The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046822	Vibrio metschnikovii strain 07-2421 chromosome 1, complete sequence	2928756	685048	737004	2928756	protease,tRNA,integrase,transposase	Bacillus_phage(33.33%)	43	718607:718625	738678:738696
WP_154169244.1|685048_685768_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_154169242.1|685959_686880_+	glutaminase B	NA	NA	NA	NA	NA
WP_154169240.1|686936_688106_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_158137781.1|688099_688705_-	XTP/dITP diphosphatase	NA	A0A2H4V8Y9	Ugandan_cassava_brown_streak_virus	30.8	3.8e-13
WP_004396060.1|688797_689091_-	YggU family protein	NA	NA	NA	NA	NA
WP_040904707.1|689090_689648_-	YggT family protein	NA	NA	NA	NA	NA
WP_004396058.1|689700_690519_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_154169238.1|690601_691318_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_154169236.1|691344_692382_+	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_154169234.1|692392_693499_+	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_004396054.1|693501_693927_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_040904706.1|693987_694551_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_158137782.1|694590_695547_-	glutathione synthase	NA	NA	NA	NA	NA
WP_154169232.1|695561_696293_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_158139010.1|696593_697289_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_158137784.1|697392_697881_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_154169230.1|697974_699129_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	60.5	1.6e-124
WP_154169228.1|699573_701568_+	transketolase	NA	NA	NA	NA	NA
WP_154169226.1|701642_702545_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158137786.1|702687_704643_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	33.3	3.1e-11
WP_154170701.1|704769_705795_+	erythrose-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_158137788.1|705942_707106_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_004396043.1|707258_708335_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_154169222.1|708549_709413_+	small-conductance mechanosensitive channel MscS	NA	NA	NA	NA	NA
WP_154169220.1|709490_710120_-	LysE family transporter	NA	NA	NA	NA	NA
WP_158137790.1|710240_711137_+	ArgP/LysG family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_158137792.1|711277_711976_+	oxidative stress defense protein	NA	NA	NA	NA	NA
WP_158137794.1|712103_713945_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.7	1.2e-17
WP_004396037.1|714051_715464_-	pyruvate kinase PykF	NA	NA	NA	NA	NA
WP_040904702.1|715893_716655_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_154169213.1|716738_718571_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7J689	Paramecium_bursaria_Chlorella_virus	43.6	4.6e-126
718607:718625	attL	GAATAAAGTTTCATACTAA	NA	NA	NA	NA
WP_107947007.1|718825_719785_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	39.6	1.4e-54
WP_158137123.1|720263_721386_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.8	1.9e-26
WP_016898901.1|721701_722391_+	VIT family protein	NA	NA	NA	NA	NA
WP_058799734.1|722519_723866_-	group II intron reverse transcriptase/maturase	NA	A0A0N7ACI1	Bacillus_phage	26.3	1.5e-17
WP_158139011.1|725397_726990_+	phosphoethanolamine--lipid A transferase	NA	NA	NA	NA	NA
WP_158137796.1|727013_727388_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_158137798.1|728677_729352_+	response regulator	NA	W8CYM9	Bacillus_phage	32.6	6.4e-25
WP_158137799.1|729351_730611_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_158137801.1|730920_731751_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_158137803.1|731734_733825_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_158137804.1|733821_735459_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_158137806.1|735459_737004_+|transposase	transposase	transposase	NA	NA	NA	NA
