The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047020	Streptomyces sp. T44 chromosome	9735779	2511	53833	9735779	tail,transposase	Corynebacterium_phage(66.67%)	48	NA	NA
WP_067049883.1|2511_3753_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	53.6	3.9e-105
WP_158916575.1|5553_5850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158929591.1|5846_6029_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_158916577.1|6347_6587_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_158916579.1|6922_7480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158916581.1|7489_7756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158916583.1|7703_7925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158916585.1|8124_10242_-	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_158916587.1|10387_10966_-	suppressor of fused domain protein	NA	NA	NA	NA	NA
WP_158929593.1|11225_12461_-	serine hydrolase	NA	NA	NA	NA	NA
WP_158916589.1|12612_13011_-	DUF1048 domain-containing protein	NA	NA	NA	NA	NA
WP_158916591.1|13013_13343_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158929595.1|13802_14072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158916593.1|14031_14211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158916595.1|14496_14637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158916597.1|14726_14996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158916599.1|15241_16681_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_158916601.1|16677_17448_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	43.8	1.2e-54
WP_158916603.1|17808_19047_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	45.7	4.4e-80
WP_158916606.1|19371_20424_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_158916608.1|20608_20971_+	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_158916610.1|20963_23621_+	magnesium-translocating P-type ATPase	NA	NA	NA	NA	NA
WP_158916612.1|23649_24081_-	preprotein translocase	NA	NA	NA	NA	NA
WP_158916614.1|24343_25726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158929597.1|26112_27621_+	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158916616.1|27849_28065_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_158916618.1|28344_28731_+	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_158916620.1|28943_30560_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158916622.1|30552_30870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158916624.1|31896_34410_-	phospholipase	NA	NA	NA	NA	NA
WP_158916626.1|34747_35143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158916628.1|35434_36115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158916630.1|36213_36516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158916632.1|36834_37356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158916634.1|37358_37730_+|tail	tail fiber domain-containing protein	tail	NA	NA	NA	NA
WP_158916636.1|37798_39382_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_158916638.1|39427_39784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158929600.1|39837_40179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158916640.1|42882_43698_-	DUF1345 domain-containing protein	NA	NA	NA	NA	NA
WP_158916642.1|44373_45801_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_158916644.1|45837_46284_+	preprotein translocase	NA	NA	NA	NA	NA
WP_158929602.1|46506_47304_-	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
WP_158916646.1|47414_48662_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158916648.1|48883_49315_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_158929604.1|50399_52085_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_158916650.1|52174_52327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158916652.1|52568_53276_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_158916654.1|53305_53833_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP047020	Streptomyces sp. T44 chromosome	9735779	87208	221478	9735779	tail,protease,transposase	Mycobacterium_phage(20.0%)	101	NA	NA
WP_158929622.1|87208_88951_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_158916694.1|90495_91905_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_067049883.1|92439_93681_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	53.6	3.9e-105
WP_158916696.1|93877_94504_-	DUF2461 family protein	NA	NA	NA	NA	NA
WP_158916698.1|94853_96263_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_158916700.1|96365_96608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158916702.1|96683_97391_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_158929624.1|99731_99923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158916704.1|100121_101417_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	36.8	1.0e-34
WP_158929626.1|101484_101961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158916706.1|102187_102766_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_158916708.1|102762_102987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158916710.1|103411_103696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158916712.1|103864_104461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158916714.1|104554_105601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158929628.1|105940_106933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158916716.1|108440_109439_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158916717.1|109722_110112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158916718.1|110247_111231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158916719.1|112115_112301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158916720.1|112291_113179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158916721.1|114452_114689_+	antitoxin MazE7	NA	NA	NA	NA	NA
WP_158916722.1|117384_117708_-	type I-E CRISPR-associated endoribonuclease Cas2	NA	NA	NA	NA	NA
WP_158916724.1|117704_118709_-	type I-E CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_158916726.1|118701_119487_-	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
