The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP029150	Glaesserella parasuis strain GZ20170512 chromosome, complete genome	2266893	552548	603055	2266893	integrase,plate,tail,terminase,tRNA,transposase,head	Haemophilus_phage(95.65%)	59	590253:590277	614284:614308
WP_159179828.1|552548_553040_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_021119442.1|553049_554162_+	LysM peptidoglycan-binding domain-containing protein	NA	M1HNA7	Bacillus_virus	24.3	1.2e-17
WP_026916812.1|554234_554942_+	YwiC-like family protein	NA	NA	NA	NA	NA
WP_005710515.1|554965_555709_-	YdcF family protein	NA	NA	NA	NA	NA
WP_005710517.1|555844_556522_+	N-acylneuraminate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005710522.1|558101_558902_+	glycosyltransferase	NA	F2Y1U7	Organic_Lake_phycodnavirus	29.7	2.9e-16
WP_005710524.1|559030_560971_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_005710526.1|560967_561501_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_021114577.1|561848_563222_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_159179829.1|563233_564766_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005710531.1|565044_566097_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_005710533.1|566188_567238_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_005710534.1|567237_567726_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_075621066.1|568429_568690_+	hypothetical protein	NA	F6MIM3	Haemophilus_phage	97.7	3.5e-40
WP_159179830.1|568730_569558_-	hypothetical protein	NA	F6MIM2	Haemophilus_phage	95.3	1.3e-152
WP_075621077.1|569594_570074_-	enoyl-CoA hydratase	NA	F6MIM0	Haemophilus_phage	92.9	2.5e-84
WP_159179831.1|570066_570633_-	DUF4376 domain-containing protein	NA	F6MIL9	Haemophilus_phage	92.0	3.6e-98
WP_021115449.1|572391_572970_-	DUF2313 domain-containing protein	NA	F6MIL7	Haemophilus_phage	99.5	4.7e-109
WP_159179832.1|572966_574028_-|plate	baseplate J protein	plate	F6MIL6	Haemophilus_phage	96.9	1.5e-190
WP_021115447.1|574039_574390_-	mu bacteriophage protein gp46	NA	F6MIL5	Haemophilus_phage	99.1	1.2e-59
WP_005711896.1|574494_575145_-|plate	phage baseplate assembly protein V	plate	F6MIL4	Haemophilus_phage	86.1	2.5e-95
WP_159179833.1|575141_576266_-|tail	phage tail protein	tail	F6MIL3	Haemophilus_phage	97.0	9.5e-199
WP_159179834.1|576270_577626_-	hypothetical protein	NA	F6MIL2	Haemophilus_phage	94.2	2.5e-246
WP_159179835.1|577626_579942_-|tail	phage tail tape measure protein	tail	F6MIL1	Haemophilus_phage	87.2	2.8e-298
WP_026916652.1|579987_580182_-	hypothetical protein	NA	F6MIL0	Haemophilus_phage	97.9	8.8e-20
WP_149350649.1|580211_580568_-	hypothetical protein	NA	F6MIK9	Haemophilus_phage	99.2	5.5e-60
WP_021115441.1|580567_580942_-	hypothetical protein	NA	F6MIK8	Haemophilus_phage	98.4	2.1e-62
WP_106379880.1|580951_582367_-|tail	phage tail protein	tail	B7SDP8	Haemophilus_phage	97.9	6.0e-251
WP_005711909.1|582375_582555_-	DUF2635 domain-containing protein	NA	B7SDP7	Haemophilus_phage	93.2	1.4e-24
WP_075621003.1|582544_583192_-	DUF1834 family protein	NA	B7SDP5	Haemophilus_phage	91.0	2.5e-103
WP_016057773.1|583188_583665_-	DUF1320 domain-containing protein	NA	B7SDP4	Haemophilus_phage	100.0	6.2e-83
WP_035493258.1|583667_584021_-	hypothetical protein	NA	B7SDP3	Haemophilus_phage	99.1	6.2e-56
WP_075621004.1|584076_585000_-|head	head protein	head	B7SDP1	Haemophilus_phage	99.7	1.0e-174
WP_075621005.1|584999_586076_-	hypothetical protein	NA	B7SDN9	Haemophilus_phage	97.2	8.8e-194
WP_075605790.1|586315_586732_-	phage virion morphogenesis protein	NA	B7SDN8	Haemophilus_phage	97.1	3.6e-71
WP_106405083.1|586791_587001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075605791.1|587301_588591_-|head	phage head morphogenesis protein	head	B7SDN5	Haemophilus_phage	98.4	1.7e-247
WP_159179836.1|588577_590233_-	DUF935 family protein	NA	B7SDN1	Haemophilus_phage	96.9	0.0e+00
590253:590277	attL	GGACACACGCAGTGTGTCCCTACCT	NA	NA	NA	NA
