The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047112	Proteus mirabilis strain SCBX1.1 chromosome, complete genome	4200651	48397	107667	4200651	lysis,tRNA,tail,holin,integrase,terminase,head,capsid,portal,protease,plate	Salmonella_phage(30.77%)	69	60535:60582	90970:91017
WP_004246449.1|48397_48901_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_110706819.1|48912_50079_-	nucleotide sugar dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	57.4	1.0e-118
WP_036895934.1|50128_50944_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.6	4.0e-05
WP_110706818.1|50943_52050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143475492.1|52055_52976_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_072021552.1|52979_54236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036896203.1|54232_54742_-	acyltransferase	NA	NA	NA	NA	NA
WP_110706815.1|54808_56233_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_110706814.1|56223_57378_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_004249722.1|57584_58976_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	27.3	3.4e-20
WP_004246432.1|58988_59687_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	31.1	8.1e-07
WP_004249721.1|59870_60437_+	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
60535:60582	attL	GACACCATCCCTGTCTTTTGCAGCCCCTCTGGAGAGGGGCTTTTTTTT	NA	NA	NA	NA
WP_071233825.1|60731_61712_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	62.9	9.7e-115
WP_071233827.1|61778_62072_-	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	59.8	1.1e-26
WP_071233830.1|62201_62474_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	56.7	2.0e-22
WP_049220106.1|62475_62664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159290065.1|62660_62810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071233831.1|62818_63214_+	DUF5347 family protein	NA	NA	NA	NA	NA
WP_012368209.1|63231_63489_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_036907622.1|63481_63703_+	TraR/DksA family transcriptional regulator	NA	F1BUS2	Erwinia_phage	52.1	2.0e-12
WP_064505894.1|63704_64013_+	DUF3850 domain-containing protein	NA	A0A218M496	Shigella_phage	42.1	1.4e-08
WP_071233832.1|64012_64840_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	47.8	6.8e-61
WP_036908532.1|64839_65163_+	DUF5405 family protein	NA	NA	NA	NA	NA
WP_159290066.1|65162_67541_+	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	47.2	2.7e-163
WP_071233836.1|67747_68089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159290067.1|68200_69550_-	hypothetical protein	NA	R9TRQ8	Vibrio_phage	25.1	6.1e-19
WP_071233976.1|70045_71074_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	69.8	1.1e-137
WP_071233977.1|71073_72828_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	72.8	2.2e-258
WP_071233978.1|73000_73810_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	48.8	2.0e-65
WP_071233979.1|73825_74968_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	66.6	4.9e-126
WP_081353460.1|74964_75633_+	hypothetical protein	NA	F1BUQ7	Erwinia_phage	46.8	1.9e-45
WP_071233981.1|75710_76166_+|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	45.9	1.1e-28
WP_012368195.1|76165_76372_+|tail	tail protein X	tail	K4PAW7	Burkholderia_phage	52.9	1.3e-16
WP_071233982.1|76400_76706_+|holin	holin	holin	NA	NA	NA	NA
WP_071233983.1|76698_77103_+	M15 family metallopeptidase	NA	K4F776	Cronobacter_phage	58.1	6.1e-39
WP_071233984.1|77099_77618_+|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_071233985.1|77592_78033_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	50.0	1.9e-33
WP_071233986.1|78019_78655_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	37.8	4.0e-29
WP_071234003.1|78720_79347_+|plate	phage baseplate assembly protein V	plate	S4TUB5	Salmonella_phage	57.8	1.8e-53
WP_071233987.1|79343_79682_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	50.5	3.8e-26
WP_071233988.1|79683_80592_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	67.2	1.5e-109
WP_071233989.1|80584_81196_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	68.4	1.6e-75
WP_071233990.1|82791_83208_+	hypothetical protein	NA	U5P083	Shigella_phage	33.6	4.1e-14
WP_071233991.1|83300_84473_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	70.6	2.5e-165
WP_012368183.1|84476_84992_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	57.9	2.6e-55
WP_159290269.1|85047_85359_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	55.8	2.7e-18
WP_075204427.1|85319_85493_+|tail	GpE family phage tail protein	tail	A0A2I8TV82	Erwinia_phage	50.9	1.6e-09
WP_071233992.1|85485_88347_+|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	41.7	1.0e-119
WP_036907694.1|88346_88811_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	61.4	3.3e-41
WP_071233993.1|88810_89908_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	54.6	8.6e-112
WP_071233994.1|89960_90179_+	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	70.3	2.2e-19
WP_159290068.1|90225_90429_-	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	2.3e-10
WP_081353461.1|90613_90847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036895946.1|91363_92884_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
90970:91017	attR	GACACCATCCCTGTCTTTTGCAGCCCCTCTGGAGAGGGGCTTTTTTTT	NA	NA	NA	NA
WP_036969549.1|92960_93716_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_004246429.1|94254_95232_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_004249717.1|95525_96530_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004249716.1|96625_97396_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_004249715.1|97502_98138_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_004249714.1|98249_98678_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_159290069.1|98738_99485_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_159290070.1|99823_101008_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	24.2	1.2e-13
WP_004246422.1|101117_102650_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_004246421.1|102692_103508_-	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	28.4	2.9e-16
WP_012368679.1|103804_104047_+	cell division protein ZapB	NA	NA	NA	NA	NA
WP_004246419.1|104140_104659_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_004249712.1|104767_105685_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_004246417.1|105783_107124_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	27.1	8.7e-42
WP_004246416.1|107136_107667_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 2
