The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046853	Vibrio furnissii strain 2012V-1225 chromosome 1, complete sequence	3296503	93150	104297	3296503	tRNA	uncultured_Mediterranean_phage(25.0%)	9	NA	NA
WP_004723832.1|93150_93918_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	1.5e-67
WP_158108062.1|93910_94537_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.5	1.7e-35
WP_158164945.1|94536_95472_+	murein hydrolase activator NlpD	NA	I3PV79	Clostridium_phage	31.7	3.0e-12
WP_004723838.1|95544_96534_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.5	1.3e-34
WP_004723840.1|96602_99164_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	23.6	1.5e-34
WP_158164946.1|99248_99743_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	48.7	3.5e-28
WP_004723845.1|99909_100962_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	60.7	6.3e-112
WP_004723847.1|101056_101527_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_158164947.1|101714_104297_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.4	1.9e-77
>prophage 2
NZ_CP046853	Vibrio furnissii strain 2012V-1225 chromosome 1, complete sequence	3296503	313591	320635	3296503		Faustovirus(16.67%)	9	NA	NA
WP_004729418.1|313591_314806_+	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	30.2	6.3e-31
WP_004729416.1|314842_315226_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	76.6	9.1e-53
WP_004729414.1|315285_315609_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	5.5e-27
WP_055465966.1|315675_316191_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_158164995.1|316212_318066_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	40.5	1.1e-111
WP_004729409.1|318079_318418_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_004729407.1|318473_318668_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_055465968.1|318844_320137_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	34.1	1.7e-34
WP_004729403.1|320203_320635_+	nucleoside-diphosphate kinase	NA	K7YW26	Megavirus	38.3	4.4e-19
>prophage 3
NZ_CP046853	Vibrio furnissii strain 2012V-1225 chromosome 1, complete sequence	3296503	1037318	1103034	3296503	tail,capsid,terminase,plate,integrase,tRNA,portal,head	Vibrio_phage(26.32%)	71	1066905:1066933	1103155:1103183
WP_158165207.1|1037318_1038722_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_158165208.1|1038718_1040530_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	26.0	3.7e-11
WP_014205182.1|1040808_1041414_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_158165209.1|1041416_1043348_+	hydrogenase 4 subunit B	NA	NA	NA	NA	NA
WP_004726129.1|1043348_1044302_+	respiratory chain complex I subunit 1 family protein	NA	NA	NA	NA	NA
WP_086027842.1|1044335_1046051_+	hydrogenase large subunit	NA	NA	NA	NA	NA
WP_158165210.1|1046058_1046637_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_158165211.1|1046633_1047452_+	NADH-quinone oxidoreductase subunit NuoB	NA	NA	NA	NA	NA
WP_004726125.1|1047438_1047873_+	formate hydrogenlyase maturation protein HycH	NA	NA	NA	NA	NA
WP_004726124.1|1047869_1048325_+	hydrogenase maturation peptidase HycI	NA	NA	NA	NA	NA
WP_004726123.1|1048564_1049110_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_081454197.1|1049137_1051282_+	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_158165212.1|1051357_1053415_+	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_158165213.1|1053469_1054315_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_081454196.1|1054427_1055009_+	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_158165214.1|1055021_1057322_+	carbamoyltransferase HypF	NA	NA	NA	NA	NA
WP_004726118.1|1057391_1057649_+	HypC/HybG/HupF family hydrogenase formation chaperone	NA	NA	NA	NA	NA
WP_158165215.1|1057645_1058797_+	hydrogenase formation protein HypD	NA	NA	NA	NA	NA
WP_158166191.1|1058798_1059791_+	hydrogenase expression/formation protein HypE	NA	NA	NA	NA	NA
WP_004726115.1|1059799_1060141_+	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_158165216.1|1060142_1061282_+	hydrogenase nickel incorporation protein HypB	NA	NA	NA	NA	NA