WP_159180033.1|590285_591902_-|terminase	phage terminase large subunit	terminase	B7SDN0	Haemophilus_phage	98.5	0.0e+00
WP_159179837.1|592002_592512_-	DUF1804 family protein	NA	F6MIK6	Haemophilus_phage	98.2	2.6e-87
WP_159179838.1|592512_592767_-	hypothetical protein	NA	F6MIK5	Haemophilus_phage	96.4	1.0e-20
WP_005711935.1|592763_593024_-	hypothetical protein	NA	F6MIK4	Haemophilus_phage	92.7	2.4e-12
WP_159179839.1|593186_593540_-	DUF2681 domain-containing protein	NA	F6MIK1	Haemophilus_phage	66.7	1.0e-29
WP_021115427.1|593536_593767_-	DUF2644 domain-containing protein	NA	F6MIK0	Haemophilus_phage	98.7	2.2e-33
WP_158661086.1|593763_593913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016057760.1|593905_594448_-	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	100.0	3.5e-106
WP_026916639.1|594526_594952_-	mor transcription activator family protein	NA	F6MIJ8	Haemophilus_phage	99.3	3.2e-75
WP_035520840.1|595121_595661_-	hypothetical protein	NA	F6MIJ7	Haemophilus_phage	100.0	2.0e-98
WP_035491011.1|595752_596175_-	regulatory protein GemA	NA	F6MIJ6	Haemophilus_phage	99.3	1.4e-73
WP_075605981.1|596155_596719_-	hypothetical protein	NA	F6MIJ5	Haemophilus_phage	94.7	2.0e-96
WP_075620982.1|596859_597177_-	hypothetical protein	NA	F6MIJ3	Haemophilus_phage	66.0	9.0e-30
WP_026916633.1|597471_597993_-	host-nuclease inhibitor protein Gam	NA	F6MIJ0	Haemophilus_phage	93.1	1.4e-83
WP_016528536.1|598004_598298_-	hypothetical protein	NA	F6MII9	Haemophilus_phage	94.8	2.6e-47
WP_005711959.1|598299_598491_-	hypothetical protein	NA	F6MII8	Haemophilus_phage	100.0	3.9e-28
WP_016057750.1|598498_599380_-	AAA family ATPase	NA	F6MII7	Haemophilus_phage	100.0	8.0e-161
WP_016057749.1|599463_599886_-	hypothetical protein	NA	F6MII6	Haemophilus_phage	100.0	1.5e-69
WP_159179840.1|599895_601872_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	F6MII5	Haemophilus_phage	99.7	0.0e+00
WP_005822937.1|601881_602151_-	transcriptional regulator	NA	F6MII4	Haemophilus_phage	100.0	7.6e-46
WP_159179841.1|602335_603055_+	helix-turn-helix domain-containing protein	NA	F6MII3	Haemophilus_phage	87.0	1.9e-115
614284:614308	attR	AGGTAGGGACACACTGCGTGTGTCC	NA	NA	NA	NA
>prophage 2
NZ_CP029150	Glaesserella parasuis strain GZ20170512 chromosome, complete genome	2266893	1094749	1108426	2266893		uncultured_Mediterranean_phage(12.5%)	10	NA	NA
WP_021115957.1|1094749_1097578_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.0	2.9e-305
WP_010786780.1|1097743_1098286_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	56.2	2.1e-42
WP_010786779.1|1098491_1099706_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_005712618.1|1100095_1101316_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.1	2.0e-40
WP_005712616.1|1101379_1101652_-	HigA family addiction module antidote protein	NA	A0A2P1MXE5	Escherichia_phage	42.5	2.2e-08
WP_010786777.1|1101662_1101941_-	plasmid maintenance system killer protein	NA	A0A0M3LQB1	Mannheimia_phage	48.9	2.6e-17
WP_005712612.1|1102087_1103098_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_075620774.1|1103444_1104707_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.2	4.3e-99
WP_010786775.1|1104820_1106149_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	39.1	6.0e-43
WP_010786774.1|1106182_1108426_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	30.9	2.0e-86
>prophage 3
NZ_CP029150	Glaesserella parasuis strain GZ20170512 chromosome, complete genome	2266893	1121673	1168784	2266893	integrase,transposase,tail,protease	Mannheimia_phage(43.75%)	45	1129990:1130004	1167072:1167086
WP_005714908.1|1121673_1122660_-|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	32.7	9.7e-22
WP_010787361.1|1122944_1123442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010787362.1|1123451_1123595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010787363.1|1123752_1124922_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_010787364.1|1124921_1125353_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_159179917.1|1125362_1125647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010787360.1|1127455_1128169_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