WP_158916728.1|119490_120285_-	type I-E CRISPR-associated protein Cas5/CasD	NA	NA	NA	NA	NA
WP_158916730.1|120281_121466_-	type I-E CRISPR-associated protein Cas7/Cse4/CasC	NA	NA	NA	NA	NA
WP_158916732.1|121625_122825_-	type I-E CRISPR-associated protein Cse2/CasB	NA	NA	NA	NA	NA
WP_158916734.1|122821_124498_-	type I-E CRISPR-associated protein Cse1/CasA	NA	NA	NA	NA	NA
WP_158916736.1|124788_127674_-	CRISPR-associated helicase Cas3'	NA	NA	NA	NA	NA
WP_158916698.1|130152_131562_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_158916738.1|132156_133749_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	28.9	2.6e-08
WP_158916740.1|133964_135278_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	36.4	6.3e-53
WP_158929630.1|136228_138433_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_158916742.1|138579_139074_-	chromosome partitioning protein	NA	NA	NA	NA	NA
WP_158916744.1|139714_140200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158916746.1|140258_140696_+	DUF4259 domain-containing protein	NA	NA	NA	NA	NA
WP_158916748.1|141635_142409_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	49.1	9.1e-60
WP_158916751.1|142405_143827_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_158916753.1|144175_145354_-	Cmx/CmrA family chloramphenicol efflux MFS transporter	NA	NA	NA	NA	NA
WP_158916755.1|145738_147004_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_158929632.1|147247_148465_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_158916757.1|148591_148762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158916759.1|148809_149409_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_158916761.1|149646_150039_-	VOC family protein	NA	NA	NA	NA	NA
WP_158916763.1|150515_151193_-	response regulator	NA	NA	NA	NA	NA
WP_158916765.1|151189_152569_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_158916767.1|152522_153221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158916769.1|153217_154030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158916771.1|154026_154950_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.2	2.3e-17
WP_158916773.1|154982_155144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158916775.1|155520_156798_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_158916777.1|157921_159007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158916779.1|159284_161732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158916781.1|162358_163009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158916783.1|163320_163737_-	chromosome partitioning protein	NA	NA	NA	NA	NA
WP_158916785.1|165073_165556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158916787.1|165653_165953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158916789.1|167108_167843_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_158916791.1|168167_169454_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_158916793.1|169662_169893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158929634.1|170878_171394_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_158916795.1|171589_171898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158916797.1|172356_172665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158929636.1|174075_174306_+	DUF3761 domain-containing protein	NA	NA	NA	NA	NA
WP_158916799.1|174392_174908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158929638.1|175244_175721_-	DUF1524 domain-containing protein	NA	NA	NA	NA	NA
WP_158929640.1|177159_177447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158916801.1|177478_177682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158916803.1|177817_178507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158916805.1|178910_179504_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_158916807.1|179899_180169_-	DUF1905 domain-containing protein	NA	NA	NA	NA	NA
WP_158916809.1|180185_180551_-	glyoxalase	NA	NA	NA	NA	NA
WP_158916811.1|180893_181526_-	DUF1524 domain-containing protein	NA	NA	NA	NA	NA
WP_158916813.1|181872_182349_-|tail	lamin tail domain-containing protein	tail	NA	NA	NA	NA
WP_158916815.1|182884_183391_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_158916817.1|183605_184829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158916819.1|184877_185321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158916821.1|187252_188467_-	MFS transporter	NA	NA	NA	NA	NA
WP_158916823.1|188463_189714_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_158916825.1|189833_190328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158916827.1|190514_190898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158916829.1|190930_191569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158916831.1|191638_192076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158916833.1|194691_196086_-	DHA2 family efflux MFS transporter permease subunit	NA	A0A0M3UL24	Mycobacterium_phage	35.3	9.4e-39
WP_158916835.1|196160_197018_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	34.2	5.8e-39
WP_158916837.1|197014_197449_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_158916839.1|197519_197840_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_158916841.1|199358_200186_+	alpha/beta fold hydrolase	NA	A0A2P1CHW5	Mycobacterium_phage	30.8	5.6e-15
WP_158916843.1|200880_202389_+	NAD-binding protein	NA	NA	NA	NA	NA
WP_158916845.1|202480_203710_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_158916847.1|205469_206933_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_158916849.1|206929_208606_-	oxaloacetate-decarboxylating malate dehydrogenase	NA	NA	NA	NA	NA
WP_158929642.1|209385_209928_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158916851.1|210132_211089_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_158916853.1|211201_212179_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	24.8	4.9e-10