NZ_CP047112	Proteus mirabilis strain SCBX1.1 chromosome, complete genome	4200651	1153777	1162311	4200651		Mycobacterium_phage(28.57%)	9	NA	NA
WP_004246075.1|1153777_1154977_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.6	3.8e-28
WP_004247427.1|1155585_1156554_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.0	3.5e-133
WP_004252248.1|1156579_1158706_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.3	1.5e-205
WP_004246072.1|1158734_1159139_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	3.7e-12
WP_004246071.1|1159150_1159375_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
WP_004246069.1|1159656_1160130_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004246068.1|1160327_1160537_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	5.9e-22
WP_004246061.1|1160839_1161328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246058.1|1161936_1162311_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
>prophage 3
NZ_CP047112	Proteus mirabilis strain SCBX1.1 chromosome, complete genome	4200651	1202000	1246234	4200651	lysis,tail,integrase,terminase,capsid	Morganella_phage(53.85%)	62	1201914:1201932	1253136:1253154
1201914:1201932	attL	CTGCTTATTGGATTATAGT	NA	NA	NA	NA
WP_026164649.1|1202000_1203002_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	44.3	1.9e-70
WP_004246013.1|1202958_1203204_-	excisionase	NA	NA	NA	NA	NA
WP_017827453.1|1204354_1205050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017827452.1|1205121_1205631_-	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	57.3	4.9e-54
WP_017827451.1|1205630_1206242_-	single-stranded DNA-binding protein	NA	A0A1W6JP21	Morganella_phage	69.2	1.1e-73
WP_017628824.1|1206243_1206564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628823.1|1206560_1206713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036919938.1|1206709_1206973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165439118.1|1206980_1207136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036919939.1|1207189_1207450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628819.1|1207649_1208147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245994.1|1208168_1208486_-	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	52.3	7.1e-19
WP_036908285.1|1208940_1209306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036908283.1|1209302_1210082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036908281.1|1210116_1210761_-	LexA family transcriptional regulator	NA	A0A077KGZ5	Edwardsiella_phage	65.0	1.9e-79
WP_004247477.1|1210866_1211076_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	83.3	1.2e-25
WP_049256531.1|1211221_1211569_+	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	72.9	1.1e-36
WP_004251793.1|1211664_1211838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060554530.1|1211834_1212602_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	52.8	1.8e-23
WP_121909412.1|1212601_1213987_+	helicase	NA	Q716D2	Shigella_phage	47.7	1.4e-114
WP_026090523.1|1214014_1214344_+	hypothetical protein	NA	A0A1C9LVV9	Vibrio_phage	39.0	1.1e-22
WP_049195179.1|1214411_1214861_+	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	32.2	2.9e-13
WP_004245984.1|1214939_1215230_+	DUF1364 domain-containing protein	NA	A0A2H4JIC4	uncultured_Caudovirales_phage	68.1	7.2e-34
WP_004245983.1|1215226_1215583_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	71.6	3.2e-44
WP_004245982.1|1215582_1216215_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	34.3	3.3e-23
WP_004247148.1|1216526_1217048_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_155289772.1|1217206_1217629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026164644.1|1217682_1217952_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	3.5e-19
WP_049255374.1|1217951_1218422_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	61.8	9.8e-49
WP_165439119.1|1218403_1218562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060554533.1|1218564_1219026_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	47.9	7.4e-25
WP_036976683.1|1219234_1219663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164530411.1|1219947_1220112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036976685.1|1220191_1220800_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	68.5	2.2e-64
WP_159290104.1|1220802_1222287_+|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	88.3	2.3e-269
WP_159290105.1|1222288_1223665_+	DUF4055 domain-containing protein	NA	A0A1W6JNV0	Morganella_phage	78.8	2.0e-211
WP_017628801.1|1223673_1224738_+|capsid	minor capsid protein	capsid	A0A1W6JNT7	Morganella_phage	51.4	9.2e-103
WP_017628800.1|1224812_1225499_+	hypothetical protein	NA	A0A1W6JNU9	Morganella_phage	81.1	3.4e-74
WP_017827430.1|1225504_1226455_+	hypothetical protein	NA	A0A1W6JNV5	Morganella_phage	87.1	1.3e-153
WP_017628798.1|1226497_1226875_+	hypothetical protein	NA	A0A1W6JP09	Morganella_phage	71.2	5.8e-44
WP_017628797.1|1226876_1227218_+	hypothetical protein	NA	A0A1W6JNW7	Morganella_phage	79.6	1.2e-51
WP_017628796.1|1227220_1227589_+	hypothetical protein	NA	A0A1W6JNX7	Morganella_phage	83.6	3.3e-52
WP_017628795.1|1227585_1227957_+	hypothetical protein	NA	A0A1W6JNU7	Morganella_phage	70.7	1.5e-47
WP_017628794.1|1228021_1228777_+	hypothetical protein	NA	A0A1W6JNT1	Morganella_phage	81.7	4.7e-109
WP_159290106.1|1228826_1229513_+	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	71.5	1.2e-90
WP_036895031.1|1229705_1231076_-	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_159290107.1|1231077_1231599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036895027.1|1231743_1232142_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_159290108.1|1232266_1232440_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_080741352.1|1232513_1233083_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	61.1	2.0e-32
WP_159290273.1|1233202_1233973_+	hypothetical protein	NA	A0A2I7RX10	Vibrio_phage	39.5	6.8e-39
WP_063693349.1|1234095_1234503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159290109.1|1234574_1237742_+	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	41.9	5.5e-103
WP_165439129.1|1237899_1238373_-	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	45.9	3.9e-29
WP_017628783.1|1238550_1238880_+|tail	phage tail protein	tail	A0A1W6JNT2	Morganella_phage	71.6	9.6e-43
WP_036908262.1|1238876_1239575_+|tail	phage minor tail protein L	tail	A0A1W6JNT8	Morganella_phage	83.2	3.1e-115
WP_017628781.1|1239578_1240298_+	C40 family peptidase	NA	A0A1W6JNU8	Morganella_phage	74.9	2.8e-111
WP_017628780.1|1240234_1240801_+|tail	tail assembly protein	tail	A0A1W6JP03	Morganella_phage	76.7	3.1e-49