1129990:1130004	attL	ATCAGGCTGTGTTGC	NA	NA	NA	NA
WP_016527735.1|1133419_1134628_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	48.1	2.3e-49
WP_131321221.1|1134640_1135483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010786966.1|1135492_1135768_+	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
WP_010786965.1|1135907_1137074_+	putative phage-like membrane protein	NA	NA	NA	NA	NA
WP_010786964.1|1137058_1138309_+	putative phage-like secreted protein	NA	NA	NA	NA	NA
WP_010786963.1|1138588_1139788_+	acetate kinase	NA	NA	NA	NA	NA
WP_010786962.1|1139896_1142032_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_010786961.1|1142142_1143102_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_159179918.1|1143280_1143688_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.1	8.9e-22
WP_005712577.1|1143689_1144331_-	starvation protein A	NA	NA	NA	NA	NA
WP_005712575.1|1144546_1144864_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_075605577.1|1144907_1146206_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_012621717.1|1146205_1147096_-	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_035499902.1|1147183_1147546_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_005712567.1|1147539_1147809_-	antitoxin	NA	NA	NA	NA	NA
WP_112062939.1|1148053_1149250_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_010786955.1|1149330_1150245_-	DMT family transporter	NA	NA	NA	NA	NA
WP_010786954.1|1150316_1151504_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005714470.1|1151567_1152449_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_010786953.1|1152533_1153400_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010786952.1|1153401_1153872_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_005714474.1|1154094_1154571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112062938.1|1155850_1156192_-	cell wall hydrolase	NA	K7PLW1	Enterobacteria_phage	55.9	1.4e-25
WP_005714476.1|1156262_1156541_+	peptidase	NA	A0A0M3LQB1	Mannheimia_phage	50.0	4.0e-18
WP_005714478.1|1156552_1156834_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	36.6	2.3e-08
WP_010786947.1|1156830_1157568_-|tail	phage minor tail protein L	tail	A0A0M3LSQ5	Mannheimia_phage	54.5	2.3e-68
WP_035499891.1|1157577_1158066_-	hypothetical protein	NA	A0A0M3LS69	Mannheimia_phage	60.5	1.5e-31
WP_075605944.1|1158750_1160238_-	DUF4041 domain-containing protein	NA	X5JAC1	Clostridium_phage	48.4	1.8e-56
WP_010786944.1|1160355_1160703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010786943.1|1160779_1161106_-|tail	phage tail protein	tail	A0A0M3LQW6	Mannheimia_phage	61.7	4.9e-39
WP_010786942.1|1161107_1161443_-	hypothetical protein	NA	A0A0M3LQT0	Mannheimia_phage	67.3	1.4e-33
WP_075620767.1|1161451_1162372_-	hypothetical protein	NA	A0A0M3LQV7	Mannheimia_phage	73.9	1.3e-76
WP_005714627.1|1162495_1163017_-	ATPase	NA	A0A0M3LR56	Mannheimia_phage	53.5	1.5e-34
WP_080661240.1|1163283_1163988_-	recombinase	NA	A0A0R6PHM5	Moraxella_phage	44.3	4.9e-44
WP_035499888.1|1164049_1164355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049753181.1|1165469_1166111_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1V0E8G8	Vibrio_phage	33.2	1.2e-20
WP_010786936.1|1166406_1166736_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_010786935.1|1166861_1168784_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	28.9	1.0e-35
1167072:1167086	attR	ATCAGGCTGTGTTGC	NA	NA	NA	NA
>prophage 4
NZ_CP029150	Glaesserella parasuis strain GZ20170512 chromosome, complete genome	2266893	1198647	1207674	2266893	tRNA,transposase	Burkholderia_virus(16.67%)	8	NA	NA
WP_005711533.1|1198647_1198929_-	integration host factor subunit beta	NA	A4JWM7	Burkholderia_virus	44.4	2.4e-10
