The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046954	Aeromonas hydrophila strain HX-3 chromosome, complete genome	4941513	793958	853079	4941513	tRNA,integrase,transposase	uncultured_Caudovirales_phage(18.18%)	54	811571:811586	824916:824931
WP_158198330.1|793958_794861_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_005304459.1|794980_795430_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_045526152.1|795549_796293_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_080602824.1|796335_796875_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_158198331.1|797019_799467_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	28.0	1.1e-29
WP_016351880.1|799717_802039_+	penicillin-binding protein 1B	NA	NA	NA	NA	NA
WP_158196696.1|802081_802483_+	VOC family protein	NA	NA	NA	NA	NA
WP_011707272.1|802580_802901_-	multidrug transporter	NA	NA	NA	NA	NA
WP_158196697.1|802888_803353_-	multidrug transporter	NA	NA	NA	NA	NA
WP_011707270.1|803509_804391_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_045789066.1|804504_806085_+	DUF3369 domain-containing protein	NA	NA	NA	NA	NA
WP_158196698.1|806160_806676_-	DUF2937 family protein	NA	NA	NA	NA	NA
WP_158196699.1|806862_807585_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_011707266.1|807841_808744_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_158198332.1|808804_809611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158196700.1|809830_811117_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_158196701.1|811339_812731_+	H(+)/Cl(-) exchange transporter ClcA	NA	NA	NA	NA	NA
811571:811586	attL	TTTGGTTTCAGTGCCT	NA	NA	NA	NA
WP_045789072.1|812817_813513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005304404.1|813603_813954_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	1.3e-26
WP_158196702.1|819929_820562_+	LysE family transporter	NA	NA	NA	NA	NA
WP_158196703.1|820802_822020_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	49.9	1.6e-103
WP_158196704.1|822106_822463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158196705.1|823075_823480_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_158196706.1|823562_824612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158196707.1|824998_825211_+	AlpA family phage regulatory protein	NA	A0A1V0E8E5	Vibrio_phage	35.9	2.3e-05
824916:824931	attR	AGGCACTGAAACCAAA	NA	NA	NA	NA
WP_158196708.1|825633_826608_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_024945142.1|826754_827099_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J5G9	uncultured_Caudovirales_phage	34.3	1.5e-06
WP_158196709.1|827380_827734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042034774.1|827745_827898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158196710.1|827909_828584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158196711.1|828671_829235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158196712.1|829267_829696_+	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
WP_158196713.1|829706_830135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158196714.1|830502_831000_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_158196715.1|830996_831188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158198333.1|831302_831551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158196716.1|831667_832177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158196717.1|832173_832389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158196718.1|832385_832748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029303521.1|832827_833370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158196719.1|833371_833713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158196720.1|833745_834042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158196721.1|834131_834446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042054148.1|834520_834856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158196722.1|835054_836484_-|transposase	IS66-like element ISAeme23 family transposase	transposase	NA	NA	NA	NA
WP_158196723.1|837203_837776_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	35.6	1.4e-20
WP_158196724.1|837830_839168_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_158196725.1|839408_840570_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	49.7	4.1e-80
WP_158196726.1|840742_843211_+	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.1	2.4e-13
WP_158196727.1|843333_848604_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	31.1	1.3e-61
WP_158196728.1|848635_849385_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	36.9	7.3e-14
WP_158196729.1|849638_851147_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_158196730.1|851133_851361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158196731.1|851537_853079_+|transposase	IS21-like element ISAs29 family transposase	transposase	K4I413	Acidithiobacillus_phage	47.4	1.3e-129
>prophage 2