WP_158916855.1|212204_213143_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_158916857.1|213163_214141_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_158916859.1|215014_216241_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_158916861.1|216577_217780_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_158916863.1|218874_221478_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP047020	Streptomyces sp. T44 chromosome	9735779	248605	310282	9735779	holin,integrase,transposase	Powai_lake_megavirus(50.0%)	49	242868:242885	295955:295972
242868:242885	attL	CCAGCGGCACGTCGGTGC	NA	NA	NA	NA
WP_158916897.1|248605_249844_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_158929652.1|250491_250869_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_158916899.1|254211_255003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158916901.1|255028_255631_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_158916903.1|256632_256929_+	amidase	NA	NA	NA	NA	NA
WP_158916905.1|256925_257927_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_158916907.1|257923_258379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158916909.1|258917_259847_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_067051817.1|260209_261244_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_158916911.1|261351_262512_+	lactate 2-monooxygenase	NA	NA	NA	NA	NA
WP_158916913.1|262801_264412_+	benzoylformate decarboxylase	NA	NA	NA	NA	NA
WP_158916915.1|264464_265226_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_158916917.1|265372_268258_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_158916919.1|268484_269066_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_158916921.1|269493_269631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067051826.1|269704_270154_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158916923.1|270268_270868_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_158916925.1|270867_272370_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_067051830.1|272678_273311_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_158916927.1|274214_274556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158916929.1|274552_275797_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_158916931.1|275869_276883_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_158916933.1|276883_278209_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_158916935.1|278469_279036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158916937.1|279032_279500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158929654.1|279704_280769_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_158916939.1|281438_281837_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158916941.1|281841_283353_-	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158916943.1|283566_284391_+	FAD-binding molybdopterin dehydrogenase	NA	NA	NA	NA	NA
WP_158916945.1|284387_287135_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_158916947.1|289331_289946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158916949.1|290400_291810_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_158929656.1|291907_292522_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_158916951.1|292518_293001_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158916953.1|293330_294227_-	cyclase family protein	NA	NA	NA	NA	NA
WP_158916955.1|294434_295403_-	alpha/beta hydrolase fold domain-containing protein	NA	A0A167RJ59	Powai_lake_megavirus	32.9	1.6e-24
WP_158916957.1|296319_297252_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
295955:295972	attR	CCAGCGGCACGTCGGTGC	NA	NA	NA	NA
WP_158916959.1|297384_298011_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158916961.1|299559_299886_-	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_158929658.1|300089_301625_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_158916963.1|301955_302636_+	methyltransferase	NA	NA	NA	NA	NA
WP_158916965.1|302619_302832_+	CDGSH iron-sulfur domain-containing protein	NA	NA	NA	NA	NA
WP_158916967.1|302828_303851_+	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_158916969.1|304550_304910_-	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_158916971.1|305018_305879_-	SigB/SigF/SigG family RNA polymerase sigma factor	NA	A0A0Y0AU18	Bacillus_phage	30.9	4.3e-18
WP_158929612.1|306093_306327_-	DUF5133 domain-containing protein	NA	NA	NA	NA	NA
WP_158916669.1|306489_306858_+	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_158916973.1|307183_307384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158929660.1|309910_310282_+|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 4
NZ_CP047020	Streptomyces sp. T44 chromosome	9735779	318142	443603	9735779	transposase	Enterobacteria_phage(11.11%)	98	NA	NA
WP_158916751.1|318142_319564_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_158916748.1|319560_320334_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	49.1	9.1e-60
WP_158916989.1|322115_322682_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_158916991.1|322936_323755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158916993.1|324074_325268_-	elongation factor Tu	NA	M4M9V7	Vibrio_phage	63.9	5.3e-06
WP_158929662.1|325679_326819_-	lipase	NA	NA	NA	NA	NA
WP_158916995.1|326846_327050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158916997.1|327691_328054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158916999.1|328187_329039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067040255.1|329128_329299_+	hydrophobic protein	NA	NA	NA	NA	NA
