The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046851	Grimontia hollisae strain F9489 chromosome 1, complete sequence	3373500	662634	673302	3373500	tRNA	Tupanvirus(16.67%)	10	NA	NA
WP_158174671.1|662634_664563_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.7	4.4e-127
WP_040529049.1|664566_665112_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.2	8.2e-15
WP_005505546.1|665226_665421_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005505544.1|665463_665817_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005505542.1|666177_667161_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	39.3	1.2e-35
WP_005505540.1|667180_669571_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	22.7	4.7e-06
WP_005505538.1|669981_670278_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	2.1e-12
WP_005505537.1|670450_671500_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_040529048.1|671563_672550_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_114995136.1|672546_673302_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	1.0e-10
>prophage 2
NZ_CP046851	Grimontia hollisae strain F9489 chromosome 1, complete sequence	3373500	884140	932160	3373500	transposase,holin,tail,plate,head,integrase	Vibrio_phage(65.71%)	52	879274:879289	918386:918401
879274:879289	attL	CTTTGATCCCCGGAAT	NA	NA	NA	NA
WP_115659799.1|884140_885766_-|holin	glucose-methanol-choline oxidoreductase	holin	A0A1V0S9J5	Catovirus	34.9	2.9e-71
WP_114996376.1|885777_887391_-	long-chain fatty acid--CoA ligase	NA	Q75ZG1	Hepacivirus	29.7	4.9e-47
WP_040529005.1|889127_890162_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_104439948.1|890519_890711_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_005505206.1|890769_890979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158174726.1|891292_892561_+	autoinducer synthase	NA	NA	NA	NA	NA
WP_005505202.1|892553_895436_+	response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	37.2	3.2e-09
WP_040529002.1|895500_895839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158174727.1|896313_896760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115659803.1|896948_897629_-	XRE family transcriptional regulator	NA	A0A1C6ZDG7	Pseudomonas_phage	29.3	6.0e-23
WP_158174728.1|898106_900332_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0M4U788	Ralstonia_phage	31.2	2.6e-38
WP_115659805.1|900443_901175_+	ATP-binding protein	NA	M4SPU5	Rhodobacter_phage	28.9	2.3e-20
WP_158174729.1|901188_901800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158174730.1|901796_902366_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_158174731.1|902431_902665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158174732.1|902666_903278_+	DUF3164 family protein	NA	A0A2I7S9B0	Vibrio_phage	68.5	2.8e-72
WP_158174733.1|903287_903536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158174734.1|903593_903806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158174735.1|903805_904270_+	DUF1018 domain-containing protein	NA	A0A0C4UQU3	Shigella_phage	41.5	3.5e-22
WP_158174736.1|904391_904856_+	hypothetical protein	NA	G9L674	Escherichia_phage	37.1	2.8e-19
WP_158174737.1|904845_905889_+	protein kinase	NA	G9L673	Escherichia_phage	40.3	6.5e-69
WP_158174738.1|905922_906102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158174739.1|906211_906619_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_158174740.1|906786_907311_+	peptidoglycan-binding protein	NA	A0A2I7S9B9	Vibrio_phage	48.0	2.9e-41