WP_159290110.1|1240800_1244946_+	DUF1983 domain-containing protein	NA	A0A1W6JNW2	Morganella_phage	75.5	0.0e+00
WP_004245936.1|1244939_1245308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247523.1|1245309_1245924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245934.1|1245973_1246234_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	56.4	2.5e-17
1253136:1253154	attR	CTGCTTATTGGATTATAGT	NA	NA	NA	NA
>prophage 4
NZ_CP047112	Proteus mirabilis strain SCBX1.1 chromosome, complete genome	4200651	1420765	1499731	4200651	tRNA,protease,plate	Bacillus_phage(17.65%)	58	NA	NA
WP_004244558.1|1420765_1421080_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.1	1.5e-13
WP_004244559.1|1421110_1423405_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	1.3e-170
WP_004244560.1|1423523_1423742_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_004247616.1|1424061_1424754_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004244562.1|1424755_1426507_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.7	1.4e-18
WP_017628444.1|1426509_1428279_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	23.5	3.0e-21
WP_004247618.1|1428417_1429377_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.8	1.2e-64
WP_004244566.1|1429919_1430414_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_159290111.1|1430541_1434351_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.3	1.7e-90
WP_004244569.1|1434463_1435069_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_110706932.1|1435079_1436429_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	4.0e-79
WP_004244571.1|1436562_1437852_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.2	4.1e-97
WP_004244572.1|1438031_1438364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247622.1|1438764_1439814_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_004244574.1|1439886_1440792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244575.1|1441149_1441890_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.0	2.3e-20
WP_004244576.1|1441997_1444280_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.6	1.0e-159
WP_004244577.1|1444334_1445189_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_036900836.1|1445859_1447617_-	30S ribosomal protein S12 methylthiotransferase accessory factor YcaO	NA	NA	NA	NA	NA
WP_004244579.1|1447844_1448882_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_108717050.1|1448956_1450210_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_104459796.1|1450346_1451777_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	24.8	1.5e-07
WP_004244582.1|1451913_1453002_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.0	5.7e-84
WP_004252010.1|1453198_1454485_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_004244585.1|1454773_1455451_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_004244586.1|1455632_1457306_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_004244587.1|1457370_1457658_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.0	8.4e-11
WP_143475375.1|1458089_1460459_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q0H255	Geobacillus_phage	29.3	3.6e-22
WP_004244589.1|1460495_1462241_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.9	8.4e-61
WP_004244590.1|1462237_1463239_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004247631.1|1463734_1463950_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004244593.1|1464364_1464544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244594.1|1464548_1465310_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_004247632.1|1465432_1466263_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_004247633.1|1466642_1467416_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_004244597.1|1467425_1468748_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_004247634.1|1468728_1469460_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_004247635.1|1469456_1473914_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_004247636.1|1474195_1474849_-	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	80.4	8.2e-102
WP_004247637.1|1475255_1475969_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_004247638.1|1476311_1478027_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_004244605.1|1478358_1478907_+	YcbK family protein	NA	NA	NA	NA	NA
WP_004247640.1|1478956_1479607_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004244607.1|1479699_1480173_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004247642.1|1480263_1482000_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_004244609.1|1481992_1483348_-	membrane protein	NA	NA	NA	NA	NA
WP_004244610.1|1483385_1486934_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_110706694.1|1486936_1488400_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004244612.1|1488405_1489056_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_004244614.1|1489057_1489846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104459791.1|1489849_1492573_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.5	1.4e-83
WP_004244617.1|1492581_1493337_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_026164596.1|1493329_1494688_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004244619.1|1494689_1495241_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004247648.1|1495242_1496511_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_004244621.1|1496515_1497553_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_046334530.1|1497516_1499292_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004244624.1|1499299_1499731_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 5
NZ_CP047112	Proteus mirabilis strain SCBX1.1 chromosome, complete genome	4200651	2082523	2168025	4200651	lysis,tRNA,tail,bacteriocin,holin,integrase,transposase,capsid	Morganella_phage(42.31%)	109	2167013:2167028	2168737:2168752
WP_004243086.1|2082523_2083444_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	89.5	1.2e-130
WP_004243087.1|2083758_2084742_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_004248145.1|2085106_2085439_+	DUF4377 domain-containing protein	NA	NA	NA	NA	NA
WP_049236172.1|2085731_2086292_+	porin family protein	NA	NA	NA	NA	NA
WP_004251029.1|2086647_2088267_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004243092.1|2088492_2088996_+	thiol peroxidase	NA	NA	NA	NA	NA
WP_004243093.1|2089095_2090661_-	transcriptional regulator TyrR	NA	NA	NA	NA	NA
WP_049219577.1|2090797_2091220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243095.1|2091677_2092724_-	TIGR01620 family protein	NA	NA	NA	NA	NA
