_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	99.3	3.3e-76
WP_001067855.1|32140_32845_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000204520.1|34156_34864_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|34860_35097_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|35093_35456_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|35473_37168_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|37219_37642_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|37677_37953_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|37966_38317_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|38388_38823_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000427619.1|38901_39906_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000361404.1|41439_42462_-	helicase UvrD	NA	NA	NA	NA	NA
WP_004206609.1|42446_44009_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001044770.1|44082_44499_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261282.1|44495_44726_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011977810.1|45304_46249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032738650.1|46327_46678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013214008.1|46735_47257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011977813.1|47302_47506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013214009.1|48721_49501_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.4e-52
WP_013214010.1|49546_49804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|50579_51446_+	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
50315:50329	attR	GGAACAGAACTTATA	NA	NA	NA	NA
WP_011977818.1|52552_53758_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	5.3e-163
WP_086523286.1|53754_54732_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	53.8	1.4e-86
WP_013214011.1|54813_56085_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	7.5e-152
WP_001568036.1|56084_56516_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_004152765.1|56925_58410_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152353.1|58658_59630_+	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_013214012.1|59632_60304_+	mediator of plasmid stability	NA	NA	NA	NA	NA
WP_001568040.1|60366_60597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568041.1|61033_61735_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
>prophage 1
NZ_CP032243	Klebsiella pneumoniae strain XJ-K2 plasmid unnamed3, complete sequence	84855	4986	12167	84855	transposase,integrase	Escherichia_phage(28.57%)	7	4935:4994	8478:9297
4935:4994	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067855.1|4986_5691_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004201280.1|5937_6411_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_000845048.1|6566_7580_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067855.1|8529_9234_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_053897648.1|9258_10815_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.1e-83
8478:9297	attR	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCC	NA	NA	NA	NA
WP_108970993.1|10962_11742_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	51.0	3.7e-69
WP_045325066.1|11741_12167_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	49.3	3.7e-31