WP_115659816.1|907929_908154_+	TraR/DksA family transcriptional regulator	NA	M4MHG5	Vibrio_phage	38.6	1.4e-08
WP_158174741.1|908153_908483_+	DUF2730 family protein	NA	M1Q558	Vibrio_phage	33.7	1.5e-08
WP_158174742.1|908479_908776_+	ArsR family transcriptional regulator	NA	A0A2I7S9D8	Vibrio_phage	61.1	2.8e-25
WP_158174743.1|908777_909356_+	DUF3486 family protein	NA	NA	NA	NA	NA
WP_158174744.1|909352_910939_+	hypothetical protein	NA	A0A2I7S9C5	Vibrio_phage	70.6	1.2e-194
WP_158174745.1|910948_912505_+	DUF935 family protein	NA	A0A2I7S9K0	Vibrio_phage	53.6	1.7e-150
WP_158174746.1|912497_913253_+	hypothetical protein	NA	M1PVV7	Vibrio_phage	59.0	9.8e-83
WP_158174747.1|913374_915021_-	UvrD-helicase domain-containing protein	NA	A0A1V0SAV1	Catovirus	27.0	1.6e-16
WP_158174748.1|915017_916937_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_158174749.1|917260_918223_+	peptidase	NA	M1Q578	Vibrio_phage	41.8	4.5e-64
WP_062715026.1|918229_919117_+|head	phage head protein	head	M4MB71	Vibrio_phage	63.7	1.1e-109
918386:918401	attR	ATTCCGGGGATCAAAG	NA	NA	NA	NA
WP_158174750.1|919190_919595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158174751.1|919598_920036_+	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	50.0	1.2e-27
WP_158174752.1|920035_920578_+	phage virion morphogenesis protein	NA	A0A2I7S9D7	Vibrio_phage	58.7	9.0e-54
WP_158174753.1|920574_921186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158174754.1|921182_921377_+	DUF2635 domain-containing protein	NA	A0A2I7S9K4	Vibrio_phage	41.0	1.6e-05
WP_158175225.1|921367_922846_+|tail	phage tail protein	tail	M1Q565	Vibrio_phage	53.3	2.3e-144
WP_158174755.1|922858_923212_+|tail	phage tail protein	tail	A0A2I7S9D5	Vibrio_phage	43.5	1.0e-21
WP_158174756.1|923224_923617_+	hypothetical protein	NA	C9DGP9	Escherichia_phage	45.8	4.8e-17
WP_158174757.1|923727_925503_+	hypothetical protein	NA	A0A2P9JZK0	Alteromonadaceae_phage	38.4	5.7e-81
WP_158174758.1|925512_926712_+	hypothetical protein	NA	A0A2I7S9E8	Vibrio_phage	31.5	7.5e-53
WP_158174759.1|926704_927754_+|tail	phage tail protein	tail	A0A2I7S9G1	Vibrio_phage	45.9	3.8e-85
WP_158174760.1|927747_928338_+|plate	phage baseplate assembly protein V	plate	A0A2I7S9F6	Vibrio_phage	42.4	7.5e-22
WP_158174761.1|928334_928793_+	hypothetical protein	NA	M4MB61	Vibrio_phage	45.5	1.8e-23
WP_158174762.1|928782_929862_+|plate	phage baseplate protein	plate	A0A2I7S9E5	Vibrio_phage	49.3	1.7e-88
WP_158174763.1|929849_930407_+	DUF2313 domain-containing protein	NA	A0A2I7S9L6	Vibrio_phage	48.7	8.6e-44
WP_158174764.1|930406_931147_+	hypothetical protein	NA	A0A2I7S9H6	Vibrio_phage	51.3	4.4e-27
WP_158174765.1|931146_932160_+	DUF4376 domain-containing protein	NA	A0A2I7RWL2	Vibrio_phage	46.2	2.0e-38
>prophage 3
NZ_CP046851	Grimontia hollisae strain F9489 chromosome 1, complete sequence	3373500	1234764	1282784	3373500	portal,transposase,bacteriocin,integrase,terminase,capsid	Aeromonas_phage(33.33%)	45	1233138:1233197	1240816:1240995
1233138:1233197	attL	ATTTACCTGACACGAGGCTGGACAATTTCGAGTTAGGAATTGTGTTCGTAACTGTCGAGT	NA	NA	NA	NA
WP_104439922.1|1234764_1235418_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	58.4	2.7e-52
WP_158174819.1|1235783_1235975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158174820.1|1237600_1239235_-	phosphoethanolamine--lipid A transferase	NA	NA	NA	NA	NA