WP_004243096.1|2092720_2094115_-	YcjX family protein	NA	NA	NA	NA	NA
WP_110706620.1|2094095_2094353_-	phage shock protein PspD	NA	NA	NA	NA	NA
WP_004243099.1|2094437_2094794_-	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_004243100.1|2094793_2095024_-	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_017628083.1|2095060_2095729_-	phage shock protein PspA	NA	NA	NA	NA	NA
WP_004248148.1|2095945_2096950_+	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_004243105.1|2097228_2098920_+	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
WP_017628082.1|2098916_2099882_+	peptide ABC transporter permease SapB	NA	NA	NA	NA	NA
WP_004243108.1|2099868_2100762_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_004248150.1|2100761_2101763_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	24.1	5.8e-06
WP_004243110.1|2101752_2102562_+	peptide ABC transporter ATP-binding protein SapF	NA	G9BWD6	Planktothrix_phage	26.9	1.0e-13
WP_004243111.1|2102770_2103559_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_110706619.1|2103777_2104389_+	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_004248153.1|2104467_2105337_-	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_049202939.1|2105457_2106732_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	42.8	4.7e-85
WP_004243118.1|2106862_2107516_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_049219980.1|2107559_2108672_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_004243121.1|2108892_2109360_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_004243123.1|2109704_2110133_-	transcriptional regulator SlyA	NA	NA	NA	NA	NA
WP_004243130.1|2110595_2110835_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_004248157.1|2111015_2111423_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_004243132.1|2111518_2112157_+	ribonuclease T	NA	NA	NA	NA	NA
WP_159290126.1|2112227_2113436_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	81.3	7.3e-189
WP_110706618.1|2113458_2113875_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.8	2.6e-45
WP_036918397.1|2114026_2114365_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_036894993.1|2114642_2114873_+	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	90.8	4.5e-31
WP_049206383.1|2115141_2115486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036894997.1|2115938_2116196_-	cloacin	NA	NA	NA	NA	NA
WP_036894998.1|2116417_2116675_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_049206695.1|2116677_2118540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036895000.1|2118972_2119587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004245936.1|2119588_2119957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159290127.1|2119950_2124099_-	DUF1983 domain-containing protein	NA	A0A1W6JNW2	Morganella_phage	70.1	0.0e+00
WP_036935929.1|2124098_2124665_-|tail	tail assembly protein	tail	A0A1W6JP03	Morganella_phage	77.4	1.4e-49
WP_036895008.1|2124601_2125321_-	C40 family peptidase	NA	A0A1W6JNU8	Morganella_phage	74.5	1.1e-110
WP_036895011.1|2125324_2126023_-|tail	phage minor tail protein L	tail	A0A1W6JNT8	Morganella_phage	84.1	6.2e-116
WP_017628783.1|2126019_2126349_-|tail	phage tail protein	tail	A0A1W6JNT2	Morganella_phage	71.6	9.6e-43
WP_165439129.1|2126526_2127000_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	45.9	3.9e-29
WP_159290128.1|2127157_2130316_-	hypothetical protein	NA	A0A1W6JNU2	Morganella_phage	41.2	5.3e-98
WP_159290129.1|2130381_2131104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159290275.1|2131319_2131919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159290130.1|2131974_2132406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159290131.1|2132407_2133244_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	35.9	7.1e-34
WP_004247510.1|2133612_2133795_+	hypothetical protein	NA	A0A192Y6A8	Salmonella_phage	76.3	3.7e-20
WP_159290132.1|2133808_2134180_-	hypothetical protein	NA	E7C9U7	Salmonella_phage	63.7	6.4e-35
WP_159290133.1|2134222_2134915_-	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	69.7	5.4e-88
WP_159290134.1|2134964_2135720_-	DNA breaking-rejoining protein	NA	A0A1W6JNT1	Morganella_phage	78.5	6.3e-106
WP_159290135.1|2135784_2136156_-	hypothetical protein	NA	A0A1W6JNU7	Morganella_phage	70.7	7.2e-47
WP_159290136.1|2136152_2136521_-	HK97 gp10 family phage protein	NA	A0A1W6JNX7	Morganella_phage	85.2	5.1e-53
WP_049206412.1|2136523_2136865_-	hypothetical protein	NA	A0A1W6JNW7	Morganella_phage	80.5	3.1e-52
WP_159290137.1|2136866_2137244_-	hypothetical protein	NA	A0A1W6JP09	Morganella_phage	71.2	7.6e-44
WP_109829159.1|2137286_2138237_-	hypothetical protein	NA	A0A1W6JNV5	Morganella_phage	88.4	5.4e-155
WP_109829160.1|2138242_2138929_-	hypothetical protein	NA	A0A1W6JNU9	Morganella_phage	78.0	4.3e-69
WP_134736587.1|2139003_2140068_-|capsid	minor capsid protein	capsid	A0A1W6JNT7	Morganella_phage	51.4	7.1e-103
WP_159290138.1|2140076_2141453_-	DUF4055 domain-containing protein	NA	A0A1W6JNV0	Morganella_phage	78.8	2.0e-211
WP_036895049.1|2141454_2142939_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	88.7	3.6e-270
WP_159290139.1|2142941_2143544_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	69.6	4.3e-65
WP_159290140.1|2143608_2144160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628806.1|2144477_2144717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628807.1|2144839_2145265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159290141.1|2145551_2146004_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	49.3	9.2e-28
WP_159290142.1|2146000_2146405_-	structural protein	NA	A0A2I7RXE2	Vibrio_phage	50.0	2.9e-25
WP_159290143.1|2146397_2146715_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	56.2	6.9e-30
WP_159290144.1|2147178_2147514_-	lysozyme inhibitor	NA	NA	NA	NA	NA
WP_159290145.1|2148147_2150043_+	hypothetical protein	NA	A0A2L1IV32	Escherichia_phage	57.9	7.6e-15
WP_159290146.1|2151155_2151557_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	70.4	3.2e-48
WP_165439130.1|2151606_2152248_-	NinG family protein	NA	A0A1W6JNX3	Morganella_phage	72.4	1.2e-84
WP_159290148.1|2152278_2152728_-	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	31.6	3.7e-13
WP_141060707.1|2152753_2154139_-	AAA family ATPase	NA	Q716D2	Shigella_phage	47.5	4.0e-114
WP_004247480.1|2154138_2154885_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	54.9	3.0e-23
WP_004247479.1|2154881_2155055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247478.1|2155150_2155498_-	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	72.9	8.3e-37
WP_004247477.1|2155643_2155853_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	83.3	1.2e-25