WP_158917001.1|329574_329952_-	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_158917003.1|330111_330591_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_158917005.1|330695_330893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158917007.1|331429_332437_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_158917009.1|334156_335209_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_158917011.1|335718_335895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158917013.1|336244_336862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158917015.1|338416_338740_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_158929664.1|340075_340465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158917017.1|340452_340617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158917019.1|340741_340900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158917021.1|341145_342495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158917022.1|342742_343687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158917024.1|344436_345612_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_158929666.1|346030_346360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158917026.1|346475_346670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158917028.1|347735_347927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158917030.1|349849_350203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158917032.1|350238_350607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158917034.1|350603_351047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158917036.1|351552_352830_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_158917038.1|353750_354395_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_158917040.1|355330_356101_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_158929668.1|356237_357503_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_158917042.1|358057_358522_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_158917044.1|359070_359805_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158917046.1|360045_361077_+	radical SAM protein	NA	NA	NA	NA	NA
WP_158917048.1|361310_363860_+	protein kinase	NA	G9E4F0	Emiliania_huxleyi_virus	33.6	6.6e-06
WP_158917050.1|364133_364589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158917052.1|364895_366821_-	Ig-like domain repeat protein	NA	NA	NA	NA	NA
WP_158917054.1|367012_367186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158917056.1|367252_367747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158917058.1|368176_368368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158917060.1|368699_370058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158917062.1|370335_370584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158917064.1|371202_371346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158917066.1|371697_371970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158917067.1|372962_373724_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_158917068.1|373966_375355_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_158917069.1|375351_376314_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.0	1.0e-28
WP_158917070.1|376391_379133_-	PKD domain-containing protein	NA	NA	NA	NA	NA
WP_158917071.1|379399_379684_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_158917072.1|379914_380163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158917073.1|380226_380802_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_158917075.1|381785_382109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158917077.1|382530_383397_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158917079.1|383393_384293_+	oxidoreductase	NA	NA	NA	NA	NA
WP_158917081.1|384427_385204_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_158917083.1|386305_388468_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_158917085.1|388471_389149_+	response regulator	NA	W8CYM9	Bacillus_phage	28.6	4.3e-21
WP_158917087.1|389145_390528_+	HAMP domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.4	8.8e-05
WP_158917089.1|392289_392763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158917091.1|395400_395670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158917093.1|395897_397154_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158917095.1|398507_398783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158929671.1|399427_400279_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_158917097.1|400369_400966_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158929673.1|401257_401671_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_158917100.1|401833_403222_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_119987691.1|403559_404381_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_158917102.1|404412_405306_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158917104.1|406701_407463_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_158929675.1|407674_408479_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_158917106.1|409484_410663_-	Cmx/CmrA family chloramphenicol efflux MFS transporter	NA	NA	NA	NA	NA
WP_158917108.1|411806_412742_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158917110.1|412882_414127_+	MFS transporter	NA	NA	NA	NA	NA
WP_158917112.1|414454_414865_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_158917114.1|414973_416785_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_158917116.1|417364_417769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158917118.1|419090_419435_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_067049883.1|419795_421037_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	53.6	3.9e-105
WP_158929677.1|421065_421566_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_158917120.1|421812_423438_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_158917122.1|423496_423934_+	DUF4259 domain-containing protein	NA	NA	NA	NA	NA
WP_158917124.1|423982_424540_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_158917126.1|424976_425219_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158917128.1|425401_426250_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_158917130.1|426734_428099_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_158917132.1|429539_429863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158917134.1|430437_431679_-	protein kinase	NA	S4VV57	Pandoravirus	31.5	4.9e-15