738678:738696	attR	TTAGTATGAAACTTTATTC	NA	NA	NA	NA
>prophage 2
NZ_CP046822	Vibrio metschnikovii strain 07-2421 chromosome 1, complete sequence	2928756	767801	774902	2928756		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_154169165.1|767801_768557_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.6	3.2e-65
WP_004395999.1|768560_769187_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	50.9	1.7e-35
WP_158137827.1|769186_770155_+	murein hydrolase activator NlpD	NA	Q8SBN9	Clostridium_phage	35.5	1.2e-11
WP_154169163.1|770227_771205_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.3	2.6e-35
WP_158137829.1|771267_773850_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	23.6	4.2e-32
WP_158137831.1|774011_774902_-	cysteine synthase CysM	NA	C3U2M1	Lactococcus_phage	39.1	1.7e-49
>prophage 3
NZ_CP046822	Vibrio metschnikovii strain 07-2421 chromosome 1, complete sequence	2928756	2069110	2117526	2928756	protease,transposase,portal,integrase,lysis,head,terminase,tail,capsid	Vibrio_phage(88.33%)	71	2068393:2068442	2117656:2117705
2068393:2068442	attL	GTCATGGGGTGTCGGGGGTCGGAGGTTCAAATCCTCTCAGTCCGACCAAA	NA	NA	NA	NA
WP_158138641.1|2069110_2070046_-	hypothetical protein	NA	A0A1V0E875	Vibrio_phage	40.2	3.6e-10
WP_158138642.1|2070038_2070194_-	hypothetical protein	NA	A0A1V0E896	Vibrio_phage	68.5	3.7e-13
WP_158138643.1|2070235_2071339_-	hypothetical protein	NA	A0A1V0E897	Vibrio_phage	59.0	5.2e-125
WP_158138644.1|2071335_2074866_-	DUF1983 domain-containing protein	NA	A0A1V0E886	Vibrio_phage	78.8	0.0e+00
WP_158138645.1|2074884_2075490_-|tail	tail assembly protein	tail	A0A1V0E8A0	Vibrio_phage	71.6	4.3e-73
WP_158138646.1|2075633_2076518_+|transposase	transposase	transposase	A0A0R6PHP9	Moraxella_phage	41.6	5.2e-51
WP_158138647.1|2076526_2077042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158138648.1|2077071_2077803_-	peptidase P60	NA	A0A1V1FD38	Vibrio_phage	71.5	1.3e-108
WP_158138649.1|2077805_2078552_-|tail	phage minor tail protein L	tail	A0A1V1FDP3	Vibrio_phage	83.5	1.1e-123
WP_158138650.1|2078562_2078901_-|tail	phage tail protein	tail	A0A1V1FDP8	Vibrio_phage	83.0	5.8e-51
WP_158138651.1|2078904_2081760_-|tail	phage tail tape measure protein	tail	A0A1V0E8B0	Vibrio_phage	60.1	6.8e-286
WP_158138652.1|2081802_2081964_-	hypothetical protein	NA	A0A1V0E8A9	Vibrio_phage	64.2	3.6e-11
WP_158138653.1|2082056_2082500_-	hypothetical protein	NA	A0A1V0E823	Vibrio_phage	81.0	1.8e-60
WP_158138654.1|2082510_2082987_-|tail	phage tail protein	tail	A0A1V0E8B3	Vibrio_phage	91.8	8.3e-80
WP_158138655.1|2083092_2083461_-	DUF3168 domain-containing protein	NA	A0A1V0E8A7	Vibrio_phage	78.7	4.6e-54
WP_158138656.1|2083457_2083922_-	hypothetical protein	NA	A0A1V0E895	Vibrio_phage	75.7	5.5e-60
WP_158138657.1|2083951_2084314_-|head,tail	head-tail adaptor protein	head,tail	A0A1V0E8B6	Vibrio_phage	63.6	1.9e-39
WP_158138658.1|2084313_2084607_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1V0E887	Vibrio_phage	66.7	6.1e-33
WP_158138659.1|2084624_2084891_-	hypothetical protein	NA	A0A1V0E889	Vibrio_phage	58.0	4.4e-06
WP_158138660.1|2084962_2086150_-|capsid	phage major capsid protein	capsid	A0A1V0E898	Vibrio_phage	81.0	2.1e-156
WP_158138661.1|2086154_2087027_-|protease	Clp protease ClpP	protease	A0A1V0E8B8	Vibrio_phage	82.8	1.7e-134
WP_158138662.1|2087029_2088337_-|portal	phage portal protein	portal	A0A1V0E8B9	Vibrio_phage	83.0	3.0e-212
WP_158138663.1|2088533_2090252_-|terminase	terminase large subunit	terminase	A0A1V0E8C2	Vibrio_phage	91.6	0.0e+00
WP_158138664.1|2090248_2090722_-|terminase	phage terminase small subunit P27 family	terminase	A0A1V0E8B7	Vibrio_phage	84.7	8.0e-75