WP_004247476.1|2155958_2156603_+	LexA family transcriptional regulator	NA	A0A077KGZ5	Edwardsiella_phage	64.5	9.6e-79
WP_004245991.1|2156611_2156953_+	DUF3024 domain-containing protein	NA	A0A1W6JP12	Morganella_phage	62.8	2.1e-37
WP_017628815.1|2157003_2157564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049197575.1|2157560_2158316_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_004247473.1|2158691_2159012_+	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	52.3	5.0e-20
WP_004247471.1|2159118_2159331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247470.1|2159516_2159669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247469.1|2159665_2159851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247467.1|2160015_2160291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159290149.1|2160413_2160641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162837622.1|2160729_2160885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247465.1|2160892_2161156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247464.1|2161152_2161404_+	hypothetical protein	NA	A0A1P8DTG3	Proteus_phage	95.2	4.1e-38
WP_004247463.1|2161400_2162285_+	recombinase RecT	NA	A0A2L1IV84	Escherichia_phage	62.5	7.7e-95
WP_087740865.1|2162281_2162980_+	exonuclease	NA	A0A0P0ZBV6	Stx2-converting_phage	61.6	6.3e-76
WP_159290150.1|2162969_2163503_+	single-stranded DNA-binding protein	NA	A0A1W6JNW8	Morganella_phage	63.8	1.9e-48
WP_049197573.1|2163518_2163719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036908775.1|2163756_2163936_+	hypothetical protein	NA	A0A1P8DTH9	Proteus_phage	94.7	5.8e-26
WP_036907944.1|2163938_2164619_+	hypothetical protein	NA	R9VWB9	Serratia_phage	54.8	9.8e-66
WP_036907943.1|2164683_2164980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159290151.1|2165051_2165636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036907941.1|2165688_2165916_+	hypothetical protein	NA	A0A1P8DTI8	Proteus_phage	71.2	5.3e-24
WP_036907940.1|2165908_2166184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162837621.1|2166341_2166518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036907939.1|2166510_2166831_+	DUF2591 domain-containing protein	NA	A0A1P8DTH6	Proteus_phage	51.9	1.3e-15
WP_012367595.1|2166827_2167073_+	excisionase	NA	NA	NA	NA	NA
2167013:2167028	attL	TTTAATGGAGAAAATT	NA	NA	NA	NA
WP_036895086.1|2167029_2168025_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	44.9	9.3e-73
WP_036895086.1|2167029_2168025_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	44.9	9.3e-73
2168737:2168752	attR	AATTTTCTCCATTAAA	NA	NA	NA	NA
>prophage 6
NZ_CP047112	Proteus mirabilis strain SCBX1.1 chromosome, complete genome	4200651	2530242	2598357	4200651	lysis,holin,tRNA,integrase,terminase,capsid	Proteus_phage(17.14%)	103	2582275:2582290	2602328:2602343
WP_012368081.1|2530242_2532681_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	54.5	5.0e-261
WP_049213336.1|2532692_2533310_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	68.3	4.4e-89
WP_004243611.1|2533313_2534090_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	39.8	5.1e-42
WP_004243612.1|2534205_2534748_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.7	1.9e-19
WP_017628013.1|2535316_2535496_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_159290165.1|2535635_2536871_-	hypothetical protein	NA	Q6IWQ6	Burkholderia_phage	34.1	1.1e-14
WP_004243615.1|2536876_2537533_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	39.9	2.3e-35
WP_017628010.1|2537529_2538717_-	hypothetical protein	NA	A0A2H5BG53	Pseudoalteromonas_phage	37.7	1.9e-72
WP_004243617.1|2538709_2539054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243621.1|2539050_2539743_-	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	35.7	1.2e-29
WP_004243622.1|2539745_2540558_-	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.2	9.0e-42
WP_004243623.1|2540526_2540847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036971128.1|2540852_2541347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107337176.1|2541349_2543653_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	23.1	2.0e-14
WP_004243627.1|2543735_2544194_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.9e-25
WP_004243628.1|2544253_2544706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107337175.1|2544716_2546204_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.5	4.2e-77
WP_159290166.1|2546212_2546725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159290167.1|2546761_2547211_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_110706590.1|2547207_2547612_-	structural protein	NA	A0A0E3JJ20	Enterobacteria_phage	45.8	1.1e-24
WP_004248367.1|2547614_2547914_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	51.0	1.9e-21
WP_036918599.1|2548294_2549110_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.3	2.1e-54
WP_036918602.1|2549359_2550097_+	helix-turn-helix transcriptional regulator	NA	A0A088CBP2	Shigella_phage	44.8	2.0e-56
WP_159290168.1|2550196_2551216_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_159290169.1|2552182_2552374_+	DNA polymerase II	NA	A0A1P8DTI0	Proteus_phage	79.4	8.9e-17
WP_159290170.1|2552403_2554773_-	hypothetical protein	NA	G0XNW5	Escherichia_phage	34.7	1.0e-77
WP_159290171.1|2554825_2557294_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	52.0	1.1e-252
WP_159290172.1|2557280_2557673_-	peptidoglycan endopeptidase	NA	F1C5F2	Cronobacter_phage	57.4	1.4e-45
WP_159290173.1|2557669_2558140_-	DUF1833 family protein	NA	F1C5F1	Cronobacter_phage	51.9	5.2e-42
WP_109409994.1|2558139_2558616_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	71.6	9.6e-60
WP_159290174.1|2558619_2562021_-	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	34.2	3.6e-140
WP_159290175.1|2562084_2562465_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_159290176.1|2562534_2563227_-	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	71.9	2.0e-90
WP_063073751.1|2563276_2564032_-	DNA breaking-rejoining protein	NA	A0A1W6JNT1	Morganella_phage	80.1	1.2e-107
WP_159290177.1|2564096_2564465_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	31.1	1.3e-11
WP_159290178.1|2564461_2564830_-	HK97 gp10 family phage protein	NA	F1C5E3	Cronobacter_phage	68.9	9.1e-42
WP_159290179.1|2564831_2565173_-	hypothetical protein	NA	A0A1W6JNW7	Morganella_phage	51.5	6.1e-24
WP_159290180.1|2565172_2565571_-	hypothetical protein	NA	I6S619	Salmonella_phage	77.3	2.5e-53
WP_004247764.1|2565627_2565801_-	hypothetical protein	NA	I6R9A3	Salmonella_phage	51.8	1.4e-08