WP_158174821.1|1239235_1239595_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_158174822.1|1239883_1240408_-	cytochrome B	NA	NA	NA	NA	NA
WP_158174823.1|1240400_1240685_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_158174824.1|1241435_1241972_-	hypothetical protein	NA	NA	NA	NA	NA
1240816:1240995	attR	ATTTACCTGACACGAGGCTGGACAATTTCGAGTTAGGAATTGTGTTCGTAACTGTCGAGTTCGGATTGTTTCAGATAGGGAAAACCGAAGTAAACGACTTTGTAGTTCTGGGGCATTGGCTGCTGACGCTGCCAAGAGAAGGCTATTGTCTATTGACCGGAGAAGGGCTCATATGTGTTA	NA	NA	NA	NA
WP_154124098.1|1242586_1242874_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_005500649.1|1242866_1243109_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_158174825.1|1244124_1245282_+	molecular chaperone	NA	NA	NA	NA	NA
WP_114995772.1|1246360_1246663_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_005503215.1|1246650_1246908_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_158174826.1|1247294_1255226_-	PLxRFG domain-containing protein	NA	M4M9L8	Vibrio_phage	37.7	8.8e-166
WP_158161002.1|1255249_1256572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158161000.1|1256581_1256821_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_158160999.1|1256831_1257203_-	hypothetical protein	NA	A0A2L1IV89	Escherichia_phage	44.5	5.6e-15
WP_158174827.1|1257212_1257869_-	hypothetical protein	NA	A0A1I9KFE8	Aeromonas_phage	44.0	8.3e-38
WP_158162297.1|1257879_1258281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158160997.1|1258282_1258630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158174828.1|1258633_1260388_-	DUF1983 domain-containing protein	NA	A0A0H4IPM2	Shigella_phage	31.0	3.9e-42
WP_158160995.1|1260389_1262003_-	hypothetical protein	NA	A0A1I9KFD2	Aeromonas_phage	46.9	5.1e-129
WP_158174829.1|1261996_1262275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158174830.1|1262280_1262589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158174831.1|1262585_1263206_-	hypothetical protein	NA	A0A1B1ITG1	uncultured_Mediterranean_phage	31.2	1.4e-15
WP_158160993.1|1263205_1263808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158160992.1|1263807_1264248_-	hypothetical protein	NA	A0A1I9KFH0	Aeromonas_phage	45.7	2.5e-14
WP_158174832.1|1264278_1264662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158160989.1|1264707_1265922_-|capsid	N4-gp56 family major capsid protein	capsid	A0A088CC32	Shigella_phage	58.8	2.4e-139
WP_158160987.1|1265986_1266928_-	hypothetical protein	NA	A0A1I9KFD1	Aeromonas_phage	30.4	2.6e-24
WP_158174833.1|1267024_1269646_-	hypothetical protein	NA	A0A2I7QSB0	Vibrio_phage	36.3	5.2e-139
WP_158162295.1|1269647_1270010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158174834.1|1270019_1272089_-|portal	portal protein	portal	A0A1U9AJF2	Stx1_converting_phage	57.4	2.8e-204
WP_158160983.1|1272089_1273754_-|terminase	terminase	terminase	A0A1I9KFB6	Aeromonas_phage	72.6	1.3e-247
WP_158160982.1|1273769_1274519_-	hypothetical protein	NA	A0A1I9KFG9	Aeromonas_phage	35.4	1.0e-31
WP_158160980.1|1274696_1274879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158160978.1|1274881_1275286_-	hypothetical protein	NA	A0A2I7R6R1	Vibrio_phage	37.7	2.0e-13
WP_158160976.1|1275285_1275765_-	M15 family peptidase	NA	A0A2D1GMU0	Marinobacter_phage	47.4	7.2e-31
WP_158174835.1|1276804_1277434_+	recombinase family protein	NA	NA	NA	NA	NA