NZ_CP046954	Aeromonas hydrophila strain HX-3 chromosome, complete genome	4941513	1568199	1576202	4941513		Enterobacteria_phage(50.0%)	8	NA	NA
WP_045789381.1|1568199_1569321_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	50.4	5.7e-95
WP_045789382.1|1569320_1570208_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	9.0e-27
WP_045789383.1|1570320_1571199_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	4.3e-106
WP_045790994.1|1571259_1571808_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	55.6	1.7e-47
WP_045789384.1|1571957_1573064_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A0P0YLZ6	Yellowstone_lake_phycodnavirus	25.4	1.3e-14
WP_045789385.1|1573066_1573636_+	acyltransferase	NA	NA	NA	NA	NA
WP_158196966.1|1573850_1575275_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_045789386.1|1575287_1576202_+	hypothetical protein	NA	A0A1V0SLJ0	Klosneuvirus	29.4	2.3e-25
>prophage 3
NZ_CP046954	Aeromonas hydrophila strain HX-3 chromosome, complete genome	4941513	2004717	2027622	4941513	integrase,transposase	Escherichia_phage(33.33%)	17	2012599:2012614	2030285:2030300
WP_049636875.1|2004717_2005749_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_017787123.1|2005927_2006944_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.9e-186
WP_075112425.1|2007187_2008144_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	32.5	8.5e-15
WP_001809438.1|2008776_2009808_+|transposase	IS630-like element ISAhy2 family transposase	transposase	NA	NA	NA	NA
WP_082189233.1|2010324_2010864_-	YbjQ family protein	NA	M4STD1	Rhodobacter_phage	39.0	2.0e-13
WP_158198361.1|2010957_2012043_-	sel1 repeat family protein	NA	NA	NA	NA	NA
2012599:2012614	attL	GCAACTGCGCCAGTTC	NA	NA	NA	NA
WP_158197109.1|2013733_2014090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158197110.1|2014149_2014590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158197111.1|2014704_2015118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158197112.1|2015120_2016566_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_158197113.1|2016684_2016975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158197114.1|2016940_2017393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158197115.1|2017437_2019900_+	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_158197116.1|2020410_2021712_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	36.1	2.3e-63
WP_135354569.1|2022609_2024451_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.9	2.0e-28
WP_158197117.1|2024813_2026205_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_158197118.1|2026422_2027622_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JGM5	uncultured_Caudovirales_phage	32.9	6.6e-33
2030285:2030300	attR	GCAACTGCGCCAGTTC	NA	NA	NA	NA
>prophage 4
NZ_CP046954	Aeromonas hydrophila strain HX-3 chromosome, complete genome	4941513	2827699	2900523	4941513	integrase,plate,protease,tRNA,transposase,bacteriocin	uncultured_Mediterranean_phage(10.0%)	59	2886564:2886596	2901035:2901067
WP_158197475.1|2827699_2828458_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_011705746.1|2828642_2830163_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	42.6	1.4e-88
WP_011705745.1|2830184_2830673_-|bacteriocin	bacteriocin production protein	bacteriocin	NA	NA	NA	NA
WP_011705744.1|2830859_2832155_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.1	1.4e-92
WP_065477836.1|2832495_2833833_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	42.1	8.1e-80
WP_042066569.1|2833984_2834593_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_024944039.1|2834670_2837193_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.4	4.7e-89
WP_005300047.1|2837394_2837886_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_135354313.1|2838035_2838266_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_158197476.1|2838880_2839831_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	2.4e-62
WP_011705738.1|2839888_2841136_+	response regulator	NA	A0A127AWB9	Bacillus_phage	32.2	6.5e-15
WP_011705737.1|2841246_2841717_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_158197477.1|2841736_2842444_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_011705735.1|2842440_2843157_+	arginyltransferase	NA	NA	NA	NA	NA
WP_005300033.1|2843226_2843445_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_158197478.1|2843514_2845767_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.7	2.0e-168
WP_005300028.1|2845826_2846144_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	49.4	2.4e-14
WP_005300025.1|2846372_2846591_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	63.2	1.2e-17
WP_158197479.1|2846698_2847562_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	31.2	1.3e-27