WP_158138665.1|2090727_2091087_-	HNH endonuclease	NA	A0A1V0E8A5	Vibrio_phage	75.6	1.1e-47
WP_158138666.1|2091086_2091419_-	hypothetical protein	NA	A0A1V0E8K3	Vibrio_phage	61.7	3.1e-25
WP_158138667.1|2091694_2091898_-	hypothetical protein	NA	A0A1V0E8A4	Vibrio_phage	48.6	1.3e-10
WP_158138668.1|2092443_2092686_-	hypothetical protein	NA	A0A2I7QYY5	Vibrio_phage	62.5	5.8e-21
WP_072669746.1|2092692_2093187_-|lysis	lysis protein	lysis	A0A1V1FD30	Vibrio_phage	40.7	2.0e-20
WP_158138669.1|2093200_2093680_-	glycoside hydrolase family protein	NA	A0A1U9GSH3	Vibrio_phage	81.6	1.6e-70
WP_072669748.1|2093672_2093858_-	hypothetical protein	NA	A0A1V1FD92	Vibrio_phage	60.7	1.5e-13
WP_158138670.1|2093988_2094657_-	hypothetical protein	NA	A0A1U9GXP4	Vibrio_phage	73.5	2.6e-87
WP_158138671.1|2094856_2095219_+	helix-turn-helix domain-containing protein	NA	L7TKV7	Pseudomonas_virus	50.9	6.0e-22
WP_158138672.1|2095222_2095690_+	toxin	NA	NA	NA	NA	NA
WP_158138673.1|2096196_2096700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158138674.1|2096776_2097787_-	DUF968 domain-containing protein	NA	A0A1U9GXE8	Vibrio_phage	74.4	7.5e-155
WP_158139052.1|2097780_2098038_-	DUF4406 domain-containing protein	NA	A0A1U9GY09	Vibrio_phage	82.4	1.3e-39
WP_158138675.1|2098074_2098326_-	hypothetical protein	NA	A0A1V0E827	Vibrio_phage	57.3	2.8e-18
WP_158138676.1|2098322_2098826_-	hypothetical protein	NA	A0A1V0E852	Vibrio_phage	71.9	1.7e-59
WP_158138677.1|2098818_2099145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158138678.1|2099144_2099351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158138679.1|2099526_2100243_-	DNA-binding protein	NA	A0A1V1FD44	Vibrio_phage	84.8	2.4e-107
WP_158138680.1|2100417_2101110_-	hypothetical protein	NA	B5WZY0	Pseudomonas_phage	33.5	2.9e-25
WP_158138681.1|2101093_2101924_-	hypothetical protein	NA	A0A1V0E831	Vibrio_phage	70.2	5.7e-84
WP_158138682.1|2101920_2102205_-	hypothetical protein	NA	A0A1V0E8C9	Vibrio_phage	57.1	3.6e-22
WP_158138683.1|2102205_2102844_-	hypothetical protein	NA	A0A067ZG73	Vibrio_phage	50.7	6.4e-59
WP_158138684.1|2102983_2103229_-	hypothetical protein	NA	A0A1V0E8D3	Vibrio_phage	73.8	6.1e-26
WP_158138685.1|2103231_2103684_-	hypothetical protein	NA	R9TRN6	Vibrio_phage	65.4	1.5e-41
WP_158138686.1|2103975_2104761_+	helix-turn-helix domain-containing protein	NA	R9TNM0	Vibrio_phage	69.8	1.5e-86
WP_158138687.1|2104793_2105348_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	35.1	8.7e-20
WP_158138688.1|2106536_2106986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158138689.1|2107694_2108090_+	hypothetical protein	NA	R9TMP0	Vibrio_phage	84.7	1.1e-56
WP_158138690.1|2108150_2108975_+	DUF2303 family protein	NA	R9TRN9	Vibrio_phage	65.6	8.7e-101
WP_158138691.1|2109038_2109770_+	hypothetical protein	NA	A0A1V0E8E0	Vibrio_phage	35.7	2.4e-17
WP_158139053.1|2109784_2109994_+	hypothetical protein	NA	A0A1V0E8D5	Vibrio_phage	68.1	3.2e-20
WP_158138692.1|2110011_2110227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158138693.1|2110323_2110902_+	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	43.8	3.6e-37
WP_158138694.1|2110901_2111162_+	hypothetical protein	NA	A0A1V0E8E7	Vibrio_phage	53.1	3.3e-14
WP_158138695.1|2111170_2111527_+	hypothetical protein	NA	I3PV00	Vibrio_phage	60.4	1.6e-30
WP_158138696.1|2111564_2111798_+	hypothetical protein	NA	A0A1V0E8D1	Vibrio_phage	54.5	2.0e-10
WP_158138697.1|2111797_2112592_+	HNH endonuclease	NA	A0A1S5SAF6	Streptococcus_phage	38.4	1.2e-35
WP_158138698.1|2112566_2113244_+	hypothetical protein	NA	I7KQS5	Yersinia_phage	48.5	1.9e-08
WP_158138699.1|2113253_2113523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158138700.1|2113552_2113990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158138701.1|2113986_2114424_+	hypothetical protein	NA	A0A1V0E8D7	Vibrio_phage	68.8	1.0e-55