WP_010786907.1|1198994_1200662_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_010786906.1|1200758_1201424_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_035499863.1|1201433_1202459_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IT49	uncultured_Mediterranean_phage	28.7	3.7e-16
WP_012621529.1|1202712_1203684_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	4.1e-09
WP_005711543.1|1203733_1204621_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	45.2	1.4e-59
WP_005711547.1|1204800_1204986_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	1.4e-11
WP_159179921.1|1205049_1207674_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.4	3.0e-78
>prophage 5
NZ_CP029150	Glaesserella parasuis strain GZ20170512 chromosome, complete genome	2266893	1254773	1309408	2266893	protease,tail,capsid,tRNA,terminase,transposase	Mannheimia_phage(36.36%)	53	NA	NA
WP_159179925.1|1254773_1256777_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_010786871.1|1256903_1257674_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_010786870.1|1258063_1259296_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_010786869.1|1260593_1261217_-	MarC family protein	NA	NA	NA	NA	NA
WP_159179926.1|1261296_1263210_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	30.4	3.9e-67
WP_035499829.1|1264225_1266154_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	43.2	2.0e-116
WP_010786866.1|1266227_1266854_-	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_005714049.1|1267094_1267883_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010786865.1|1267962_1268625_+	Fic family protein	NA	NA	NA	NA	NA
WP_010786864.1|1268682_1268979_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010786863.1|1269162_1271142_+	exoribonuclease II	NA	NA	NA	NA	NA
WP_005714201.1|1271252_1272344_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_159179927.1|1273344_1277958_-	hypothetical protein	NA	A0A2C9CZB7	Yersinia_phage	35.4	3.1e-06
WP_159179928.1|1278536_1278680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005714340.1|1279515_1280112_-	DedA family protein	NA	NA	NA	NA	NA
WP_005714341.1|1280122_1281145_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	33.8	1.2e-35
WP_010786764.1|1281258_1282203_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005714346.1|1282289_1282820_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_075592618.1|1282961_1284179_-	tyrosine transporter	NA	NA	NA	NA	NA
WP_075620998.1|1284327_1285542_-	amino acid permease	NA	NA	NA	NA	NA
WP_010786761.1|1286326_1286806_-	redoxin family protein	NA	NA	NA	NA	NA
WP_010786760.1|1286823_1287474_-	cytochrome C biogenesis protein CcdA	NA	NA	NA	NA	NA
WP_012621776.1|1287475_1288546_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_010786758.1|1288649_1288979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005713976.1|1289120_1289693_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005713975.1|1289689_1289875_+	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_005713972.1|1291028_1291325_-|terminase	terminase, ATPase subunit	terminase	A0A0M3LRV4	Mannheimia_phage	59.8	2.4e-21
WP_021118203.1|1291492_1292308_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0M3LSA0	Mannheimia_phage	44.5	3.7e-51
WP_038513810.1|1292320_1292524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012621779.1|1292523_1293177_+|terminase	terminase	terminase	A4JWP8	Burkholderia_virus	42.1	2.9e-38
WP_010786754.1|1293211_1293349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038513807.1|1293332_1293857_+	lysozyme	NA	A0A0M3LQY4	Mannheimia_phage	57.4	3.4e-50
WP_159179929.1|1293841_1294309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010786751.1|1294491_1295010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159179930.1|1295215_1295434_+	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	69.9	1.2e-20