WP_158165217.1|1061322_1061688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158165218.1|1061754_1063014_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_158165219.1|1063142_1064186_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_158165220.1|1064682_1065375_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_004726107.1|1065366_1066377_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
1066905:1066933	attL	AAAACCCGCTTTTTAGCGGGTTTTGTCGT	NA	NA	NA	NA
WP_158165221.1|1067000_1068887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075990070.1|1068915_1069023_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_075990071.1|1069058_1069346_-|tail	phage tail assembly protein	tail	R4JJY8	Burkholderia_phage	40.7	1.6e-06
WP_158166192.1|1069329_1070037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061055511.1|1070047_1070413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158165222.1|1070416_1071550_-|tail	phage tail protein	tail	C9DGP7	Escherichia_phage	38.7	2.6e-47
WP_020432118.1|1071546_1071729_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_158165223.1|1071729_1072266_-	virion morphogenesis protein	NA	NA	NA	NA	NA
WP_158146632.1|1072262_1072727_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_158125652.1|1072726_1073176_-|head	head completion/stabilization protein	head	NA	NA	NA	NA
WP_158165224.1|1073284_1074322_-|capsid	phage major capsid protein, P2 family	capsid	A0A0U4K5I9	Pseudomonas_phage	41.4	1.1e-63
WP_158165225.1|1074364_1075177_-|capsid	phage capsid protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	44.3	4.4e-20
WP_158165226.1|1075347_1077072_+|terminase	terminase	terminase	E5E3X0	Burkholderia_phage	41.6	2.5e-113
WP_158165227.1|1077082_1078039_+|portal	phage portal protein	portal	A0A0M3LS06	Mannheimia_phage	42.8	2.5e-59
WP_158165228.1|1078060_1078654_-	cell filamentation protein Fic	NA	S4TP71	Salmonella_phage	28.8	1.6e-08
WP_158165229.1|1078952_1079570_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	58.7	2.7e-22
WP_158165230.1|1079992_1080904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004726819.1|1081614_1081866_-	hypothetical protein	NA	A0A1D9C9R8	Salinivibrio_phage	45.2	1.2e-08
WP_004726817.1|1081856_1082087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158165231.1|1082097_1082514_-	glycoside hydrolase family protein	NA	A0A1Q1PW74	Pseudoalteromonas_phage	50.0	3.2e-27
WP_158165232.1|1082629_1083055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158165233.1|1084491_1085022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158165234.1|1085003_1086050_-	hypothetical protein	NA	A0A1E1GE19	Vibrio_phage	24.5	6.9e-10
WP_158165235.1|1086046_1086433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158165236.1|1086429_1087005_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_158165237.1|1086997_1087936_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_158165238.1|1087932_1089123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158165239.1|1089908_1090265_-	hypothetical protein	NA	A0A1S6KZW3	Salmonella_phage	38.9	2.9e-13
WP_004726797.1|1090513_1090765_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_158165240.1|1090774_1093405_-	replication endonuclease	NA	A0A166YHE2	Vibrio_phage	59.0	7.4e-295
WP_041943172.1|1093447_1093828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075990099.1|1093963_1094191_-	hypothetical protein	NA	U3PIK2	Vibrio_phage	73.3	6.6e-27
WP_158165241.1|1094172_1094640_-	DUF3850 domain-containing protein	NA	A0A0A8WI22	Clostridium_phage	38.6	8.9e-10
WP_047462999.1|1094636_1094933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004726788.1|1095005_1095338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004726786.1|1095347_1095887_-	phage regulatory CII family protein	NA	A0A2I7RNI1	Vibrio_phage	57.0	2.0e-53
WP_158165242.1|1095944_1096403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158165243.1|1096554_1097280_+	peptidase	NA	M4MB93	Vibrio_phage	28.4	2.4e-22
WP_158165244.1|1097281_1098259_+	HipA-like protein	NA	NA	NA	NA	NA
WP_158165245.1|1098255_1098999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158165246.1|1099165_1099666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158165247.1|1099699_1099846_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_158165248.1|1099812_1100643_-	DUF3825 domain-containing protein	NA	NA	NA	NA	NA