WP_158917136.1|433564_434221_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_158917138.1|434220_434637_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_158917140.1|435251_435464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158917142.1|435741_435945_+	cold shock domain-containing protein	NA	Q9AZD3	Lactococcus_phage	62.7	4.7e-16
WP_158917144.1|438602_439193_+	DUF664 domain-containing protein	NA	NA	NA	NA	NA
WP_158917146.1|439981_440677_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_158929679.1|440818_442138_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_158929681.1|442385_443603_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP047020	Streptomyces sp. T44 chromosome	9735779	968038	1013154	9735779	tail,protease,plate	Caulobacter_phage(20.0%)	41	NA	NA
WP_158917913.1|968038_969025_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_158917915.1|969043_969445_-	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_158917917.1|969585_970965_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_158917919.1|970961_971759_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_158917921.1|971847_972516_+	DedA family protein	NA	NA	NA	NA	NA
WP_158929769.1|972729_973833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158917923.1|974036_975305_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_158917925.1|975658_976234_-	chemical-damaging agent resistance protein C	NA	K4JRX3	Caulobacter_phage	44.2	2.6e-35
WP_158917927.1|976254_976491_-	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_158917929.1|976503_977202_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_158917931.1|977459_977750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158917933.1|977738_978539_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158917935.1|978555_979227_-	response regulator	NA	NA	NA	NA	NA
WP_158929771.1|979223_980483_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_158917937.1|980542_981394_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_158917939.1|981390_982338_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.3	4.7e-34
WP_158917941.1|982537_982720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158917943.1|983005_983893_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_158917945.1|983912_984308_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_158917947.1|984565_985483_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158917949.1|985631_987815_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_158917951.1|987953_988763_-	maleylpyruvate isomerase	NA	NA	NA	NA	NA
WP_158917953.1|988779_989142_-	5-carboxymethyl-2-hydroxymuconate delta isomerase	NA	NA	NA	NA	NA
WP_158917954.1|989429_989573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158917955.1|989661_991869_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_158917956.1|992021_992690_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158929773.1|992885_994166_-	hydrolytic protein	NA	NA	NA	NA	NA
WP_158917958.1|994471_995164_+	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_158929775.1|995407_998527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158917960.1|998523_999228_+	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_158917962.1|999224_1001297_+	AAA family ATPase	NA	A0A0R6PCP6	Moraxella_phage	33.8	4.8e-23
WP_158917964.1|1001490_1003041_+|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	32.5	2.9e-65
WP_067132325.1|1003076_1003517_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_158917966.1|1003513_1004014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158917968.1|1004308_1007377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158917970.1|1007401_1007827_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_158929777.1|1007823_1008546_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_158917972.1|1008542_1010366_+	VgrG-related protein	NA	NA	NA	NA	NA
WP_158917974.1|1010456_1010774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158917976.1|1010773_1011196_+|plate	baseplate protein	plate	A0A1D8KT65	Synechococcus_phage	32.3	4.0e-09
WP_158917978.1|1011195_1013154_+|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
>prophage 6
NZ_CP047020	Streptomyces sp. T44 chromosome	9735779	1491425	1547308	9735779	tail,protease,plate	Enterobacteria_phage(25.0%)	43	NA	NA
WP_158918719.1|1491425_1492361_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_158918721.1|1493231_1493900_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158918723.1|1493915_1494488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158918725.1|1494695_1496024_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_158918727.1|1496148_1497522_+	purine permease	NA	Q9KX94	Enterobacteria_phage	31.8	4.0e-34
WP_158918729.1|1497686_1497845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158918731.1|1497881_1498238_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158918733.1|1498370_1499450_+	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_158918735.1|1499656_1499863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158918737.1|1500309_1501068_-	PaaX domain-containing protein, C- domain protein	NA	NA	NA	NA	NA
WP_158918739.1|1501141_1502809_+	DNA alkylation response protein	NA	NA	NA	NA	NA
WP_158918741.1|1502955_1504947_+	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_158918743.1|1505008_1505593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158929869.1|1505861_1506959_+	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_158918745.1|1507046_1507724_+	uracil-DNA glycosylase	NA	F2WLY3	Lausannevirus	40.8	3.2e-32
WP_158918747.1|1507720_1508695_+	ATPase	NA	NA	NA	NA	NA
WP_158918749.1|1508883_1509810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158918751.1|1509927_1510965_-	beta-propeller fold lactonase family protein	NA	NA	NA	NA	NA
WP_158918753.1|1511064_1512591_-	FUSC family protein	NA	NA	NA	NA	NA
WP_158918755.1|1512819_1513296_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_158918757.1|1513316_1514015_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_158918759.1|1514155_1515619_+	MFS transporter	NA	NA	NA	NA	NA