WP_159179931.1|1295430_1295907_+|tail	phage tail protein	tail	Q19UR3	Mannheimia_phage	52.9	2.5e-39
WP_159179932.1|1295906_1296368_+	phage virion morphogenesis protein	NA	Q19UR2	Mannheimia_phage	62.0	7.9e-43
WP_010786748.1|1296393_1296648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080661236.1|1296776_1299518_+|tail	phage tail tape measure protein	tail	V5YUN9	Pseudomonas_phage	37.8	7.5e-64
WP_010786746.1|1299644_1300187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010786745.1|1300179_1300602_+	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_010786743.1|1301097_1301475_-	anti-termination protein Q, phage associated	NA	Q7Y5V5	Haemophilus_phage	29.5	1.8e-08
WP_010786742.1|1301471_1302041_-	recombination protein NinG	NA	A0A0U4KL68	Pseudomonas_phage	54.5	1.8e-49
WP_010786741.1|1302286_1302469_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	67.8	9.4e-16
WP_010786740.1|1302501_1302915_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q775F5	Haemophilus_virus	53.3	1.2e-34
WP_010786738.1|1303459_1304815_-	AAA family ATPase	NA	A0A0M3LQC0	Mannheimia_phage	61.9	7.7e-155
WP_010786737.1|1304814_1305195_-	hypothetical protein	NA	Q7Y5W1	Haemophilus_phage	57.4	1.2e-25
WP_005714908.1|1305210_1306197_-|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	32.7	9.7e-22
WP_159179933.1|1306334_1306982_-	hypothetical protein	NA	A0A0M3LQL8	Mannheimia_phage	44.8	5.4e-21
WP_010786733.1|1306959_1307142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010786732.1|1307480_1307681_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010786731.1|1307807_1308479_+	helix-turn-helix transcriptional regulator	NA	A0A1B1P9J5	Acinetobacter_phage	29.8	1.4e-19
WP_005714534.1|1308559_1309408_+	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	52.4	2.8e-70
>prophage 6
NZ_CP029150	Glaesserella parasuis strain GZ20170512 chromosome, complete genome	2266893	1420985	1430750	2266893	tRNA	Mollivirus(12.5%)	9	NA	NA
WP_010786632.1|1420985_1422500_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	39.4	1.4e-80
WP_005710639.1|1422630_1423215_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	40.5	2.2e-29
WP_159179940.1|1423231_1423885_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	37.5	3.0e-35
WP_159179941.1|1424074_1424587_-	endopeptidase	NA	A0A0K2SUC1	Clostridium_phage	40.0	4.1e-16
WP_005710633.1|1424638_1424935_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	7.9e-12
WP_159179942.1|1424951_1427339_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	29.9	1.4e-05
WP_005714554.1|1427494_1428478_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	37.4	1.9e-33
WP_005714552.1|1428787_1429468_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_010786626.1|1429487_1430750_+	inorganic phosphate transporter	NA	E5ES24	Ostreococcus_lucimarinus_virus	35.5	1.1e-59
>prophage 7
NZ_CP029150	Glaesserella parasuis strain GZ20170512 chromosome, complete genome	2266893	1593024	1666983	2266893	protease,portal,tail,tRNA,terminase	Mannheimia_phage(26.92%)	73	NA	NA
WP_021116070.1|1593024_1594452_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_159179958.1|1594603_1595272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159179959.1|1595341_1597966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159179960.1|1598557_1600489_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	4.4e-127
WP_159179961.1|1600678_1601041_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_159180042.1|1601195_1603781_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.6	3.3e-186
WP_005712977.1|1603863_1604358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159180043.1|1604362_1605385_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_010786355.1|1605381_1605576_-	DNA gyrase inhibitor YacG	NA	NA	NA	NA	NA
WP_010786354.1|1605579_1606200_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_159179962.1|1606286_1606634_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_021112628.1|1606648_1607494_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	25.5	2.8e-17
