The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046808	Vibrio parahaemolyticus strain 2013V-1146 chromosome 1, complete sequence	3343366	19780	28616	3343366		Vibrio_phage(25.0%)	13	NA	NA
WP_005495398.1|19780_22006_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	31.7	8.2e-61
WP_005483265.1|22300_22513_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	61.2	2.9e-16
WP_005495400.1|23417_23621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005495402.1|23843_24251_-	APSE-2 prophage; Q protein	NA	NA	NA	NA	NA
WP_005495404.1|24287_24689_-	NinG recombination protein/bacteriophage lambda NinG family protein	NA	A0A2I7S3K0	Vibrio_phage	45.0	3.7e-20
WP_005495406.1|24678_24861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005495408.1|24857_25508_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	36.5	7.0e-21
WP_005495410.1|25500_25881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005495412.1|25877_26831_-	helix-turn-helix domain-containing protein	NA	A0A1V0E831	Vibrio_phage	35.3	3.8e-39
WP_005495414.1|26896_27115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005495415.1|27111_27576_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	48.0	3.0e-18
WP_005495417.1|27595_27847_-	hypothetical protein	NA	A0A1I9KFF6	Aeromonas_phage	41.9	3.8e-07
WP_079749494.1|27818_28616_+	helix-turn-helix domain-containing protein	NA	G9L676	Escherichia_phage	37.2	2.1e-22
>prophage 2
NZ_CP046808	Vibrio parahaemolyticus strain 2013V-1146 chromosome 1, complete sequence	3343366	300411	310225	3343366	tRNA	Klosneuvirus(16.67%)	7	NA	NA
WP_005495749.1|300411_301692_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.4	2.5e-22
WP_005495751.1|301761_302028_-	DksA/TraR family C4-type zinc finger protein	NA	A0A1S6UBD1	Serratia_phage	48.9	2.1e-16
WP_023650089.1|302580_303480_-	DUF3380 domain-containing protein	NA	K4RM41	Pseudomonas_phage	43.0	4.8e-36
WP_005495761.1|303682_304990_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	42.8	2.2e-90
WP_005495763.1|305081_306431_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	42.1	1.1e-84
WP_005460060.1|306437_307064_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_005495766.1|307138_310225_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.9	3.8e-88
>prophage 3
NZ_CP046808	Vibrio parahaemolyticus strain 2013V-1146 chromosome 1, complete sequence	3343366	734680	741382	3343366		Staphylococcus_phage(50.0%)	7	NA	NA
WP_005440184.1|734680_735151_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.3	1.7e-32
WP_005496254.1|735320_736430_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.6	1.5e-63
WP_005496255.1|736599_737253_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.0	2.1e-33
WP_005496256.1|737265_738390_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	36.0	1.8e-48
WP_005482986.1|738397_738847_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_005496257.1|738974_740225_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.9	3.6e-98
WP_005483011.1|740242_741382_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.7	1.3e-62
>prophage 4
NZ_CP046808	Vibrio parahaemolyticus strain 2013V-1146 chromosome 1, complete sequence	3343366	2056146	2073544	3343366	tRNA	uncultured_Mediterranean_phage(20.0%)	14	NA	NA
WP_005455581.1|2056146_2057787_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.4	4.2e-155
WP_005455579.1|2057865_2059167_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	59.2	4.2e-134
WP_005455577.1|2059794_2060076_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_005493934.1|2060077_2060782_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	A0A2H4UTB4	Bodo_saltans_virus	24.3	3.4e-05
WP_005493937.1|2060799_2061276_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_005493940.1|2061322_2062366_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_005493942.1|2062365_2063142_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	6.6e-66
WP_158153161.1|2063141_2063768_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.1	1.3e-35
WP_005455560.1|2063782_2064706_+	peptidoglycan DD-metalloendopeptidase family protein	NA	D7RWE0	Brochothrix_phage	35.2	4.1e-06
WP_005493944.1|2065855_2068417_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	23.9	4.4e-34
WP_005493945.1|2068501_2068984_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	48.7	2.9e-27
WP_005478550.1|2069184_2070228_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	60.7	8.1e-112
WP_005493947.1|2070351_2070819_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005455546.1|2070961_2073544_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.9	1.0e-78
>prophage 1
NZ_CP046809	Vibrio parahaemolyticus strain 2013V-1146 chromosome 2, complete sequence	1853767	629930	681382	1853767	transposase,integrase,protease	Vibrio_phage(37.5%)	44	635950:635974	650829:650853
WP_021448338.1|629930_634301_+|protease	SslE/AcfD family lipoprotein zinc metalloprotease	protease	NA	NA	NA	NA
WP_005499492.1|634411_634816_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_100198882.1|635031_635934_+	OspB protein	NA	A0A0P0ZCT1	Stx2-converting_phage	35.3	1.2e-29
635950:635974	attL	TCTGACCGAATTACGCAACAAAGCC	NA	NA	NA	NA
WP_021448339.1|636158_637049_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	86.9	1.6e-153