WP_158174836.1|1277444_1277789_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_158174837.1|1277800_1278049_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_158174838.1|1278679_1279234_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_115659927.1|1279519_1279903_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_158174839.1|1280484_1280679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158174840.1|1280681_1281539_+	hypothetical protein	NA	I6PD67	Cronobacter_phage	29.2	6.9e-24
WP_158161006.1|1281575_1282784_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.0	2.4e-75
>prophage 4
NZ_CP046851	Grimontia hollisae strain F9489 chromosome 1, complete sequence	3373500	1292752	1301467	3373500	integrase	Enterobacteria_phage(22.22%)	14	1279810:1279824	1302997:1303011
1279810:1279824	attL	CTTTATTGGTATCTA	NA	NA	NA	NA
WP_158162291.1|1292752_1293079_-	DUF1364 family protein	NA	A0A2I7RNU4	Vibrio_phage	44.9	6.6e-20
WP_158160965.1|1293081_1293669_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	44.1	1.4e-44
WP_158160963.1|1293784_1294117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158160961.1|1294129_1294756_-	hypothetical protein	NA	Q3HQZ7	Burkholderia_phage	38.2	1.1e-34
WP_158174844.1|1294761_1295502_-	hypothetical protein	NA	A0A1W6JNM1	Staphylococcus_phage	49.3	2.0e-11
WP_158174845.1|1295841_1296234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158174846.1|1296202_1296490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158175228.1|1296609_1297281_+	helix-turn-helix domain-containing protein	NA	Q37946	Enterobacteria_phage	29.4	5.2e-11
WP_158160954.1|1297479_1297854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158160952.1|1297858_1298800_+	hypothetical protein	NA	A0A192Y5Z5	Salmonella_phage	50.9	7.5e-40
WP_158174847.1|1298805_1299798_+	hypothetical protein	NA	A0A1B0VN89	Pseudomonas_phage	26.9	1.8e-07
WP_158174848.1|1299857_1300265_+	hypothetical protein	NA	A0A2L1IV39	Escherichia_phage	46.7	9.8e-13
WP_158160946.1|1300236_1300464_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_158162287.1|1300492_1301467_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	58.5	1.7e-103
1302997:1303011	attR	CTTTATTGGTATCTA	NA	NA	NA	NA
>prophage 5
NZ_CP046851	Grimontia hollisae strain F9489 chromosome 1, complete sequence	3373500	2233962	2289342	3373500	portal,tail,head,integrase,terminase,tRNA,capsid	Salinivibrio_phage(51.43%)	61	2245548:2245588	2282497:2282537
WP_158174995.1|2233962_2234970_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_002542007.1|2234992_2235289_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_005501102.1|2235424_2235703_-	pyrimidine/purine nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_158174996.1|2235874_2236291_-	Zn(2+)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_158174997.1|2236471_2238082_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.4	4.4e-72
WP_158174998.1|2238135_2239425_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_158174999.1|2239453_2240170_-	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
WP_002542017.1|2240212_2240485_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	62.2	4.5e-22
WP_158175000.1|2240720_2241899_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_005501119.1|2241958_2242546_-	DUF416 family protein	NA	NA	NA	NA	NA
WP_158175001.1|2242639_2243545_+	D-2-hydroxyacid dehydrogenase	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	28.1	6.0e-10