WP_158929871.1|1515702_1516425_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158918761.1|1516534_1516936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158918763.1|1516886_1517489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158918765.1|1517785_1518631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158918767.1|1520189_1522388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158918769.1|1522384_1526272_-|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_158929873.1|1526268_1529397_-|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_158918771.1|1529468_1529942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158918773.1|1529938_1530271_-	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_158918775.1|1530298_1530811_-|plate	baseplate assembly protein	plate	NA	NA	NA	NA
WP_158918777.1|1530821_1531967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158918779.1|1531959_1532325_-	LysM domain-containing protein	NA	NA	NA	NA	NA
WP_158929875.1|1532330_1533002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158918781.1|1533030_1533555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158918783.1|1533597_1540275_-	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_158929877.1|1540271_1540553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158918785.1|1540717_1542748_-	AAA family ATPase	NA	A0A109WUE1	Acidianus_tailed_spindle_virus	34.3	7.3e-08
WP_158918787.1|1542768_1543386_-	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_158929879.1|1544145_1544889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158918789.1|1544898_1545423_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_158918791.1|1545448_1547308_-|tail	phage tail protein	tail	J9PVC2	Bacillus_phage	32.9	2.0e-44
>prophage 7
NZ_CP047020	Streptomyces sp. T44 chromosome	9735779	7701077	7730678	9735779	integrase,transposase	uncultured_virus(50.0%)	22	7721666:7721688	7729280:7729302
WP_158916704.1|7701077_7702373_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	36.8	1.0e-34
WP_158926768.1|7702411_7703110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158926770.1|7705470_7706622_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_158926772.1|7706837_7708049_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_158930948.1|7708065_7708749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158926774.1|7709051_7711469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158926776.1|7712122_7713811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158926778.1|7714191_7714662_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_158926780.1|7715185_7716196_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_158926782.1|7716816_7718562_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	37.2	6.4e-85
WP_158926784.1|7718766_7719387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158916704.1|7719452_7720748_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	36.8	1.0e-34
WP_158926786.1|7720762_7721146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158926788.1|7721164_7721566_+	hypothetical protein	NA	NA	NA	NA	NA
7721666:7721688	attL	TGACGGCAGTAGTTGACGGCAAC	NA	NA	NA	NA
WP_158926790.1|7721689_7723018_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0T6A8	Bacillus_phage	33.9	6.2e-40
WP_158926792.1|7723017_7723209_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158926794.1|7723205_7724915_-	Replication initiation protein	NA	NA	NA	NA	NA
WP_158926796.1|7725237_7725663_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158922763.1|7725748_7727560_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_158930950.1|7728328_7728646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158926798.1|7728741_7729203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158926800.1|7730441_7730678_+|transposase	transposase	transposase	NA	NA	NA	NA
7729280:7729302	attR	TGACGGCAGTAGTTGACGGCAAC	NA	NA	NA	NA
>prophage 8
NZ_CP047020	Streptomyces sp. T44 chromosome	9735779	8418246	8428666	9735779	transposase	Staphylococcus_phage(33.33%)	9	NA	NA
WP_158927685.1|8418246_8420148_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	47.4	2.2e-147
WP_158927686.1|8420156_8420765_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_158927687.1|8420771_8421725_+	DnaJ domain-containing protein	NA	A0A2P1ELC3	Moumouvirus	55.7	2.2e-15
WP_158927688.1|8421721_8422129_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158927689.1|8422119_8424759_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	33.5	1.1e-123
WP_158927690.1|8424755_8425202_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	29.4	5.9e-11
WP_158927692.1|8425207_8425471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158927694.1|8425470_8427285_+	FAD-dependent oxidoreductase	NA	A0A2I2L5E1	Orpheovirus	32.1	1.0e-29
WP_158927696.1|8427439_8428666_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.1	4.9e-39
>prophage 9
NZ_CP047020	Streptomyces sp. T44 chromosome	9735779	9604144	9649125	9735779	integrase,transposase	Shigella_phage(100.0%)	38	9594771:9594787	9630384:9630400
9594771:9594787	attL	GGCCGTGGTGATCGACT	NA	NA	NA	NA
WP_158929419.1|9604144_9605335_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_158929421.1|9605719_9606178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158929423.1|9606197_9607553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158929425.1|9607666_9608233_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_158929427.1|9608225_9609152_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_158929429.1|9611294_9612509_-	DUF2029 domain-containing protein	NA	NA	NA	NA	NA
WP_158929431.1|9613069_9613540_-	DUF3147 family protein	NA	NA	NA	NA	NA
WP_158929433.1|9613536_9613881_-	DUF3147 family protein	NA	NA	NA	NA	NA