WP_158197480.1|2848680_2849190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310555.1|2849681_2850698_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_158197481.1|2850754_2851075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158197482.1|2851427_2851832_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_158197483.1|2851834_2854390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158197484.1|2854424_2856470_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.7	2.5e-32
WP_017411057.1|2856480_2856768_-	type VI secretion system PAAR protein	NA	G4KK81	Yersinia_phage	39.4	2.3e-08
WP_158197485.1|2857025_2858456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158197486.1|2858502_2861988_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_158197487.1|2862029_2863466_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_158197488.1|2863474_2864080_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_017411062.1|2864079_2865618_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_158197489.1|2865620_2868263_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	3.1e-91
WP_113994302.1|2868283_2868994_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_029301183.1|2869085_2870420_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_158197490.1|2870422_2870938_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_158197491.1|2870937_2872188_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_158197492.1|2872256_2873255_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_011705715.1|2873218_2874985_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_005299981.1|2874988_2875420_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_158197493.1|2875426_2876905_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_011705712.1|2876943_2877447_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_158197494.1|2878120_2879509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158197495.1|2879629_2880175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080697997.1|2880298_2881288_-	DUF1911 domain-containing protein	NA	NA	NA	NA	NA
WP_158197496.1|2881297_2882617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158197497.1|2882618_2884850_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.9	1.7e-34
WP_010634822.1|2885127_2885646_-	type VI secretion system effector Hcp1	NA	NA	NA	NA	NA
2886564:2886596	attL	TATTTGGCGGTGAGGGAGGGATTCGAACCCTCG	NA	NA	NA	NA
WP_001310555.1|2887100_2888117_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_158197498.1|2888121_2888382_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_158197499.1|2888606_2889317_+	GDSL family lipase	NA	F5B430	Synechococcus_phage	32.7	4.7e-18
WP_158197121.1|2889822_2891478_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	31.2	1.1e-38
WP_041205730.1|2891526_2891892_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_134697343.1|2891891_2892194_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_139039452.1|2893293_2893734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158197500.1|2894351_2895344_-	AAA family ATPase	NA	A0A2P1CFH0	Microbacterium_phage	24.3	3.7e-05
WP_158197501.1|2895497_2897207_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_158197502.1|2897197_2897896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158197503.1|2898192_2899353_-|integrase	tyrosine-type recombinase/integrase	integrase	Q76UT6	Pseudomonas_virus	34.1	7.1e-32
WP_046400743.1|2899644_2900523_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2901035:2901067	attR	TATTTGGCGGTGAGGGAGGGATTCGAACCCTCG	NA	NA	NA	NA
>prophage 5
NZ_CP046954	Aeromonas hydrophila strain HX-3 chromosome, complete genome	4941513	4043939	4057019	4941513	tRNA,integrase	Vibrio_phage(20.0%)	13	4027281:4027295	4047988:4048002
4027281:4027295	attL	CAACGAGTGCGAAAC	NA	NA	NA	NA
WP_158197958.1|4043939_4044167_-	AlpA family phage regulatory protein	NA	G8DCP6	Silicibacter_phage	40.5	3.1e-08
WP_158197959.1|4044286_4045255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158197960.1|4045368_4046637_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	45.2	5.8e-104
WP_073348937.1|4047083_4048949_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.6	1.1e-34
4047988:4048002	attR	GTTTCGCACTCGTTG	NA	NA	NA	NA
WP_158197961.1|4049162_4050950_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	40.9	7.5e-73
WP_158197962.1|4051038_4051482_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	48.6	1.7e-26
WP_005309452.1|4051497_4051713_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_113995473.1|4051892_4052906_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.3	9.1e-108
WP_011704778.1|4052990_4053974_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.1	1.7e-34
WP_158197963.1|4054021_4055062_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0A7NU10	Lactobacillus_phage	41.4	3.5e-14
WP_073352336.1|4055072_4055648_-	DedA family protein	NA	NA	NA	NA	NA
WP_011704775.1|4055650_4056268_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.4	4.0e-34
WP_042064190.1|4056272_4057019_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	54.1	7.2e-70