WP_010786351.1|1608693_1609143_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_010786350.1|1609281_1610022_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_010786349.1|1610139_1610628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159179963.1|1610701_1611280_+	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_159179964.1|1611331_1612312_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.3	4.2e-17
WP_005712951.1|1612326_1613310_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.0	1.4e-17
WP_010786346.1|1613320_1614214_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005712947.1|1614242_1615247_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_010786345.1|1615340_1616936_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010786344.1|1617183_1618524_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A1X9I6F4	Streptococcus_phage	25.8	5.7e-33
WP_010786343.1|1618594_1619917_+	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_021110971.1|1619935_1620352_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_010786341.1|1620351_1620909_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_062924323.1|1620909_1621644_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_005712929.1|1621880_1622468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005712927.1|1622551_1622863_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_005712925.1|1623183_1624161_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_005712922.1|1624297_1625077_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_021110215.1|1625836_1626214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075592701.1|1628342_1629377_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	M4QRQ6	Synechococcus_phage	42.2	8.5e-69
WP_159180044.1|1629564_1630512_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_075605881.1|1630513_1630795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149351063.1|1630798_1631461_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_159179965.1|1631520_1634337_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9V7W4	Bandra_megavirus	25.5	5.5e-78
WP_010786332.1|1634842_1636210_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005713881.1|1636347_1637304_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_010786331.1|1637644_1638436_-	antimicrobial peptide ABC transporter ATPase	NA	NA	NA	NA	NA
WP_159179966.1|1638464_1642352_-	DUF1983 domain-containing protein	NA	A0A0M3LQ61	Mannheimia_phage	62.5	3.8e-13
WP_010786330.1|1642405_1642918_-|tail	tail assembly protein	tail	A0A0M3LQC4	Mannheimia_phage	41.0	1.7e-25
WP_075621043.1|1642947_1643709_-	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	49.2	2.2e-66
WP_010786328.1|1643752_1644133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016527897.1|1644132_1644879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075621044.1|1644958_1645696_-|tail	phage minor tail protein L	tail	A0A0M3LSQ5	Mannheimia_phage	53.7	1.1e-67
WP_020997028.1|1645695_1646028_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	40.0	1.6e-13
WP_159179967.1|1648024_1649632_-	tape measure protein	NA	A0A125RN77	Pseudomonas_phage	50.9	3.6e-50
WP_075592536.1|1649694_1649961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005714578.1|1650044_1650314_-	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_005714576.1|1650317_1650584_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_005714573.1|1650652_1650880_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_005714571.1|1650924_1651326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075592537.1|1651399_1652065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005714567.1|1652067_1652487_-|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	33.3	7.2e-11
