The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047028	Formosa sp. L2A11 chromosome, complete genome	3783741	296230	370594	3783741	integrase,transposase	Staphylococcus_phage(13.33%)	63	337511:337550	368644:368683
WP_159021447.1|296230_297466_+|integrase	tyrosine-type recombinase/integrase	integrase	H7BUI8	unidentified_phage	41.5	3.0e-36
WP_159021448.1|297472_298102_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_159021449.1|298538_299384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159021450.1|299685_299970_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_159021451.1|299973_300726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159021452.1|300709_301372_+	ATPase	NA	NA	NA	NA	NA
WP_159021453.1|301481_302114_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A067ZJB6	Vibrio_phage	37.4	2.2e-19
WP_159021454.1|302302_302590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159021455.1|302591_302876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159021456.1|302862_305265_+	TraG family conjugative transposon ATPase	NA	NA	NA	NA	NA
WP_159021457.1|305335_305854_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_159021458.1|305856_306699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159021459.1|306710_307334_+	conjugal transfer protein TraK	NA	NA	NA	NA	NA
WP_159024199.1|307314_308247_+	conjugative transposon protein TraM	NA	NA	NA	NA	NA
WP_159021460.1|308243_309098_+	DUF4138 domain-containing protein	NA	NA	NA	NA	NA
WP_159021461.1|309105_309471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159021462.1|309474_310212_-	SOS response-associated peptidase	NA	NA	NA	NA	NA
WP_159021463.1|310251_311214_-	endonuclease	NA	NA	NA	NA	NA
WP_159021464.1|312226_313585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159021465.1|313577_316022_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	40.1	4.8e-22
WP_159021466.1|316150_317803_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	43.1	3.5e-109
WP_047790785.1|317814_318885_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_159021467.1|318888_320220_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_159021468.1|320212_323179_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	23.3	4.2e-20
WP_159021469.1|323977_324130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159021470.1|324528_325368_-	class D beta-lactamase	NA	NA	NA	NA	NA
WP_159021471.1|325499_326759_-	DUF4113 domain-containing protein	NA	A0A1W6JNT0	Morganella_phage	42.2	3.6e-82
WP_159021472.1|326758_327205_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	42.9	7.2e-25
WP_159021473.1|327430_327829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159021474.1|328048_329635_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_159021475.1|329642_330674_-	mobilization protein	NA	NA	NA	NA	NA
WP_159021476.1|330685_331066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159021477.1|331509_331890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159021478.1|331970_332318_-	single-stranded DNA-binding protein	NA	A0A1J0MFK5	Staphylococcus_phage	42.9	1.1e-15
WP_159021479.1|333424_334264_-	DUF932 domain-containing protein	NA	A0A1B0WMN7	Flavobacterium_phage	49.8	4.6e-73
WP_159021480.1|334537_334921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159021481.1|335017_336148_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	29.2	5.9e-23
WP_159021482.1|336275_336437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159021483.1|336752_337469_+	hypothetical protein	NA	NA	NA	NA	NA
337511:337550	attL	CTCACACCACCGTACGTACGGGTCTCGTATACGGCGGTTC	NA	NA	NA	NA
WP_159021484.1|339471_340110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159021485.1|340264_340963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159021486.1|341102_341714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159024200.1|341812_342208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159021487.1|342216_343389_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_159021488.1|346604_347156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159021489.1|347260_348541_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	28.2	7.1e-25
WP_159021490.1|349189_349993_+	DUF1963 domain-containing protein	NA	NA	NA	NA	NA
WP_111710331.1|350151_351405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159021491.1|351675_352815_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_159021492.1|352814_353579_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	33.8	2.2e-26
WP_159021493.1|355859_356225_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_159024201.1|356176_357082_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	35.5	9.4e-32
WP_159021494.1|357135_358029_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_159021495.1|358120_359698_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_159021496.1|359908_362023_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_159021497.1|362244_362610_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_159021498.1|362615_363338_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	30.8	4.9e-15
WP_159024202.1|363331_363487_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_159021499.1|363549_364350_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_159021500.1|366924_367905_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_159021501.1|368182_368434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159021493.1|369371_369737_+|transposase	transposase	transposase	NA	NA	NA	NA
368644:368683	attR	CTCACACCACCGTACGTACGGGTCTCGTATACGGCGGTTC	NA	NA	NA	NA
WP_159024203.1|369688_370594_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	35.5	9.4e-32
>prophage 2
NZ_CP047028	Formosa sp. L2A11 chromosome, complete genome	3783741	1173627	1182592	3783741		Escherichia_phage(28.57%)	10	NA	NA
WP_159022143.1|1173627_1174647_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	45.5	1.9e-81
WP_159022144.1|1174648_1175515_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	H9NC64	Sphingomonas_phage	62.7	1.6e-97
WP_159022145.1|1175514_1176060_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	50.0	6.7e-41
WP_159022146.1|1176059_1176908_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	38.4	8.8e-40
WP_159022147.1|1176908_1177703_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_159022148.1|1177771_1178191_+	DUF2061 domain-containing protein	NA	NA	NA	NA	NA
WP_159022149.1|1178190_1178796_+	adenylyl-sulfate kinase	NA	A0A2P1ELS9	Moumouvirus	38.1	3.7e-24
WP_159022150.1|1178788_1179700_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_159022151.1|1179733_1180987_+	GTP-binding protein	NA	A0A1V0SGC3	Hokovirus	26.4	1.4e-33
WP_159022152.1|1181122_1182592_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	33.3	6.2e-65
>prophage 3
NZ_CP047028	Formosa sp. L2A11 chromosome, complete genome	3783741	1821862	1829549	3783741		Tupanvirus(16.67%)	7	NA	NA
WP_159024258.1|1821862_1822849_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L0I7	Tupanvirus	50.3	9.2e-89
WP_159022655.1|1822879_1823998_+	GDP-mannose 4,6-dehydratase	NA	M1HAR7	Acanthocystis_turfacea_Chlorella_virus	59.0	5.8e-124
WP_159022656.1|1824010_1824967_+	NAD-dependent epimerase/dehydratase family protein	NA	M4R1H4	Synechococcus_phage	51.4	2.3e-89
WP_159024259.1|1824970_1826365_+	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	33.8	2.3e-61
WP_159022657.1|1826367_1827390_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI6	Catovirus	32.1	4.9e-37
WP_159022658.1|1827391_1828261_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_159022659.1|1828286_1829549_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.8	6.8e-12
