The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046904	Massilia flava strain DSM 26639 chromosome, complete genome	6922031	4068149	4120083	6922031	integrase,protease,holin,transposase	Pseudomonas_phage(12.5%)	58	4071412:4071431	4130877:4130896
WP_145877367.1|4068149_4068659_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	47.4	2.0e-18
WP_145877370.1|4068903_4069521_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4UU96	Bodo_saltans_virus	24.9	2.3e-05
WP_145877372.1|4069514_4070183_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_145877374.1|4070191_4070950_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_145877377.1|4070946_4071099_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_145877379.1|4071095_4071548_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
4071412:4071431	attL	GCGAGCTGGCGCCGGGGAAC	NA	NA	NA	NA
WP_145877381.1|4071528_4073517_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_145877383.1|4073519_4074047_+	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_145877385.1|4074039_4074477_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_145877388.1|4074473_4075706_+	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_145877390.1|4075792_4075957_+	nitrate reductase	NA	NA	NA	NA	NA
WP_145877392.1|4075959_4076229_+	glutamate synthase	NA	NA	NA	NA	NA
WP_145877394.1|4076225_4078724_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_145877396.1|4078735_4079206_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_145877399.1|4079215_4079794_+	cytochrome c3 family protein	NA	NA	NA	NA	NA
WP_145877402.1|4079898_4080228_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_145877405.1|4080231_4082052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158206774.1|4082048_4082195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145877408.1|4082191_4083211_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	36.1	5.8e-54
WP_145877410.1|4083159_4083576_-	GtrA family protein	NA	NA	NA	NA	NA
WP_145877412.1|4083651_4084701_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_145877414.1|4084702_4085146_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_145877416.1|4085240_4085717_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_145877418.1|4085858_4086119_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	40.5	1.3e-10
WP_145877420.1|4086135_4086537_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_145877422.1|4086651_4087398_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_145877425.1|4087405_4088860_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_145877428.1|4088870_4090391_+	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	25.8	3.3e-21
WP_145877430.1|4090387_4091134_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_145877432.1|4091255_4091699_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_145877434.1|4091670_4092171_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_145877437.1|4092175_4092544_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_145877439.1|4092540_4093158_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_145877441.1|4093154_4094123_+	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_145877444.1|4094138_4095368_+	general secretion pathway protein GspL	NA	NA	NA	NA	NA
WP_145877514.1|4095373_4095883_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_145877446.1|4095879_4096653_+	type II secretion system protein GspN	NA	NA	NA	NA	NA
WP_145877448.1|4096652_4098827_+	type II secretion system secretin GspD	NA	NA	NA	NA	NA
WP_145877450.1|4098833_4100252_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_145877452.1|4100264_4101485_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_158206775.1|4102149_4102860_-	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_145877454.1|4102990_4103194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145877456.1|4103203_4104541_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	28.7	7.4e-41
WP_145877460.1|4104551_4105088_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_145877462.1|4105161_4106472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145877464.1|4106586_4107036_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_145877467.1|4107131_4108181_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_145877470.1|4108257_4109211_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1SGM4	Mycobacterium_phage	30.7	2.4e-09
WP_145877472.1|4109212_4109884_-	DUF484 family protein	NA	NA	NA	NA	NA
WP_158206887.1|4110063_4110996_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_145876716.1|4111104_4112163_-	porin	NA	NA	NA	NA	NA
WP_145876718.1|4112587_4114030_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_145876720.1|4114042_4114906_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_145876723.1|4114902_4115799_-	lipid A biosynthesis acyltransferase	NA	NA	NA	NA	NA
WP_145876725.1|4115795_4116653_-	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_145876727.1|4116843_4118013_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	61.2	1.7e-121
WP_145876729.1|4118244_4119660_+	adenosylhomocysteinase	NA	NA	NA	NA	NA
WP_145876731.1|4119732_4120083_+|holin	phage holin family protein	holin	NA	NA	NA	NA
4130877:4130896	attR	GTTCCCCGGCGCCAGCTCGC	NA	NA	NA	NA
>prophage 2
NZ_CP046904	Massilia flava strain DSM 26639 chromosome, complete genome	6922031	6736556	6752622	6922031	terminase	Pseudomonas_phage(46.15%)	25	NA	NA
WP_145880204.1|6736556_6736757_-	hypothetical protein	NA	A0A2I6PHW0	Pseudomonas_phage	57.1	8.2e-05
WP_145880206.1|6736780_6737059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158206869.1|6737060_6737222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145880208.1|6737225_6738140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145880211.1|6738168_6738594_-	recombinase	NA	E5AGF7	Erwinia_phage	51.1	1.8e-25
WP_145880213.1|6738590_6739238_-	YqaJ viral recombinase family protein	NA	A0A0S2SY31	Pseudomonas_phage	39.1	4.1e-29
WP_145880215.1|6739230_6739977_-	phage recombination protein Bet	NA	A0A0H5BBT9	Pseudomonas_phage	76.1	7.5e-67
WP_145880217.1|6740133_6740397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158206870.1|6740504_6741872_-	hypothetical protein	NA	A0A0U3TGV3	Pseudomonas_phage	60.5	6.0e-06
WP_145881972.1|6742018_6742231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158206871.1|6742694_6743438_-	helix-turn-helix domain-containing protein	NA	W6MVG5	Pseudomonas_phage	32.9	1.9e-22
WP_145881967.1|6743577_6743799_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_145881965.1|6743852_6744125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145881963.1|6744193_6744415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145881961.1|6744587_6744959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145881959.1|6744955_6745450_+	hypothetical protein	NA	Q3HR00	Burkholderia_phage	39.6	1.0e-24
WP_145881958.1|6745452_6746340_+	hypothetical protein	NA	I3PUZ7	Vibrio_phage	47.0	5.0e-54
WP_145881956.1|6746329_6747106_+	hypothetical protein	NA	U6C6D0	Ralstonia_phage	35.0	3.5e-27
WP_145881954.1|6747151_6747943_+	SPFH domain-containing protein	NA	NA	NA	NA	NA
WP_145881952.1|6747991_6748642_+	ninG protein	NA	A0A0U1VZM0	Pseudomonas_phage	46.4	2.4e-37
WP_145881950.1|6748638_6749190_+	hypothetical protein	NA	K4F5N6	Cronobacter_phage	38.7	1.0e-12
WP_145881948.1|6749186_6749567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145881946.1|6749628_6749919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145881943.1|6750769_6751261_+|terminase	terminase	terminase	Q775B8	Bordetella_phage	47.7	7.6e-28
WP_145881978.1|6751329_6752622_+	DNA packaging protein	NA	A0A1B1IQC4	uncultured_Mediterranean_phage	35.0	8.5e-26