WP_158165249.1|1100787_1101753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061056067.1|1102065_1103034_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	49.7	6.0e-85
1103155:1103183	attR	AAAACCCGCTTTTTAGCGGGTTTTGTCGT	NA	NA	NA	NA
>prophage 4
NZ_CP046853	Vibrio furnissii strain 2012V-1225 chromosome 1, complete sequence	3296503	2146960	2153528	3296503		Staphylococcus_phage(66.67%)	7	NA	NA
WP_004724909.1|2146960_2147431_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.3	1.9e-31
WP_004724911.1|2147623_2148733_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.8	7.0e-61
WP_014204552.1|2148774_2149431_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.0	2.1e-33
WP_158165650.1|2149433_2150543_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	34.0	1.1e-42
WP_014204550.1|2150556_2151006_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_004724920.1|2151108_2152359_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.9	1.7e-95
WP_004724922.1|2152370_2153528_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.6	2.6e-66
>prophage 1
NZ_CP046852	Vibrio furnissii strain 2012V-1225 chromosome 2, complete sequence	1730402	311488	355384	1730402	head,tail,lysis,terminase,integrase	Vibrio_phage(39.58%)	65	300694:300708	330729:330743
300694:300708	attL	TTCATGATTTTACGA	NA	NA	NA	NA
WP_158164249.1|311488_312643_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	38.0	7.7e-63
WP_148497474.1|312632_312857_-	excisionase	NA	NA	NA	NA	NA
WP_158164250.1|312893_313565_-	hypothetical protein	NA	A0A1V0E8E6	Vibrio_phage	56.1	8.5e-70
WP_158164251.1|313612_313978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158164252.1|313964_314105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158164253.1|314150_315281_-	recombination-associated protein RdgC	NA	W6AT81	Vibrio_phage	46.3	1.7e-91
WP_158164254.1|315294_315654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158164255.1|315640_315883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158164256.1|315885_316311_-	hypothetical protein	NA	A0A1V0E8D7	Vibrio_phage	46.4	8.3e-31
WP_158164257.1|316307_316901_-	hypothetical protein	NA	K7R9L4	Vibrio_phage	59.7	1.8e-71
WP_158164258.1|316897_317326_-	hypothetical protein	NA	A0A2I7RTP4	Vibrio_phage	37.5	2.2e-10
WP_158164259.1|317322_318147_-	DNA adenine methylase	NA	A0A0K1LM14	Caulobacter_phage	47.4	2.0e-68
WP_158164260.1|318143_318794_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	46.4	7.2e-50
WP_158164261.1|318833_319043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158164262.1|319035_319200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158164263.1|319189_319792_-	3'-5' exonuclease	NA	I3PUZ1	Vibrio_phage	65.3	7.3e-73
WP_158164264.1|319831_320824_-	hypothetical protein	NA	A0A2I7RSX4	Vibrio_phage	38.0	3.9e-31
WP_158164265.1|320950_321874_-	hypothetical protein	NA	A0A191ZDG3	Pseudoalteromonas_virus	39.7	3.5e-50
WP_158164266.1|321885_322272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158164267.1|322406_322709_-	hypothetical protein	NA	A0A2I7QLM4	Vibrio_phage	72.5	7.5e-34
WP_158164268.1|323605_323869_+	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_158164269.1|323845_324025_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_158164270.1|324101_324248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158164271.1|324729_325407_+	hypothetical protein	NA	A0A1W6DWH5	Salmonella_phage	56.5	9.5e-61
WP_158164272.1|325454_326012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158164273.1|326034_326700_-	helix-turn-helix domain-containing protein	NA	Q37946	Enterobacteria_phage	57.6	5.3e-64
WP_158142205.1|326814_327024_+	helix-turn-helix domain-containing protein	NA	A0A0M4RTV8	Salmonella_phage	47.7	2.3e-10
WP_158164274.1|327036_327810_+	hypothetical protein	NA	A0A0M3LS90	Mannheimia_phage	31.6	8.1e-32
WP_158164848.1|327980_328532_+	ATP-binding protein	NA	A0A2I7QS85	Vibrio_phage	68.9	5.1e-73
WP_158164275.1|328544_328766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158164276.1|328773_329097_+	hypothetical protein	NA	A0A1I9KG94	Aeromonas_phage	43.0	3.1e-09