WP_159290181.1|2565810_2566905_-	hypothetical protein	NA	G0ZND9	Cronobacter_phage	68.6	2.2e-144
WP_049257612.1|2566920_2567367_-	hypothetical protein	NA	I6S1Q2	Salmonella_phage	68.5	7.4e-46
WP_143475546.1|2567366_2568641_-	hypothetical protein	NA	G0ZND7	Cronobacter_phage	63.9	4.4e-152
WP_143475547.1|2568644_2569574_-|capsid	minor capsid protein	capsid	A0A1V0E5Q2	Salmonella_phage	55.3	1.3e-89
WP_159290182.1|2569524_2570880_-	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	61.6	2.0e-158
WP_143475551.1|2570879_2572130_-|terminase	PBSX family phage terminase large subunit	terminase	A0A1V0E5Q3	Salmonella_phage	78.4	2.7e-202
WP_036905466.1|2572113_2572539_-	hypothetical protein	NA	A0A068CGC1	Acinetobacter_phage	63.6	1.1e-33
WP_063073743.1|2572555_2572741_-	hypothetical protein	NA	A0A1W6JNV6	Morganella_phage	73.8	3.4e-21
WP_143475553.1|2572719_2572935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165439123.1|2572965_2573124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004245979.1|2573120_2573327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159290183.1|2573323_2573908_-	hypothetical protein	NA	Q3LZN7	Bacteriophage	48.2	4.4e-22
WP_159290184.1|2574359_2574524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159290185.1|2574576_2574732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143475402.1|2574747_2575011_-	peptidase	NA	Q8SBD8	Shigella_phage	46.4	1.2e-11
WP_159290186.1|2574898_2575300_-	hypothetical protein	NA	A0A1P8DTG0	Proteus_phage	84.8	7.9e-07
WP_049199105.1|2575296_2575689_-	M15 family metallopeptidase	NA	A0A1P8DTE2	Proteus_phage	96.8	4.3e-50
WP_036906009.1|2575685_2575982_-|holin	holin	holin	E7C9S8	Salmonella_phage	45.4	1.0e-19
WP_049199108.1|2576420_2576924_-	DUF1133 family protein	NA	A0A1P8DTF1	Proteus_phage	87.4	2.6e-79
WP_104459275.1|2576920_2577112_-	hypothetical protein	NA	A0A1P8DTD3	Proteus_phage	93.7	1.5e-27
WP_143475398.1|2577264_2577858_-	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	96.9	1.7e-98
WP_159290187.1|2577829_2577973_-	hypothetical protein	NA	A0A1P8DTE6	Proteus_phage	91.5	5.4e-19
WP_143475397.1|2577969_2578632_-	serine/threonine-protein phosphatase	NA	A0A2D1GLI5	Escherichia_phage	61.9	9.5e-74
WP_159290188.1|2578628_2578772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159290189.1|2578792_2578984_-	DUF3310 domain-containing protein	NA	A0A0A6Z5B6	Enterobacter_phage	79.7	1.6e-21
WP_159290190.1|2578980_2579340_-	hypothetical protein	NA	A0A077KB17	Edwardsiella_phage	40.0	2.0e-09
WP_159290191.1|2579360_2579807_-	recombination protein NinB	NA	E5AGF7	Erwinia_phage	56.6	1.1e-36
WP_052169993.1|2579808_2580009_-	hypothetical protein	NA	A0A1P8DTG8	Proteus_phage	63.6	5.7e-14
WP_036969509.1|2580022_2580277_-	hypothetical protein	NA	A0A1P8DTF4	Proteus_phage	95.2	1.5e-43
WP_159290192.1|2580367_2580541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036969512.1|2580537_2580786_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_063693402.1|2580772_2580994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152964332.1|2581009_2581177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159290193.1|2581196_2582153_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	55.1	1.6e-101
WP_159290194.1|2582115_2583753_-	DEAD/DEAH box helicase family protein	NA	A0A0N7KZV6	Escherichia_phage	68.3	1.9e-208
2582275:2582290	attL	AAAAGCGATATTTTTT	NA	NA	NA	NA
WP_071425630.1|2583755_2584205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080633834.1|2584448_2584808_-	hypothetical protein	NA	A0A088C4S1	Shewanella_sp._phage	41.8	4.2e-07
WP_159290195.1|2584895_2585243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071233781.1|2585349_2585577_-	helix-turn-helix domain-containing protein	NA	E5AGE7	Erwinia_phage	67.6	6.0e-20
WP_064497307.1|2585682_2586408_+	helix-turn-helix transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	42.0	8.9e-41
WP_143475818.1|2586665_2587040_+	hypothetical protein	NA	A0A1P8DTD0	Proteus_phage	100.0	6.8e-61
WP_124743656.1|2587895_2588081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159290196.1|2588140_2588308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109395762.1|2588332_2588521_+	hypothetical protein	NA	A0A068C8G2	Acinetobacter_phage	50.9	2.8e-07
WP_159290276.1|2588943_2589180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159290197.1|2589206_2589443_+	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	41.8	1.1e-08
WP_159290198.1|2589691_2589967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159290277.1|2589981_2590434_+	SAM-dependent methyltransferase	NA	A0A1W6JP48	Morganella_phage	72.5	6.1e-64
WP_049199148.1|2590433_2590655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073718.1|2590651_2591578_+	recombinase RecT	NA	F1C5B8	Cronobacter_phage	66.6	1.2e-109
WP_049206325.1|2591617_2592238_+	hypothetical protein	NA	A0A068CBG2	Acinetobacter_phage	45.9	1.2e-25
WP_159290199.1|2592230_2592932_+	exonuclease	NA	A0A2R2Z325	Escherichia_phage	57.2	6.8e-70
WP_159290200.1|2592921_2593416_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	78.0	5.3e-53
WP_159290201.1|2593446_2593608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142836744.1|2593650_2593869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159290202.1|2593902_2594592_+	hypothetical protein	NA	R9VWB9	Serratia_phage	56.7	7.4e-69
WP_159290203.1|2594591_2595125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049206330.1|2595124_2595478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004916560.1|2595635_2595812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159290204.1|2595815_2596184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159290205.1|2596170_2596773_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	58.6	7.1e-60
WP_165439124.1|2596780_2596975_+	hypothetical protein	NA	A0A1P8DTH3	Proteus_phage	90.6	1.3e-28
WP_159290206.1|2596984_2597317_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_159290207.1|2597193_2598357_+|integrase	tyrosine-type recombinase/integrase	integrase	G8C7S0	Escherichia_phage	76.0	4.3e-178
2602328:2602343	attR	AAAAAATATCGCTTTT	NA	NA	NA	NA
>prophage 7
NZ_CP047112	Proteus mirabilis strain SCBX1.1 chromosome, complete genome	4200651	3097242	3150255	4200651	holin,tail,tRNA,integrase,terminase	Proteus_phage(23.08%)	84	3093657:3093715	3145851:3145909
3093657:3093715	attL	GTGTTGATTTTAAATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_159290226.1|3097242_3100971_-	DUF1983 domain-containing protein	NA	A0A1P8DTI4	Proteus_phage	65.4	0.0e+00
WP_159290227.1|3101024_3101630_-|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	60.0	2.8e-56