WP_005499483.1|637373_637943_-	TDH-related hemolysin TRH1	NA	NA	NA	NA	NA
WP_005499480.1|638379_639228_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005499478.1|639374_640001_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	27.3	1.8e-05
WP_005499477.1|639997_640690_-	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	24.3	9.8e-05
WP_005499475.1|640677_641478_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_023650108.1|641494_642463_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005499471.1|642453_643992_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005499470.1|644397_645240_+	urease accessory protein ureD	NA	NA	NA	NA	NA
WP_005499469.1|645257_645560_+	urease subunit gamma	NA	NA	NA	NA	NA
WP_005499468.1|645570_645894_+	urease subunit beta	NA	NA	NA	NA	NA
WP_005499467.1|645890_647594_+	urease subunit alpha	NA	NA	NA	NA	NA
WP_005499466.1|647648_648128_+	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_020842398.1|648155_648821_+	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_005499462.1|648829_649468_+	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_080332365.1|649662_649938_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_021448344.1|650882_651803_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	91.1	1.2e-162
650829:650853	attR	GGCTTTGTTGCGTAATTCGGTCAGA	NA	NA	NA	NA
WP_023650135.1|652016_652586_+	thermostable direct hemolysin TDH	NA	NA	NA	NA	NA
WP_011106469.1|652889_652985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021448345.1|653257_655084_+	cell motility protein	NA	NA	NA	NA	NA
WP_005499452.1|656453_656822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005499450.1|657038_657563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021448349.1|660090_661011_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	88.5	2.3e-158
WP_005499427.1|662799_663114_-	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
WP_025548618.1|663106_663748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079748682.1|665444_666068_-	cupin	NA	NA	NA	NA	NA
WP_005499420.1|666307_667450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079748673.1|667421_668369_+	zinc ABC transporter solute-binding protein	NA	NA	NA	NA	NA
WP_079451942.1|668365_669175_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_101893994.1|669186_669300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005499414.1|669443_670163_+	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_005499413.1|670345_670936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005499407.1|672943_673783_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005499405.1|673866_674049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005499403.1|674297_674831_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_005499401.1|674930_675497_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005499399.1|675709_676567_+	glutathione-dependent disulfide-bond oxidoreductase	NA	NA	NA	NA	NA
WP_011106462.1|677054_677357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005499397.1|677993_679163_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	45.6	3.4e-82
WP_005499396.1|679449_679854_+	cell division protein DamX	NA	NA	NA	NA	NA
WP_005499394.1|680089_681382_+|protease	serine protease	protease	V5LS29	Emiliania_huxleyi_virus	22.7	4.5e-11
>prophage 2
NZ_CP046809	Vibrio parahaemolyticus strain 2013V-1146 chromosome 2, complete sequence	1853767	1070114	1086548	1853767	coat	Vibrio_phage(93.75%)	20	NA	NA
WP_158153206.1|1070114_1071470_-	type II secretory pathway protein	NA	R9TEZ5	Vibrio_phage	59.5	1.4e-124
WP_025557898.1|1071487_1072561_-	hypothetical protein	NA	O80263	Vibrio_phage	62.6	7.3e-124
WP_024702975.1|1072560_1072920_-|coat	minor coat protein	coat	R9TIT8	Vibrio_phage	47.4	9.2e-23
WP_158153208.1|1072919_1074851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020835298.1|1074926_1075190_-	hypothetical protein	NA	R9TI50	Vibrio_phage	40.3	2.6e-06
WP_012841822.1|1075460_1075766_-	hypothetical protein	NA	Q2PZB5	Vibrio_virus	51.0	8.1e-20
WP_158153210.1|1075849_1077880_-	replication endonuclease	NA	A0A0F6YPA7	Vibrio_phage	53.3	1.7e-198
WP_158153212.1|1077879_1078152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158153214.1|1078278_1078743_+	hypothetical protein	NA	A0A1W6UFY8	Vibrio_phage	82.5	4.6e-67
WP_069525258.1|1079105_1079558_+	hypothetical protein	NA	A0A1W6UFZ4	Vibrio_phage	45.5	1.8e-31
WP_043852781.1|1080204_1081632_-	toxin	NA	Q64EV0	Vibrio_phage	52.1	1.1e-122
WP_005376274.1|1081637_1081970_-	hypothetical protein	NA	Q64EV1	Vibrio_phage	39.8	1.7e-18
WP_043852782.1|1081969_1083484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031812170.1|1083618_1083810_-	hypothetical protein	NA	G8IRU8	Vibrio_phage	54.8	8.4e-07
WP_005376279.1|1083838_1084084_-	hypothetical protein	NA	R9TMT7	Vibrio_phage	43.9	4.8e-07
WP_043852786.1|1084086_1084422_-	DUF1293 domain-containing protein	NA	Q858R2	Vibrio_phage	65.8	3.7e-34
WP_158153216.1|1084393_1085494_-	replication initiation factor family protein	NA	Q8W6E3	Vibrio_phage	76.3	7.9e-158
WP_158153218.1|1085483_1085684_-	hypothetical protein	NA	C3W4P3	Vibrio_phage	73.8	6.7e-23
WP_043852791.1|1085686_1085989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025506200.1|1086179_1086548_+	hypothetical protein	NA	A0A1W6UGD7	Vibrio_phage	65.3	9.7e-36
