The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046857	Vibrio fluvialis strain 2015AW-0233 chromosome 1, complete sequence	3212156	84548	93624	3212156	tRNA,transposase	Pseudoalteromonas_phage(16.67%)	8	NA	NA
WP_158124302.1|84548_85154_+	DUF4326 domain-containing protein	NA	A0A223LH87	Pseudoalteromonas_phage	51.4	1.5e-12
WP_158124303.1|85279_85468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158124304.1|85604_86782_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	69.2	1.2e-122
WP_020330404.1|87846_89724_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.6	5.5e-34
WP_020330405.1|89821_91567_-	DNA primase	NA	A0A1S5RG58	Helicobacter_phage	31.7	4.5e-46
WP_020330407.1|91685_92129_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	46.5	4.3e-22
WP_001145625.1|92157_92373_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_020330418.1|92604_93624_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.7	8.2e-109
>prophage 2
NZ_CP046857	Vibrio fluvialis strain 2015AW-0233 chromosome 1, complete sequence	3212156	99756	110858	3212156	tRNA	uncultured_Mediterranean_phage(25.0%)	9	NA	NA
WP_020330427.1|99756_100524_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.8	9.1e-68
WP_020429685.1|100516_101143_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	53.3	2.0e-36
WP_020429687.1|101142_102078_+	murein hydrolase activator NlpD	NA	I3PV79	Clostridium_phage	32.8	2.3e-12
WP_020429689.1|102149_103136_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.5	1.3e-34
WP_158124307.1|103200_105762_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	23.6	2.6e-34
WP_158124308.1|105846_106335_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	44.5	5.1e-24
WP_020330433.1|106507_107560_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	60.7	4.8e-112
WP_047459347.1|107629_108088_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_158124309.1|108275_110858_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.0	1.5e-77
>prophage 3
NZ_CP046857	Vibrio fluvialis strain 2015AW-0233 chromosome 1, complete sequence	3212156	322149	329197	3212156		Faustovirus(16.67%)	9	NA	NA
WP_020330643.1|322149_323364_+	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	30.5	1.1e-30
WP_020330644.1|323400_323784_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.4	9.1e-53
WP_020330645.1|323843_324167_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	5.5e-27
WP_020330646.1|324234_324750_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_158124388.1|324771_326625_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	40.8	6.5e-112
WP_020330648.1|326638_326977_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_158124390.1|327032_327227_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_100268069.1|327403_328696_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	40.3	1.0e-34
WP_020330651.1|328765_329197_+	nucleoside-diphosphate kinase	NA	K7YW26	Megavirus	39.8	2.6e-19
>prophage 4
NZ_CP046857	Vibrio fluvialis strain 2015AW-0233 chromosome 1, complete sequence	3212156	1056341	1064198	3212156		Vibrio_phage(90.0%)	11	NA	NA
WP_055453527.1|1056341_1056683_-	DUF2523 domain-containing protein	NA	R9TRT6	Vibrio_phage	75.2	1.8e-44
WP_158124970.1|1056691_1058140_-	hypothetical protein	NA	G8IRU9	Vibrio_phage	45.1	2.3e-24
WP_055453529.1|1058271_1058487_-	hypothetical protein	NA	R9TRU5	Vibrio_phage	63.1	8.8e-13
WP_081035198.1|1058515_1058743_-	hypothetical protein	NA	R9TMT7	Vibrio_phage	57.3	3.4e-15
WP_055453530.1|1058752_1059091_-	DUF1293 domain-containing protein	NA	Q858R2	Vibrio_phage	74.1	1.5e-43
WP_158124972.1|1059063_1060179_-	replication initiation factor family protein	NA	Q64EV8	Vibrio_phage	77.7	1.5e-167
WP_055453532.1|1060168_1060369_-	hypothetical protein	NA	C3W4P3	Vibrio_phage	76.9	2.1e-24
WP_061056520.1|1060371_1060629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158124974.1|1060632_1061214_-	3'-5' exonuclease	NA	W6ASW5	Vibrio_phage	42.4	7.6e-35
WP_158125716.1|1061394_1061763_+	hypothetical protein	NA	Q9MCC3	Vibrio_phage	77.7	1.5e-44
WP_158124976.1|1062467_1064198_-	response regulator	NA	A0A1V0SGX0	Hokovirus	34.5	5.6e-49
>prophage 5
NZ_CP046857	Vibrio fluvialis strain 2015AW-0233 chromosome 1, complete sequence	3212156	1733011	1769813	3212156	integrase,plate,tail	Vibrio_phage(22.22%)	48	1732541:1732599	1771133:1771191
1732541:1732599	attL	ACCGTCATGGGGTGTCGGGGGTCGGAGGTTCAAATCCTCTCAGTCCGACCATACACCTA	NA	NA	NA	NA
WP_020433371.1|1733011_1734193_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_156102025.1|1734214_1734409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158125246.1|1734611_1735127_-	PadR family transcriptional regulator	NA	A0A1S6L1S5	Vibrio_phage	52.1	1.2e-10