WP_158164277.1|329093_329294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158164278.1|329290_329563_+	hypothetical protein	NA	A0A2I7S8J3	Vibrio_phage	55.3	3.2e-20
WP_158164279.1|329555_330023_+	hypothetical protein	NA	A0A1V1FCN0	Vibrio_phage	53.5	1.8e-34
WP_158164280.1|330000_330462_+	DUF1367 family protein	NA	A0A0M3LR84	Mannheimia_phage	40.4	1.2e-27
WP_158164281.1|330711_331002_+	DUF1364 family protein	NA	A0A2I7QSH6	Vibrio_phage	58.0	2.7e-25
330729:330743	attR	TCGTAAAATCATGAA	NA	NA	NA	NA
WP_158164282.1|330998_331385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158164283.1|331567_331768_+	hypothetical protein	NA	A0A1V1FD92	Vibrio_phage	44.6	7.4e-06
WP_158164849.1|331826_332345_+	glycoside hydrolase family protein	NA	A0A1V0E844	Vibrio_phage	71.3	4.0e-67
WP_158164284.1|332406_332757_+|lysis	lysis protein	lysis	A0A1V0E843	Vibrio_phage	52.3	9.9e-22
WP_158164285.1|333245_333815_+|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	68.6	4.5e-64
WP_158164286.1|333801_335280_+	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	83.5	2.0e-244
WP_158164287.1|335509_336895_+	DUF1073 domain-containing protein	NA	I6R9A1	Salmonella_phage	60.9	3.3e-153
WP_158164288.1|336857_337799_+|head	phage head morphogenesis protein	head	H6WRT1	Salmonella_phage	55.0	1.3e-87
WP_158164850.1|337879_339145_+	hypothetical protein	NA	G0ZND7	Cronobacter_phage	70.5	3.1e-166
WP_158164289.1|339161_339590_+	hypothetical protein	NA	A0A1V0E5Q8	Salmonella_phage	61.3	2.0e-40
WP_158164290.1|339603_340674_+	hypothetical protein	NA	A0A1V0E5P6	Salmonella_phage	59.7	3.1e-122
WP_158164291.1|340685_340955_+	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	50.0	1.9e-12
WP_158164292.1|340998_341394_+	hypothetical protein	NA	J7HX89	Pseudomonas_phage	64.6	3.0e-43
WP_158164293.1|341393_341714_+	hypothetical protein	NA	J7I4I8	Pseudomonas_phage	67.0	5.9e-37
WP_158164294.1|341713_341983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158164851.1|342264_342822_+	hypothetical protein	NA	M4QC23	Vibrio_phage	68.3	8.0e-66
WP_158164295.1|342825_343263_+	hypothetical protein	NA	A0A125RNM8	Pseudomonas_phage	55.2	7.7e-40
WP_158164296.1|343255_343618_+	hypothetical protein	NA	J7I407	Pseudomonas_phage	45.5	3.1e-26
WP_158164297.1|343628_344366_+	Ig domain-containing protein	NA	A0A125RNN0	Pseudomonas_phage	67.8	2.1e-82
WP_158164298.1|344425_345031_+	glycoprotein	NA	H2BD90	Pseudomonas_phage	54.3	4.1e-55
WP_158164299.1|345098_345632_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_158164300.1|345692_347978_+	hypothetical protein	NA	J7HXG0	Pseudomonas_phage	51.2	5.5e-36
WP_158164301.1|347983_348340_+|tail	phage tail protein	tail	A0A0S2SYI2	Pseudomonas_phage	42.2	2.0e-17
WP_158164302.1|348336_349071_+|tail	phage minor tail protein L	tail	A0A2R3UA90	Siphoviridae_environmental_samples	51.9	5.4e-62
WP_158164303.1|349835_350396_+|tail	tail assembly protein	tail	C7BGD3	Burkholderia_phage	50.5	3.1e-41
WP_158164304.1|350392_352480_+	hypothetical protein	NA	Q3HQU5	Burkholderia_phage	50.0	1.5e-189
WP_158164305.1|352476_353847_+	DUF1983 domain-containing protein	NA	A0A1V0E886	Vibrio_phage	30.0	2.5e-44
WP_148497416.1|353849_354032_+	hypothetical protein	NA	A0A1U9GM54	Vibrio_phage	67.6	5.2e-06
WP_158164306.1|354013_355384_+	hypothetical protein	NA	R9TRI6	Vibrio_phage	34.8	1.1e-42
>prophage 2
NZ_CP046852	Vibrio furnissii strain 2012V-1225 chromosome 2, complete sequence	1730402	1406871	1414075	1730402		Escherichia_phage(66.67%)	7	NA	NA
WP_158164728.1|1406871_1408185_-	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.4	2.5e-17
WP_014257838.1|1408423_1409224_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	47.0	1.0e-53
WP_158164729.1|1409489_1410395_+	NAD-binding protein	NA	A0A077SLF7	Escherichia_phage	73.3	3.9e-110
WP_158164730.1|1410397_1411654_+	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	60.0	1.9e-131
WP_014257841.1|1411650_1412283_+	aldolase	NA	A0A077SK32	Escherichia_phage	62.1	4.0e-69
WP_158164731.1|1412282_1413059_+	TIM barrel protein	NA	NA	NA	NA	NA
WP_158164732.1|1413103_1414075_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A0G3FXV3	Raccoon_poxvirus	28.6	9.6e-06
