The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046815	Vibrio cincinnatiensis strain 1398-82 chromosome 1, complete sequence	2771467	651181	657770	2771467		Staphylococcus_phage(66.67%)	7	NA	NA
WP_078925467.1|651181_651652_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.7	2.9e-32
WP_078925468.1|651842_652952_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	39.0	2.0e-60
WP_078925469.1|653009_653666_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	36.1	2.2e-30
WP_078925471.1|653677_654778_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	33.8	2.6e-44
WP_078925473.1|654792_655242_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_078925475.1|655374_656625_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.5	1.7e-95
WP_115174046.1|656636_657770_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.9	1.5e-66
>prophage 2
NZ_CP046815	Vibrio cincinnatiensis strain 1398-82 chromosome 1, complete sequence	2771467	1748558	1809229	2771467	transposase,integrase	Staphylococcus_phage(22.22%)	51	1782971:1782986	1809561:1809576
WP_115174026.1|1748558_1749355_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_078926586.1|1749426_1750161_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_078926587.1|1750395_1751982_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_078926588.1|1752047_1753373_+	6-phospho-alpha-glucosidase	NA	NA	NA	NA	NA
WP_078926589.1|1753590_1754733_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.7	2.0e-42
WP_000273139.1|1755517_1755739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078926590.1|1755900_1756128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078926591.1|1756175_1756544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078926592.1|1756573_1757308_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_115174025.1|1757446_1757623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078926593.1|1757875_1760881_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	68.5	0.0e+00
WP_016151372.1|1760964_1761264_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_016151373.1|1761256_1761499_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_078926594.1|1761694_1762330_+	serine recombinase	NA	NA	NA	NA	NA
WP_078926595.1|1762834_1763494_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_078926596.1|1763490_1764807_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_078926597.1|1764803_1767905_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_078926598.1|1768273_1769797_-|transposase	ISNCY family transposase	transposase	A0A0M3LS26	Mannheimia_phage	31.0	5.5e-08
WP_078926599.1|1770156_1770462_-	monooxygenase	NA	NA	NA	NA	NA
WP_078926600.1|1770611_1771505_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_078926601.1|1771743_1772130_-	RidA family protein	NA	NA	NA	NA	NA
WP_078926602.1|1772191_1773523_-	D-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_078926603.1|1773535_1774873_-	D-serine transporter DsdX	NA	NA	NA	NA	NA
WP_078926604.1|1775094_1776030_+	DNA-binding transcriptional regulator DsdC	NA	NA	NA	NA	NA
WP_115174024.1|1777002_1777446_-	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
WP_031852557.1|1777436_1777910_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_078926607.1|1778115_1779138_-	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_032468702.1|1779480_1779939_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	33.1	2.0e-14
WP_078927315.1|1780048_1780993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078927316.1|1781600_1784210_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	40.9	3.1e-91
1782971:1782986	attL	AGAAACCCTGCGCAGC	NA	NA	NA	NA
WP_078927317.1|1784211_1785495_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	24.0	6.1e-08
WP_078927318.1|1785507_1789344_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_078927319.1|1789493_1790498_-	hypothetical protein	NA	A0A0R6PIZ6	Moraxella_phage	33.3	9.1e-44
WP_078927320.1|1790845_1792087_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	47.3	2.0e-109
WP_078927321.1|1792617_1794441_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_139364791.1|1794430_1794877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078927323.1|1794873_1795941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078927324.1|1796889_1797552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060658345.1|1797720_1797966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078927325.1|1798066_1799158_-	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_078927327.1|1799351_1800128_-	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_078927328.1|1800157_1801930_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_078927329.1|1801935_1802298_-	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_078927330.1|1802638_1802983_-	TraK family protein	NA	NA	NA	NA	NA