WP_158125247.1|1735160_1735406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020433376.1|1735383_1735653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158125248.1|1735649_1735946_-	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	55.1	5.1e-11
WP_158125249.1|1735949_1736513_-	3'-5' exoribonuclease	NA	K7PM77	Enterobacteria_phage	58.1	1.9e-51
WP_158125250.1|1736515_1736809_-	hypothetical protein	NA	A2I2Z5	Vibrio_virus	66.3	2.2e-30
WP_158125251.1|1736817_1737096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158125252.1|1737105_1739865_-	hypothetical protein	NA	A0A1S5NPU9	Burkholderia_phage	48.8	1.1e-259
WP_152467905.1|1739830_1740133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020433385.1|1740116_1740416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081878688.1|1740408_1740711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158125253.1|1740921_1741623_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_020432400.1|1741651_1742134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020432401.1|1742332_1742518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158125254.1|1742718_1743543_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_158125255.1|1743805_1744765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158125256.1|1744784_1745792_-	hypothetical protein	NA	R9TNM7	Vibrio_phage	30.7	2.4e-20
WP_158125257.1|1745782_1745989_-|tail	phage tail protein	tail	A0A0M4RTN6	Salmonella_phage	43.5	2.6e-06
WP_158125258.1|1745991_1746384_-|tail	phage tail protein	tail	K7R6Q8	Vibrio_phage	37.5	9.4e-21
WP_158125259.1|1746393_1748526_-	hypothetical protein	NA	A0A2P9JZK0	Alteromonadaceae_phage	41.4	2.2e-79
WP_158125260.1|1748602_1748959_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_020432412.1|1748967_1749480_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	31.3	7.2e-13
WP_158125261.1|1749489_1750650_-|tail	phage tail protein	tail	A0A1B2LRR3	Wolbachia_phage	38.6	2.7e-71
WP_158125262.1|1750738_1751266_-	hypothetical protein	NA	R9TMQ2	Vibrio_phage	72.6	1.3e-38
WP_158125263.1|1751269_1752499_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	25.4	7.8e-13
WP_042483718.1|1752495_1753143_-|tail	phage tail protein I	tail	Q19UQ4	Mannheimia_phage	32.3	4.5e-20
WP_158125264.1|1753142_1754012_-|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	35.5	1.4e-40
WP_158125741.1|1754008_1754356_-	dTDP-glucose pyrophosphorylase	NA	K4I3Z7	Acidithiobacillus_phage	40.9	5.2e-07
WP_158125265.1|1754363_1754996_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_158125266.1|1754988_1755528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042483730.1|1755537_1756035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158125267.1|1756027_1756633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158125268.1|1756635_1756941_-	chromosome partitioning protein ParA	NA	NA	NA	NA	NA
WP_158125269.1|1756930_1757527_-	hypothetical protein	NA	A0A1D9CA16	Salinivibrio_phage	55.2	5.2e-55
WP_158125270.1|1757581_1758166_-	ABC transporter ATPase	NA	NA	NA	NA	NA
WP_158125271.1|1758238_1760812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158125272.1|1760917_1761133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158125273.1|1761302_1761731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158125274.1|1761747_1761936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158125275.1|1762251_1763340_-	hypothetical protein	NA	M5AAH5	Nitratiruptor_phage	31.4	2.2e-06
WP_158125276.1|1763345_1764728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158125277.1|1764724_1766323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158125278.1|1766315_1767281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042483761.1|1767280_1767973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038157580.1|1768521_1768770_-	molecular chaperone GroES	NA	NA	NA	NA	NA
WP_158125279.1|1768766_1769813_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1771133:1771191	attR	ACCGTCATGGGGTGTCGGGGGTCGGAGGTTCAAATCCTCTCAGTCCGACCATACACCTA	NA	NA	NA	NA
>prophage 6
NZ_CP046857	Vibrio fluvialis strain 2015AW-0233 chromosome 1, complete sequence	3212156	2047886	2054429	3212156		Staphylococcus_phage(66.67%)	7	NA	NA
WP_004724909.1|2047886_2048357_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.3	1.9e-31
WP_020431928.1|2048550_2049660_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.0	4.8e-62
WP_158125354.1|2049701_2050355_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	39.5	1.7e-35
WP_158125355.1|2050358_2051468_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.6	2.2e-43
WP_020331649.1|2051481_2051931_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_024373553.1|2052033_2053284_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.2	8.9e-97