WP_075592538.1|1652486_1653020_-|tail	phage tail protein	tail	M9NZH5	Enterobacteria_phage	36.3	8.3e-20
WP_010786319.1|1653023_1653329_-|tail	bacteriophage tail protein	tail	NA	NA	NA	NA
WP_005714561.1|1653321_1653648_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_075592539.1|1653715_1655683_-|protease	Clp protease ClpP	protease	A0A1W6JT88	Pseudomonas_phage	56.9	8.0e-193
WP_075592540.1|1655708_1657208_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	57.0	1.7e-155
WP_005714374.1|1657208_1657430_-	hypothetical protein	NA	K7PMB5	Enterobacterial_phage	55.9	1.3e-11
WP_075621053.1|1657447_1659568_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	66.5	5.1e-270
WP_005714379.1|1659567_1660035_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	53.9	1.3e-40
WP_010786313.1|1660528_1660873_-	DUF2570 domain-containing protein	NA	A0A0M3LSP1	Mannheimia_phage	58.0	2.6e-06
WP_010786312.1|1660845_1661391_-	lysozyme	NA	Q19UR6	Mannheimia_phage	49.2	9.3e-43
WP_112063205.1|1661365_1661629_-	hypothetical protein	NA	A0A0M3LR95	Mannheimia_phage	70.6	1.7e-18
WP_010786310.1|1661751_1662213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010786309.1|1662195_1662441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010786308.1|1662671_1662857_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_005714900.1|1662886_1663324_+	CopG family transcriptional regulator	NA	A0A0R6PJ17	Moraxella_phage	36.9	1.4e-20
WP_159180045.1|1663345_1663729_-	antitermination protein	NA	NA	NA	NA	NA
WP_010786304.1|1665011_1665377_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_010786303.1|1665444_1665885_+	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_005713993.1|1666158_1666983_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	33.0	1.1e-31
>prophage 8
NZ_CP029150	Glaesserella parasuis strain GZ20170512 chromosome, complete genome	2266893	1778707	1787115	2266893		Staphylococcus_phage(50.0%)	7	NA	NA
WP_005712132.1|1778707_1780027_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	33.7	1.5e-30
WP_010786215.1|1780218_1782093_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_010786214.1|1782474_1783566_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	37.3	7.1e-50
WP_010786213.1|1783567_1784212_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	42.1	2.1e-41
WP_010786212.1|1784343_1785543_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.2	3.1e-99
WP_010786211.1|1785738_1786200_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	58.8	4.6e-43
WP_010786210.1|1786323_1787115_-	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	28.0	3.1e-10
>prophage 9
NZ_CP029150	Glaesserella parasuis strain GZ20170512 chromosome, complete genome	2266893	1790286	1799068	2266893	integrase	Mannheimia_phage(37.5%)	11	1785614:1785628	1800375:1800389
1785614:1785628	attL	GGCAAGCGGTCAGAT	NA	NA	NA	NA
WP_005712159.1|1790286_1791141_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.5	1.8e-32
WP_010786206.1|1791543_1792599_-|integrase	site-specific integrase	integrase	A0A077KGX2	Edwardsiella_phage	37.3	8.6e-61
WP_010786205.1|1792898_1793702_-	hypothetical protein	NA	Q7Y5X0	Haemophilus_phage	43.7	2.6e-33
WP_005712166.1|1794155_1794536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010786204.1|1794901_1795114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010786203.1|1795133_1795397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159179979.1|1795420_1795942_-	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	67.2	4.1e-40
WP_010786201.1|1796285_1796474_+	hypothetical protein	NA	Q19US2	Mannheimia_phage	50.0	7.4e-08
WP_010786200.1|1796515_1797130_-	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	78.2	7.4e-89
WP_010786199.1|1797126_1797993_-	phage recombination protein Bet	NA	A0A2H4JAQ4	uncultured_Caudovirales_phage	54.9	6.2e-57
WP_010786196.1|1798885_1799068_-	hypothetical protein	NA	F6MIM4	Haemophilus_phage	95.0	5.0e-25
1800375:1800389	attR	GGCAAGCGGTCAGAT	NA	NA	NA	NA