WP_159290228.1|3101626_3102337_-	peptidase P60	NA	F1C573	Cronobacter_phage	66.4	1.0e-89
WP_159290229.1|3102333_3103077_-|tail	phage minor tail protein L	tail	K7PJS0	Enterobacterial_phage	58.2	2.1e-85
WP_072502321.1|3103073_3103418_-|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	48.2	5.5e-25
WP_112843561.1|3103566_3103863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159290230.1|3103887_3104166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159290231.1|3104177_3107117_-|tail	phage tail tape measure protein	tail	A0A2P0WA05	Enterobacter_phage	36.3	1.5e-142
WP_159290232.1|3107182_3107686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064971710.1|3107753_3108026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049195351.1|3108138_3108540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152901621.1|3108685_3109456_-	phage antirepressor protein	NA	A0A2I7RX10	Vibrio_phage	41.1	4.1e-44
WP_017827422.1|3110268_3110439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036971544.1|3110541_3111357_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	26.5	4.0e-13
WP_159290233.1|3111366_3111717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049199086.1|3111818_3112226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049199087.1|3112216_3112999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049201300.1|3113318_3113609_-	hypothetical protein	NA	A0A2H4J4F7	uncultured_Caudovirales_phage	49.3	7.0e-13
WP_004245960.1|3113623_3113929_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	55.4	6.6e-22
WP_159290234.1|3113980_3114637_-|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	57.7	5.0e-59
WP_159290235.1|3114682_3115084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159290236.1|3115080_3115662_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	52.1	7.1e-49
WP_004245967.1|3115663_3116014_-	hypothetical protein	NA	I6PD77	Cronobacter_phage	45.1	3.8e-21
WP_012367632.1|3116016_3116496_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	47.7	3.8e-32
WP_107033975.1|3116535_3116820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004245970.1|3116822_3117776_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	71.6	1.4e-126
WP_036907977.1|3117789_3118551_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.3	1.5e-67
WP_159290237.1|3118662_3119784_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	51.5	2.1e-105
WP_159290238.1|3119780_3121151_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	49.4	1.3e-120
WP_159290239.1|3121150_3122638_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	89.0	1.1e-263
WP_159290240.1|3122640_3123249_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	70.2	6.7e-66
WP_049199098.1|3123259_3123442_-	hypothetical protein	NA	A0A1W6JNV6	Morganella_phage	74.1	8.2e-20
WP_165439126.1|3123434_3123593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165439127.1|3123623_3123782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049199100.1|3123778_3124195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014657891.1|3124194_3124731_-	DNA-binding protein	NA	Q3LZN6	Bacteriophage	40.4	1.2e-21
WP_080972387.1|3125182_3125437_-	peptidase	NA	Q8SBD8	Shigella_phage	46.9	3.4e-11
WP_049199103.1|3125324_3125726_-	hypothetical protein	NA	A0A1P8DTG0	Proteus_phage	84.8	7.9e-07
WP_049199105.1|3125722_3126115_-	M15 family metallopeptidase	NA	A0A1P8DTE2	Proteus_phage	96.8	4.3e-50
WP_036906009.1|3126111_3126408_-|holin	holin	holin	E7C9S8	Salmonella_phage	45.4	1.0e-19
WP_049199108.1|3126846_3127350_-	DUF1133 family protein	NA	A0A1P8DTF1	Proteus_phage	87.4	2.6e-79
WP_049199110.1|3127346_3127538_-	hypothetical protein	NA	A0A1P8DTD3	Proteus_phage	95.2	2.3e-28
WP_049199112.1|3127537_3128158_-	bacteriophage Lambda NinG protein	NA	A0A2I7RAC0	Vibrio_phage	53.6	3.9e-45
WP_049199113.1|3128431_3128875_-	hypothetical protein	NA	A0A1P8DTD8	Proteus_phage	91.9	4.2e-33
WP_049199117.1|3129210_3129468_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_049199119.1|3129467_3129728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049199120.1|3129739_3129976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152964332.1|3129991_3130159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049199122.1|3130169_3130373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080047879.1|3130392_3131769_-	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	58.3	4.2e-156
WP_159290241.1|3131768_3133265_-	phage replication protein	NA	E5AGE9	Erwinia_phage	37.4	2.4e-72
WP_049199128.1|3133257_3133437_-	hypothetical protein	NA	G9L679	Escherichia_phage	59.6	2.9e-09
WP_164484703.1|3133429_3133606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049220837.1|3133723_3134050_-	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	79.6	6.2e-42
WP_159290242.1|3134183_3134414_-	transcriptional regulator	NA	A0A0P0ZDD7	Stx2-converting_phage	63.6	8.8e-19
WP_049220841.1|3134533_3135262_+	S24 family peptidase	NA	E7C9R0	Salmonella_phage	34.5	3.2e-30
WP_143475391.1|3135722_3135995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159290243.1|3136009_3136246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049220847.1|3136217_3136499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071233968.1|3136668_3137289_+	hypothetical protein	NA	K7PKU5	Enterobacteria_phage	45.1	4.2e-39
WP_139208650.1|3137438_3137627_+	hypothetical protein	NA	A0A1P8DTG4	Proteus_phage	91.9	1.5e-24
WP_071233970.1|3137628_3137934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159290244.1|3137996_3138257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049199147.1|3138477_3138753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165439128.1|3138749_3139106_+	class I SAM-dependent methyltransferase	NA	A0A1W6JP48	Morganella_phage	75.7	6.5e-45
WP_159290245.1|3139220_3139472_+	hypothetical protein	NA	A0A1P8DTG3	Proteus_phage	92.8	1.6e-37
WP_159290246.1|3139468_3140353_+	recombinase RecT	NA	A0A2L1IV84	Escherichia_phage	61.9	6.5e-94
WP_159290247.1|3140349_3141048_+	exonuclease	NA	A0A2R2Z325	Escherichia_phage	56.9	2.2e-73
WP_110706710.1|3141037_3141538_+	single-stranded DNA-binding protein	NA	A0A1W6JNW8	Morganella_phage	67.5	3.2e-50
WP_153274246.1|3141553_3141715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063693443.1|3141787_3142057_+	hypothetical protein	NA	A0A248SL63	Klebsiella_phage	66.7	3.5e-19
WP_070487054.1|3142059_3142380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110706711.1|3142379_3142673_+	hypothetical protein	NA	A0A1B0UY37	Roseobacter_phage	43.8	4.4e-15