WP_038157346.1|2053295_2054429_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.0	6.2e-65
>prophage 7
NZ_CP046857	Vibrio fluvialis strain 2015AW-0233 chromosome 1, complete sequence	3212156	3088240	3152748	3212156	capsid,plate,integrase,protease,tail,portal,terminase,head,tRNA	Vibrio_phage(26.09%)	79	3086772:3086789	3166443:3166460
3086772:3086789	attL	TAGCTCAGTTGGTAGAGC	NA	NA	NA	NA
WP_158125641.1|3088240_3089353_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_020332624.1|3089564_3090029_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_158125761.1|3090109_3091741_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	29.2	1.4e-14
WP_158125642.1|3091753_3093694_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.5	1.5e-58
WP_020332628.1|3093690_3094623_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_020332629.1|3094818_3095082_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_020433626.1|3095123_3096413_+	GTPase HflX	NA	NA	NA	NA	NA
WP_020332631.1|3096458_3097649_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_020332632.1|3097651_3098635_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_158125643.1|3098706_3098895_+	DUF2065 family protein	NA	NA	NA	NA	NA
WP_020332635.1|3098911_3099139_-	SlyX family protein	NA	NA	NA	NA	NA
WP_020332636.1|3099141_3100122_-	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_158125644.1|3100261_3101050_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_020332638.1|3101228_3101951_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_020332639.1|3101947_3102340_+	sulfurtransferase complex subunit TusD	NA	NA	NA	NA	NA
WP_154184817.1|3102336_3102693_+	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_047462507.1|3102707_3102983_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_014203960.1|3103166_3103541_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_014203959.1|3103643_3104114_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_020332642.1|3104189_3106286_+	elongation factor G	NA	A0A1S5SF82	Streptococcus_phage	26.0	3.8e-52
WP_075989032.1|3106393_3107578_+	elongation factor Tu	NA	M4M9V7	Vibrio_phage	60.5	4.4e-05
WP_020332718.1|3107864_3108053_+	bacterioferritin-associated ferredoxin	NA	NA	NA	NA	NA
WP_020433766.1|3108122_3108599_+	bacterioferritin	NA	NA	NA	NA	NA
WP_004723737.1|3108795_3109164_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_086027247.1|3109172_3109475_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000090472.1|3109490_3109718_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_020332714.1|3109751_3110201_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_020332713.1|3110276_3111044_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_020332712.1|3111216_3112626_+	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	71.8	1.2e-182
WP_152490521.1|3112594_3113725_+	alanine racemase	NA	NA	NA	NA	NA
WP_020332710.1|3113735_3114155_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_055453706.1|3114440_3116093_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_020433733.1|3116180_3116642_-	chemotaxis protein CheX	NA	NA	NA	NA	NA
WP_061056948.1|3116666_3117116_-	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_158125645.1|3117531_3119418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080871245.1|3119446_3119554_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_158125646.1|3119589_3119877_-|tail	phage tail assembly protein	tail	R4JJY8	Burkholderia_phage	39.5	4.8e-06
WP_158125647.1|3119860_3120568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020329244.1|3120578_3120944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158125648.1|3120947_3122081_-|tail	phage tail protein	tail	C9DGP7	Escherichia_phage	38.7	9.0e-48
WP_158125649.1|3122077_3122260_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_158125650.1|3122260_3122800_-	virion morphogenesis protein	NA	NA	NA	NA	NA
WP_158125651.1|3122796_3123261_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_158125652.1|3123260_3123710_-|head	head completion/stabilization protein	head	NA	NA	NA	NA
WP_158125653.1|3123818_3124856_-|capsid	phage major capsid protein, P2 family	capsid	A0A0U4K5I9	Pseudomonas_phage	42.9	3.0e-66
WP_158125654.1|3124898_3125711_-|capsid	phage capsid protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	35.4	7.0e-18
WP_158125655.1|3125881_3127606_+|terminase	terminase	terminase	E5E3X0	Burkholderia_phage	41.4	9.3e-113
WP_158125656.1|3127616_3128582_+|portal	phage portal protein	portal	A0A0M3LS06	Mannheimia_phage	41.2	4.8e-58
WP_158125657.1|3129049_3129463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055452444.1|3129638_3129857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081035136.1|3129875_3129983_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_158125658.1|3129997_3130429_+	aldehyde-activating protein	NA	NA	NA	NA	NA