WP_158175238.1|2243565_2244129_+	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_114996047.1|2244308_2245373_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
2245548:2245588	attL	ATAATCGCATCTTACCCGCCTCCCTACGGCGGGCTTTTTTT	NA	NA	NA	NA
WP_114996048.1|2245743_2246784_-|integrase	tyrosine-type recombinase/integrase	integrase	U3PIJ4	Vibrio_phage	47.4	7.2e-84
WP_158175002.1|2246951_2247221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158175003.1|2247217_2247820_-	transcriptional regulator	NA	A0A1D9C9M6	Salinivibrio_phage	42.4	1.8e-39
WP_005501125.1|2248030_2248231_+	hypothetical protein	NA	P79674	Haemophilus_phage	47.3	5.1e-07
WP_158175004.1|2248344_2248884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158175005.1|2248896_2249268_+	hypothetical protein	NA	U3PDF0	Vibrio_phage	38.4	1.8e-13
WP_158175006.1|2249330_2249609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158175007.1|2249605_2249797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158175008.1|2249909_2250389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158175009.1|2250385_2250616_+	hypothetical protein	NA	A0A2I7RNG5	Vibrio_phage	50.0	3.5e-15
WP_158175010.1|2250612_2253147_+	replication endonuclease	NA	A0A1D9C9P3	Salinivibrio_phage	54.5	2.0e-228
WP_158175011.1|2253508_2253955_-	transcriptional regulator	NA	A0A1D9C9Q3	Salinivibrio_phage	51.7	1.7e-34
WP_158175012.1|2254613_2255270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158175239.1|2255256_2256240_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_158175013.1|2257380_2258037_+	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	54.9	1.4e-53
WP_158175014.1|2258239_2258737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158175015.1|2258856_2259357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158175016.1|2259368_2260814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158175017.1|2261239_2262280_-|portal	phage portal protein	portal	A0A1D9C9P9	Salinivibrio_phage	66.6	2.9e-133
WP_158175018.1|2262282_2264070_-|terminase	terminase	terminase	A0A1D9C9R1	Salinivibrio_phage	73.5	1.0e-239
WP_158175019.1|2264247_2265162_+|capsid	capsid protein	capsid	A0A1D9CA10	Salinivibrio_phage	56.4	1.2e-82
WP_158175020.1|2265162_2266155_+|capsid	phage major capsid protein, P2 family	capsid	R9TPZ5	Vibrio_phage	61.6	4.0e-116
WP_158175021.1|2266165_2266888_+|terminase	terminase	terminase	A0A2I7RNJ0	Vibrio_phage	50.0	6.5e-60
WP_158175022.1|2266996_2267404_+|head	head completion/stabilization protein	head	A0A1D9C9U4	Salinivibrio_phage	63.7	4.7e-39
WP_158175023.1|2267403_2267889_+|tail	phage tail protein	tail	A0A2I7RNH2	Vibrio_phage	57.3	3.3e-47
WP_158161704.1|2267872_2268535_+	virion morphogenesis protein	NA	A0A1D9C9S1	Salinivibrio_phage	68.6	1.9e-77
WP_158175024.1|2268537_2269653_+	DUF2586 family protein	NA	A0A1D9C9S8	Salinivibrio_phage	70.9	4.6e-153
WP_005501151.1|2269656_2270106_+	DUF2597 family protein	NA	A0A1D9C9S0	Salinivibrio_phage	67.8	7.4e-54
WP_158175025.1|2270335_2270758_+	hypothetical protein	NA	M4M9N1	Vibrio_phage	59.0	5.5e-43
WP_158175026.1|2270762_2271287_+	hypothetical protein	NA	A0A1L5C2C2	Pseudoalteromonas_phage	38.1	1.6e-23
WP_158175027.1|2271287_2271563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158175028.1|2271559_2271826_+	hypothetical protein	NA	A0A1D9C9R9	Salinivibrio_phage	60.5	5.8e-22
WP_158175029.1|2272014_2273904_+|tail	phage tail tape measure protein	tail	A0A2I7RNI7	Vibrio_phage	67.5	6.4e-232