WP_110706712.1|3142665_3143019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159290248.1|3143177_3143339_+	hypothetical protein	NA	A0A1P8DTF6	Proteus_phage	96.2	6.3e-24
WP_159290249.1|3143331_3143676_+	DUF2591 family protein	NA	A0A1P8DTH6	Proteus_phage	41.3	2.0e-11
WP_159290250.1|3143662_3144265_+	DNA methyltransferase	NA	A0A248SKY3	Klebsiella_phage	52.0	6.9e-55
WP_165439124.1|3144272_3144467_+	hypothetical protein	NA	A0A1P8DTH3	Proteus_phage	90.6	1.3e-28
WP_159290206.1|3144476_3144809_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_159290207.1|3144685_3145849_+|integrase	tyrosine-type recombinase/integrase	integrase	G8C7S0	Escherichia_phage	76.0	4.3e-178
WP_004244243.1|3146131_3147004_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.8	5.7e-34
3145851:3145909	attR	GTGTTGATTTTAAATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004244244.1|3147007_3147220_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004244246.1|3147856_3148798_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_004244247.1|3148863_3150255_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.3	2.7e-38
>prophage 8
NZ_CP047112	Proteus mirabilis strain SCBX1.1 chromosome, complete genome	4200651	3405777	3414651	4200651		Caulobacter_phage(50.0%)	9	NA	NA
WP_004245601.1|3405777_3407346_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	7.2e-11
WP_012368337.1|3407746_3408427_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_004245603.1|3408523_3409099_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	1.2e-27
WP_004249446.1|3409175_3409754_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	41.5	2.4e-33
WP_004245605.1|3409821_3410847_-	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.9	1.3e-74
WP_004245607.1|3410881_3411337_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_129623352.1|3411361_3412528_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_004245609.1|3412528_3413113_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.2	4.2e-17
WP_017827550.1|3413505_3414651_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	27.2	1.2e-31
>prophage 1
NZ_CP047114	Proteus mirabilis strain SCBX1.1 plasmid plas1.1.2, complete sequence	138818	53936	113282	138818	integrase,transposase	Escherichia_phage(37.5%)	55	105471:105484	116856:116869
WP_001067855.1|53936_54641_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001199192.1|54754_55531_+	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
WP_000742814.1|55759_56785_+	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_000602738.1|57206_57959_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_006581703.1|59769_60255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085940648.1|60451_61542_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001043260.1|61631_62447_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000251875.1|62533_62836_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|62729_62981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015344975.1|63011_64505_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|64616_64922_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214122.1|64949_66164_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001447541.1|66386_67271_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001067784.1|68195_68900_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_046788546.1|68984_69386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015344976.1|69394_72346_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
WP_000147567.1|72348_72909_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|73034_73385_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845039.1|73587_74601_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|74745_75243_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_071523897.1|75399_75645_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|75650_76442_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|76605_76953_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|76946_77786_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|78190_79732_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_012579084.1|79995_80652_+	quinolone resistance pentapeptide repeat protein QnrA1	NA	NA	NA	NA	NA
WP_001067855.1|80776_81481_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000052512.1|81930_83406_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_000155092.1|83461_84346_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_140173007.1|84535_84847_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|84882_85587_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|85776_86592_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|86742_87447_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000344784.1|87937_88798_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000287615.1|88848_90393_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.6	1.0e-38
WP_001324342.1|90515_92039_+|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_001163403.1|92028_92811_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
WP_000376623.1|93345_93846_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|93973_94813_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_052238321.1|94806_95142_-	ethidium bromide resistance protein	NA	NA	NA	NA	NA
WP_025999322.1|95034_95400_+	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_004193231.1|95403_96279_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004236386.1|96389_97529_+	class C beta-lactamase DHA-1	NA	NA	NA	NA	NA
WP_000050481.1|98341_99883_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|100287_101127_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|101120_101468_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|101690_102143_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_063840321.1|102239_102794_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_000845039.1|103085_104099_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067855.1|104373_105078_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_071538080.1|105102_106677_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	99.4	2.8e-87
105471:105484	attL	GGCTGCGGAAAAAT	NA	NA	NA	NA
WP_001276994.1|107479_109147_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000267723.1|109143_111252_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001029679.1|111238_112060_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_048821757.1|112328_113282_-|integrase	site-specific integrase	integrase	A0A1P8DJ76	Virus_Rctr85	29.2	9.6e-27
116856:116869	attR	ATTTTTCCGCAGCC	NA	NA	NA	NA