WP_158138702.1|2114413_2115055_+	hypothetical protein	NA	A0A1V0E8E6	Vibrio_phage	71.6	2.6e-92
WP_158138703.1|2115226_2115478_+	hypothetical protein	NA	A0A1V0E8C3	Vibrio_phage	60.3	6.2e-18
WP_158138704.1|2115484_2115694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158138705.1|2115665_2116076_+	hypothetical protein	NA	A0A1V0E8F5	Vibrio_phage	66.7	1.5e-21
WP_158138706.1|2116136_2116346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158138707.1|2116347_2117526_+|integrase	site-specific integrase	integrase	A0A2H4J1K3	uncultured_Caudovirales_phage	31.0	7.7e-34
2117656:2117705	attR	GTCATGGGGTGTCGGGGGTCGGAGGTTCAAATCCTCTCAGTCCGACCAAA	NA	NA	NA	NA
>prophage 4
NZ_CP046822	Vibrio metschnikovii strain 07-2421 chromosome 1, complete sequence	2928756	2440380	2446931	2928756		Staphylococcus_phage(66.67%)	7	NA	NA
WP_004394649.1|2440380_2440851_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.0	1.1e-31
WP_004394648.1|2440990_2442100_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	38.4	1.2e-60
WP_158138814.1|2442140_2442797_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	36.1	4.2e-29
WP_158139062.1|2442808_2443915_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	37.4	8.2e-46
WP_115152664.1|2443929_2444379_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_158138815.1|2444535_2445786_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.7	3.9e-100
WP_154170327.1|2445797_2446931_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.5	7.3e-66
>prophage 1
NZ_CP046821	Vibrio metschnikovii strain 07-2421 chromosome 2, complete sequence	823324	586003	594158	823324		Diachasmimorpha_longicaudata_entomopoxvirus(16.67%)	8	NA	NA
WP_158137279.1|586003_587266_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.0	1.3e-55
WP_154171144.1|587326_588106_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_154171143.1|588225_588741_-	NUDIX domain-containing protein	NA	Q5ULM8	Lactobacillus_virus	33.3	1.3e-06
WP_154171142.1|589077_590727_+	DUF3763 domain-containing protein	NA	A0A2H4PB07	Aphanizomenon_phage	30.7	4.1e-33
WP_158137280.1|590740_592183_+	ATPase RavA stimulator ViaA	NA	A7KV72	Bacillus_phage	22.4	8.0e-09
WP_040905069.1|592186_592846_-	hypothetical protein	NA	M4PMR5	Vibrio_phage	34.8	4.8e-25
WP_158137281.1|592766_593504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154171140.1|593684_594158_-	redoxin family protein	NA	M1I839	Pelagibacter_phage	43.9	2.5e-23
>prophage 2
NZ_CP046821	Vibrio metschnikovii strain 07-2421 chromosome 2, complete sequence	823324	691439	743280	823324	integrase,protease,transposase	Vibrio_phage(38.1%)	55	682382:682397	716945:716960
682382:682397	attL	ACGATAAATTGACCAA	NA	NA	NA	NA
WP_154171067.1|691439_692234_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_158137326.1|692381_692837_+	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_154171065.1|692833_693067_+	DUF3389 family protein	NA	NA	NA	NA	NA
WP_158137327.1|693147_694836_+	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_154171063.1|694877_695765_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158137328.1|695782_698470_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_040905007.1|698749_699325_+	cytochrome c biogenesis protein CcdA	NA	NA	NA	NA	NA
WP_158137329.1|699520_700525_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_158137330.1|700508_701462_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_154171059.1|701563_701950_+	DUF3319 domain-containing protein	NA	NA	NA	NA	NA
WP_004396328.1|701968_702280_+	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_158137331.1|702457_702814_-	hypothetical protein	NA	Q9MCC3	Vibrio_phage	72.9	2.6e-41