WP_158125762.1|3130455_3130596_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_140229250.1|3130570_3130909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004726819.1|3131180_3131432_-	hypothetical protein	NA	A0A1D9C9R8	Salinivibrio_phage	45.2	1.2e-08
WP_004726817.1|3131422_3131653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158125659.1|3131663_3132080_-	glycoside hydrolase family protein	NA	A0A1Q1PW74	Pseudoalteromonas_phage	52.2	5.0e-28
WP_158125763.1|3132197_3133019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158125660.1|3133123_3134218_-|tail	phage tail protein	tail	A9DEM1	Yersinia_phage	38.7	5.5e-18
WP_158125661.1|3134214_3134694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158125662.1|3134675_3135722_-	hypothetical protein	NA	A0A1E1GE19	Vibrio_phage	24.5	4.0e-10
WP_158125663.1|3135718_3136105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158125664.1|3136101_3136677_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_158125665.1|3136669_3137608_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_158125666.1|3137604_3138795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158125667.1|3139580_3139940_-	hypothetical protein	NA	A0A1S6KZW3	Salmonella_phage	38.0	1.1e-12
WP_004726797.1|3140185_3140437_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_158125668.1|3140446_3143077_-	replication endonuclease	NA	A0A166YHE2	Vibrio_phage	59.4	1.3e-299
WP_158125669.1|3143093_3143636_-	DNA methyltransferase	NA	U3PDF3	Vibrio_phage	83.4	5.8e-85
WP_044362472.1|3143632_3143929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158125670.1|3144001_3144331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158125671.1|3144342_3144891_-	transcriptional regulator	NA	A0A2I7RNI1	Vibrio_phage	44.5	3.1e-38
WP_158125672.1|3145117_3145387_-	pyocin activator protein PrtN	NA	A0A1L5C290	Pseudoalteromonas_phage	44.4	4.8e-16
WP_158125673.1|3145539_3146460_+	hypothetical protein	NA	F1C5C2	Cronobacter_phage	36.9	3.7e-15
WP_158125674.1|3146475_3146895_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_158125675.1|3147169_3148240_-	DNA (cytosine-5-)-methyltransferase	NA	M1PSQ0	Streptococcus_phage	34.6	1.5e-36
WP_158125676.1|3148240_3150331_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_158125677.1|3150545_3151613_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1D9C9R5	Salinivibrio_phage	66.0	5.9e-142
WP_158125678.1|3151734_3152748_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
3166443:3166460	attR	TAGCTCAGTTGGTAGAGC	NA	NA	NA	NA
>prophage 1
NZ_CP046858	Vibrio fluvialis strain 2015AW-0233 chromosome 2, complete sequence	1570000	1273685	1283233	1570000		Vibrio_phage(83.33%)	8	NA	NA
WP_158126228.1|1273685_1274159_-	DNA repair protein RadC	NA	E9P5Z9	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage	31.9	6.1e-14
WP_104408442.1|1274276_1274483_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	54.9	2.5e-09
WP_158126395.1|1274747_1275542_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_024374513.1|1275656_1276646_+	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	36.7	1.4e-49
WP_158126396.1|1276642_1280011_+	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	30.2	1.7e-105
WP_061055676.1|1280010_1281306_+	type I-F CRISPR-associated protein Csy1	NA	NA	NA	NA	NA
WP_158126229.1|1281302_1282190_+	type I-F CRISPR-associated protein Csy2	NA	A0A2I7RCX5	Vibrio_phage	21.5	7.6e-10
WP_158126230.1|1282201_1283233_+	type I-F CRISPR-associated protein Csy3	NA	A0A2D0YRR8	Vibrio_phage	34.4	1.1e-41
>prophage 2
NZ_CP046858	Vibrio fluvialis strain 2015AW-0233 chromosome 2, complete sequence	1570000	1304531	1371472	1570000	integrase,transposase,protease	Vibrio_phage(60.0%)	63	1311481:1311495	1365468:1365482
WP_158124304.1|1304531_1305709_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	69.2	1.2e-122
WP_104965419.1|1306191_1306869_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_038127441.1|1306975_1307422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104965681.1|1307638_1307914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055466417.1|1308121_1308742_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_158126235.1|1309402_1309984_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_044363220.1|1310011_1310275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075990185.1|1311042_1311252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158126236.1|1311274_1313020_+	EAL domain-containing protein	NA	NA	NA	NA	NA
1311481:1311495	attL	CGGGAATCTGAATCA	NA	NA	NA	NA
WP_158126237.1|1313411_1314332_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	98.4	3.9e-174