WP_158175030.1|2273900_2274233_+	DUF2590 family protein	NA	A0A1D9C9T2	Salinivibrio_phage	72.2	1.1e-38
WP_158175031.1|2274225_2275410_+	hypothetical protein	NA	A0A1D9C9S2	Salinivibrio_phage	58.7	3.2e-136
WP_158175032.1|2275413_2276034_+	hypothetical protein	NA	A0A1D9C9U8	Salinivibrio_phage	67.3	4.3e-76
WP_158175033.1|2276053_2277418_+	hypothetical protein	NA	A0A1D9C9T0	Salinivibrio_phage	69.4	2.0e-110
WP_158175034.1|2277414_2277966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158175035.1|2277966_2278506_+	adenine glycosylase	NA	A0A1D9C9T7	Salinivibrio_phage	59.7	8.9e-46
WP_158175036.1|2278502_2279189_+	hypothetical protein	NA	A0A1D9CA29	Salinivibrio_phage	60.8	1.4e-83
WP_158175037.1|2279179_2279914_+	hypothetical protein	NA	A0A1D9C9S3	Salinivibrio_phage	71.8	1.4e-97
WP_050778517.1|2280880_2281456_+	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_005501186.1|2281445_2282198_+	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	29.2	6.3e-05
WP_005501187.1|2282206_2282416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005501189.1|2282542_2283313_-	NAD(+) diphosphatase	NA	NA	NA	NA	NA
2282497:2282537	attR	ATAATCGCATCTTACCCGCCTCCCTACGGCGGGCTTTTTTT	NA	NA	NA	NA
WP_158175038.1|2283455_2283935_+	sigma D regulator	NA	NA	NA	NA	NA
WP_005501193.1|2284202_2284934_-	nicotinamide riboside transporter PnuC	NA	A0A2I7SAC7	Vibrio_phage	26.2	6.3e-18
WP_005501195.1|2285127_2289342_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	1.2e-65
>prophage 6
NZ_CP046851	Grimontia hollisae strain F9489 chromosome 1, complete sequence	3373500	3038106	3049096	3373500	tRNA	uncultured_Mediterranean_phage(33.33%)	8	NA	NA
WP_005501877.1|3038106_3038856_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.5	4.2e-70
WP_005501875.1|3038866_3039487_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	47.0	2.5e-36
WP_114996138.1|3039497_3040466_+	murein hydrolase activator NlpD	NA	NA	NA	NA	NA
WP_158175144.1|3040520_3041489_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.6	1.5e-35
WP_158175145.1|3041571_3044142_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	25.7	2.7e-31
WP_005501867.1|3044865_3045909_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	62.2	3.5e-115
WP_005501866.1|3045932_3046358_+	regulatory protein RecX	NA	NA	NA	NA	NA
WP_114996136.1|3046513_3049096_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.9	1.3e-78
>prophage 7
NZ_CP046851	Grimontia hollisae strain F9489 chromosome 1, complete sequence	3373500	3299316	3335351	3373500	portal,tail,head,integrase,terminase,capsid	Salinivibrio_phage(46.88%)	42	3302721:3302736	3336037:3336052
WP_005506716.1|3299316_3301044_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	26.0	1.3e-18
WP_005506715.1|3301098_3301356_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_005506714.1|3301674_3302643_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	52.4	7.6e-72
3302721:3302736	attL	AGTTATATCTTATTGT	NA	NA	NA	NA
WP_115659486.1|3302857_3303883_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S6L016	Salmonella_phage	51.3	7.5e-94
WP_158175177.1|3303972_3304662_-	transcriptional regulator	NA	A0A1D9C9M6	Salinivibrio_phage	36.9	5.2e-30
WP_114994845.1|3304789_3305011_+	helix-turn-helix domain-containing protein	NA	R9TMQ7	Vibrio_phage	51.4	4.2e-10
WP_005501126.1|3305124_3305664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114996051.1|3305675_3306047_+	hypothetical protein	NA	U3PDF0	Vibrio_phage	36.2	5.8e-12