WP_158929435.1|9613988_9614531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158929437.1|9614770_9615316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158929439.1|9615795_9616602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158929441.1|9617674_9619099_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_158929443.1|9619137_9619701_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158931326.1|9619977_9620163_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5P429	Shigella_phage	41.5	5.8e-05
WP_158929445.1|9620212_9620614_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_158929447.1|9620625_9623895_-	CHAT domain-containing protein	NA	NA	NA	NA	NA
WP_158929449.1|9624055_9624466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158929451.1|9624462_9625368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158929453.1|9625612_9625903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158929455.1|9626419_9626842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158929457.1|9628202_9628817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158929459.1|9629394_9629697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158929461.1|9629856_9630714_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
9630384:9630400	attR	AGTCGATCACCACGGCC	NA	NA	NA	NA
WP_158931328.1|9630737_9631088_-	RacP protein	NA	NA	NA	NA	NA
WP_158929463.1|9632301_9632643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158929465.1|9632689_9633283_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158929467.1|9633430_9634498_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_158929469.1|9634662_9635139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158931330.1|9638430_9639387_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158929471.1|9639607_9640009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158929473.1|9640019_9641273_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_158929475.1|9642538_9643045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158929477.1|9643754_9643997_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_158929479.1|9644348_9644645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158929481.1|9645653_9646109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158929483.1|9646105_9646612_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_158929485.1|9646608_9647493_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_158916897.1|9647886_9649125_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP047020	Streptomyces sp. T44 chromosome	9735779	9665246	9718954	9735779	integrase,transposase	Corynebacterium_phage(25.0%)	41	9698836:9698852	9716766:9716782
WP_158916949.1|9665246_9666656_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_158929503.1|9667472_9668432_+	chlorophyllase	NA	NA	NA	NA	NA
WP_158929505.1|9668540_9669560_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_158929507.1|9669999_9670668_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_158929509.1|9670870_9671947_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_158929511.1|9671943_9672264_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158929513.1|9673108_9674056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158929515.1|9674230_9675124_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158931336.1|9675219_9676377_+	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_158929517.1|9678469_9680155_-	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_158929519.1|9680255_9680972_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158929522.1|9681199_9681892_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_067049883.1|9682014_9683256_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	53.6	3.9e-105
WP_158929524.1|9683361_9683760_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_158931338.1|9683776_9684628_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_158929526.1|9685019_9685451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158929528.1|9686172_9687237_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_158931340.1|9687508_9688837_+	hypothetical protein	NA	A0A1C9EI81	Rhodococcus_phage	36.0	2.6e-14
WP_158929530.1|9688922_9689666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158929531.1|9689878_9690262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158929533.1|9691648_9692059_-	NAD(+)--rifampin ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_158929535.1|9692988_9693633_-	deaminase	NA	NA	NA	NA	NA
WP_158929537.1|9694320_9694539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158929539.1|9694535_9694733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158929541.1|9694771_9694972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158929543.1|9695007_9695238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158929545.1|9695808_9697068_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_158929547.1|9697852_9698245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158929549.1|9698378_9698600_-	hypothetical protein	NA	NA	NA	NA	NA
9698836:9698852	attL	GGTGTCCGGGCCGGTGG	NA	NA	NA	NA
WP_158929551.1|9698950_9699691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158929553.1|9701607_9702219_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_158929555.1|9702215_9703058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158931343.1|9704040_9705816_-|transposase	IS481 family transposase	transposase	S5WIU1	Leptospira_phage	28.2	3.0e-13
WP_158929557.1|9706521_9707712_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_158929559.1|9708146_9708683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158929561.1|9708726_9709317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158929563.1|9709817_9713870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158929565.1|9713979_9714759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158931344.1|9715213_9715438_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_158929567.1|9717372_9717528_-	hypothetical protein	NA	NA	NA	NA	NA
9716766:9716782	attR	CCACCGGCCCGGACACC	NA	NA	NA	NA
WP_158916704.1|9717658_9718954_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	36.8	1.0e-34