WP_158126238.1|1315081_1316743_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.0	2.4e-25
WP_158126239.1|1316896_1318528_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_158126240.1|1318665_1319070_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_075989484.1|1319412_1319622_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_075989483.1|1319752_1320130_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_158124304.1|1321192_1322369_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	69.2	1.2e-122
WP_158126241.1|1322362_1323520_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	38.9	1.1e-69
WP_158126242.1|1323938_1324742_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158126243.1|1324834_1326232_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_024375107.1|1326512_1327625_+	response regulator	NA	W8CYM9	Bacillus_phage	37.1	3.2e-13
WP_158126397.1|1330178_1330493_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_158126244.1|1330809_1331700_+	formate dehydrogenase	NA	NA	NA	NA	NA
WP_158126245.1|1331710_1334020_+	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_158126246.1|1334110_1334425_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_158126398.1|1334789_1336610_+	diguanylate cyclase	NA	G3MA91	Bacillus_virus	32.5	2.9e-11
WP_020328531.1|1336649_1337459_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_158126247.1|1337814_1338603_-	DUF2974 domain-containing protein	NA	Q6XLV5	Feldmannia_irregularis_virus	29.6	4.1e-07
WP_020328533.1|1338714_1339365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020328534.1|1339514_1339763_+	DUF2164 domain-containing protein	NA	NA	NA	NA	NA
WP_055453407.1|1339925_1340465_+	cytochrome b	NA	NA	NA	NA	NA
WP_020328536.1|1340461_1341031_+	YceI family protein	NA	NA	NA	NA	NA
WP_158126248.1|1341123_1342575_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_020328538.1|1342791_1343697_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158126249.1|1343881_1344376_+	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_020328540.1|1344541_1346173_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_158126250.1|1346440_1348174_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_158126251.1|1348620_1349580_+	TerC/Alx family metal homeostasis membrane protein	NA	A0A291LBC5	Escherichia_phage	35.0	1.1e-35
WP_020328543.1|1349905_1350097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100267799.1|1350191_1350767_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_158126252.1|1350899_1351688_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_020328546.1|1351859_1352312_+	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_020328547.1|1352312_1352546_+	DUF3389 domain-containing protein	NA	NA	NA	NA	NA
WP_158126253.1|1352626_1354318_+	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024375092.1|1354319_1354571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158126399.1|1354942_1356955_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_020328550.1|1357300_1358188_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158126254.1|1358240_1360925_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_032081879.1|1361141_1361726_+	cytochrome c biogenesis protein CcdA	NA	NA	NA	NA	NA
WP_158126255.1|1361886_1362891_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_158126256.1|1362874_1363843_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A077SLE7	Escherichia_phage	21.6	6.8e-12
WP_024375550.1|1363944_1364319_+	DUF3319 domain-containing protein	NA	NA	NA	NA	NA
WP_158126257.1|1364327_1364639_+	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_158126258.1|1364786_1365155_-	hypothetical protein	NA	A0A1W6UGD7	Vibrio_phage	72.3	3.7e-43
WP_158126259.1|1365322_1365886_+	3'-5' exonuclease	NA	W6ASW5	Vibrio_phage	58.4	4.2e-54
1365468:1365482	attR	TGATTCAGATTCCCG	NA	NA	NA	NA
WP_158126260.1|1365889_1366147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055453532.1|1366149_1366350_+	hypothetical protein	NA	C3W4P3	Vibrio_phage	76.9	2.1e-24
WP_158126261.1|1366339_1367452_+	replication initiation factor family protein	NA	Q64EV8	Vibrio_phage	77.9	8.5e-168
WP_055453530.1|1367424_1367763_+	DUF1293 domain-containing protein	NA	Q858R2	Vibrio_phage	74.1	1.5e-43
WP_081035198.1|1367772_1368000_+	hypothetical protein	NA	R9TMT7	Vibrio_phage	57.3	3.4e-15
WP_055453529.1|1368028_1368244_+	hypothetical protein	NA	R9TRU5	Vibrio_phage	63.1	8.8e-13
WP_158126262.1|1368606_1369746_+	hypothetical protein	NA	G8IRU9	Vibrio_phage	45.1	1.8e-24
WP_055453527.1|1369754_1370096_+	DUF2523 domain-containing protein	NA	R9TRT6	Vibrio_phage	75.2	1.8e-44
WP_158126263.1|1370101_1371472_+	toxin	NA	R9TQ09	Vibrio_phage	77.9	6.1e-200