WP_005501128.1|3306108_3306387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005501129.1|3306383_3306614_+	hypothetical protein	NA	A0A2I7RNG5	Vibrio_phage	48.7	1.3e-14
WP_158175178.1|3306610_3308914_+	hypothetical protein	NA	A0A2I7RNF8	Vibrio_phage	30.5	1.7e-40
WP_158175179.1|3308916_3309513_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	53.8	1.6e-43
WP_158175180.1|3309888_3310335_-	transcriptional regulator	NA	A0A1D9C9Q3	Salinivibrio_phage	52.3	1.0e-34
WP_158175181.1|3310873_3311281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158175182.1|3311258_3312101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158175244.1|3312310_3313318_+	DNA-processing protein DprA	NA	NA	NA	NA	NA
WP_158175183.1|3313329_3314577_+	phosphoribosyl transferase	NA	NA	NA	NA	NA
WP_158175245.1|3314958_3316545_-	funZ protein	NA	P79669	Escherichia_phage	52.1	6.7e-158
WP_158175184.1|3316754_3317795_-|portal	phage portal protein	portal	A0A1D9C9P9	Salinivibrio_phage	62.8	1.0e-122
WP_158175185.1|3317797_3319585_-|terminase	terminase	terminase	A0A1D9C9R1	Salinivibrio_phage	69.2	2.6e-235
WP_158175186.1|3319763_3320606_+|capsid	phage capsid protein	capsid	A0A2I7RNH1	Vibrio_phage	41.8	5.5e-34
WP_158175187.1|3320606_3321599_+|capsid	phage major capsid protein, P2 family	capsid	R9TPZ5	Vibrio_phage	61.3	8.8e-116
WP_158175188.1|3321609_3322332_+|terminase	terminase	terminase	A0A2I7RNJ0	Vibrio_phage	50.2	1.7e-60
WP_158175189.1|3322436_3322844_+|head	head completion/stabilization protein	head	A0A1D9C9U4	Salinivibrio_phage	64.4	4.7e-39
WP_158175190.1|3322843_3323329_+|tail	phage tail protein	tail	A0A2I7RNH2	Vibrio_phage	58.0	1.0e-48
WP_158175191.1|3323312_3323975_+	virion morphogenesis protein	NA	A0A1D9C9S1	Salinivibrio_phage	67.3	2.4e-77
WP_158175192.1|3323977_3325093_+	DUF2586 family protein	NA	A0A1D9C9S8	Salinivibrio_phage	70.1	2.5e-151
WP_158175193.1|3325096_3325546_+	DUF2597 family protein	NA	A0A1D9C9S0	Salinivibrio_phage	67.8	9.7e-54
WP_158175194.1|3325551_3325779_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_158175195.1|3325775_3326198_+	hypothetical protein	NA	M4M9N1	Vibrio_phage	59.7	1.5e-43
WP_158175196.1|3326202_3326727_+	hypothetical protein	NA	A0A1L5C2C2	Pseudoalteromonas_phage	39.3	1.1e-24
WP_005501161.1|3326727_3327003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104439913.1|3326996_3327266_+	hypothetical protein	NA	A0A1D9C9R9	Salinivibrio_phage	59.6	9.0e-23
WP_158175197.1|3327454_3329341_+|tail	phage tail tape measure protein	tail	A0A2I7RNI7	Vibrio_phage	67.9	9.9e-233
WP_158175198.1|3329337_3329670_+	DUF2590 family protein	NA	A0A1D9C9T2	Salinivibrio_phage	72.2	8.5e-39
WP_158175199.1|3329662_3330847_+	hypothetical protein	NA	A0A1D9C9S2	Salinivibrio_phage	58.4	7.0e-136
WP_158175200.1|3330850_3331471_+	hypothetical protein	NA	A0A1D9C9U8	Salinivibrio_phage	66.3	8.1e-75
WP_158175201.1|3331490_3332855_+	hypothetical protein	NA	A0A1D9C9T0	Salinivibrio_phage	69.0	5.8e-110
WP_158175202.1|3332851_3333403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158175203.1|3333403_3333943_+	adenine glycosylase	NA	A0A2I7RNK5	Vibrio_phage	58.0	4.7e-39
WP_158175204.1|3333939_3334626_+	hypothetical protein	NA	A0A1D9CA29	Salinivibrio_phage	60.8	5.6e-85
WP_158175205.1|3334616_3335351_+	hypothetical protein	NA	A0A1D9C9S3	Salinivibrio_phage	73.1	1.9e-99
3336037:3336052	attR	AGTTATATCTTATTGT	NA	NA	NA	NA