WP_158137332.1|702990_703206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158137333.1|703208_703469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158137334.1|703458_704775_+	replication initiation factor family protein	NA	R9TNS0	Vibrio_phage	51.5	4.9e-114
WP_110167255.1|704780_705128_+	DUF1293 domain-containing protein	NA	Q858R2	Vibrio_phage	46.1	7.5e-22
WP_158137335.1|705135_705369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158137440.1|705405_705600_+	hypothetical protein	NA	G8IRU7	Vibrio_phage	71.4	3.9e-20
WP_158137336.1|705920_707324_+	hypothetical protein	NA	G8IRU9	Vibrio_phage	26.9	8.6e-16
WP_158137337.1|707323_707668_+	DUF2523 domain-containing protein	NA	G8IRV0	Vibrio_phage	49.1	2.3e-23
WP_158137338.1|707669_709040_+	toxin	NA	Q64EV0	Vibrio_phage	67.3	7.1e-172
WP_158137339.1|709511_709895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158137340.1|709896_710268_-	regulator	NA	Q9MCC4	Vibrio_phage	61.3	8.6e-40
WP_158137341.1|710430_711702_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	25.8	3.0e-15
WP_004396324.1|712083_712248_-	YoaH family protein	NA	NA	NA	NA	NA
WP_158137441.1|712288_713350_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_158137123.1|713540_714664_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.8	1.9e-26
WP_158137342.1|714774_715650_-	DUF2861 family protein	NA	NA	NA	NA	NA
WP_154171055.1|715653_716313_-	response regulator	NA	W8CYM9	Bacillus_phage	33.8	7.9e-28
WP_154171054.1|716287_717763_-	DUF3404 domain-containing protein	NA	NA	NA	NA	NA
716945:716960	attR	ACGATAAATTGACCAA	NA	NA	NA	NA
WP_158137343.1|717948_719325_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_158137344.1|719337_720879_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_158137345.1|720974_721253_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_004396309.1|721255_721633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158137346.1|721931_723167_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	28.3	9.6e-11
WP_158137347.1|723320_725078_+	diguanylate cyclase	NA	G3MA91	Bacillus_virus	34.2	1.0e-18
WP_158137348.1|725231_725564_+	zinc chelation protein SecC	NA	NA	NA	NA	NA
WP_002033345.1|725771_726062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158137349.1|726742_727705_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	27.5	5.5e-06
WP_158137350.1|727738_728212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158116645.1|728369_728825_-	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_039438324.1|728959_729277_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	46.2	4.0e-14
WP_158137351.1|729287_729641_-	toxin	NA	A0A222YWE2	Escherichia_phage	57.6	2.0e-25
WP_158137352.1|730374_730566_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_158137016.1|731012_732359_+	group II intron reverse transcriptase/maturase	NA	A0A1I9KFG3	Aeromonas_phage	24.4	2.3e-13
WP_158137353.1|733238_733430_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_158137016.1|733876_735223_+	group II intron reverse transcriptase/maturase	NA	A0A1I9KFG3	Aeromonas_phage	24.4	2.3e-13
WP_158137354.1|735999_736701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158137355.1|736835_737300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000351249.1|737494_737896_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A222YZ88	Escherichia_phage	29.8	7.2e-08
WP_158137349.1|738449_739412_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	27.5	5.5e-06
WP_158137442.1|739427_739913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032480879.1|740821_741286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154171242.1|741314_741425_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_158137356.1|742317_743280_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	27.5	5.5e-06