WP_078927331.1|1802984_1803224_-	plasmid-related protein	NA	NA	NA	NA	NA
WP_078927332.1|1804161_1805115_+	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_078927333.1|1805201_1806032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078927334.1|1806079_1807126_-	HipA domain-containing protein	NA	NA	NA	NA	NA
WP_078927335.1|1807109_1807436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078927336.1|1807420_1807741_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_078927337.1|1808137_1809229_-|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	38.2	7.4e-47
1809561:1809576	attR	GCTGCGCAGGGTTTCT	NA	NA	NA	NA
>prophage 3
NZ_CP046815	Vibrio cincinnatiensis strain 1398-82 chromosome 1, complete sequence	2771467	1820560	1827710	2771467		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_078927348.1|1820560_1821316_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.4	2.4e-65
WP_078927349.1|1821320_1821947_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	1.5e-36
WP_078927350.1|1821946_1822894_+	murein hydrolase activator NlpD	NA	I2E8W3	Clostridium_phage	33.1	6.2e-10
WP_078927351.1|1822960_1823950_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.6	1.5e-35
WP_078927352.1|1824013_1826596_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	25.4	7.9e-31
WP_078927353.1|1826819_1827710_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	42.1	4.0e-59
>prophage 1
NZ_CP046816	Vibrio cincinnatiensis strain 1398-82 chromosome 2, complete sequence	1010325	253360	288839	1010325	transposase,integrase	Pseudomonas_phage(54.55%)	35	258106:258125	289008:289027
WP_078927662.1|253360_254494_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_115173883.1|254728_256054_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.3	2.0e-30
WP_115173912.1|256577_256859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115173888.1|256883_257912_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_115173911.1|257823_258096_-	hypothetical protein	NA	NA	NA	NA	NA
258106:258125	attL	TTAAGGGGCAAGCAACGCTA	NA	NA	NA	NA
WP_115173891.1|258214_258730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158142138.1|259327_260179_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	42.4	8.3e-54
WP_078927561.1|261161_261404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078927560.1|261407_261959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078927559.1|263688_264360_-	helix-turn-helix transcriptional regulator	NA	A0A2R2ZGJ3	Clostridioides_phage	32.7	1.5e-05
WP_078927558.1|264431_264650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078927557.1|264667_265018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078927556.1|265004_265337_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_078927555.1|265338_266310_+	MarR family transcriptional regulator	NA	J9SW46	Pseudomonas_phage	35.0	9.8e-19
WP_078927554.1|266316_268074_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q5ZR04	Pseudomonas_phage	33.2	5.3e-87
WP_115173908.1|268003_269158_+	AAA family ATPase	NA	J9SNL1	Pseudomonas_phage	37.8	5.4e-48
WP_078927552.1|269160_269619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078927551.1|270092_270359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078927550.1|270355_270766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078927549.1|271011_271359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078927548.1|271372_271951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139364796.1|271989_272325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078927546.1|272404_275293_+	hypothetical protein	NA	A0A0H5AWE4	Pseudomonas_phage	32.5	3.3e-46
WP_158116599.1|275508_276360_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	42.7	4.4e-55
WP_078927572.1|276861_277431_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_078927571.1|278540_279248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078927570.1|279244_279817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078927569.1|280114_282265_-	hypothetical protein	NA	A5LH58	Enterobacteria_phage	32.8	2.2e-103
WP_078927568.1|282707_283193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078927576.1|283192_284071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115173907.1|284187_285756_-	replication endonuclease	NA	F1BUS0	Erwinia_phage	42.1	5.7e-77
WP_115173906.1|285752_286004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078927575.1|285996_286233_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_115173905.1|286311_287283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078927578.1|287633_288839_-|integrase	site-specific integrase	integrase	A0A0S2SYQ7	Pseudomonas_phage	32.8	1.4e-27
289008:289027	attR	TTAAGGGGCAAGCAACGCTA	NA	NA	NA	NA
>prophage 2
NZ_CP046816	Vibrio cincinnatiensis strain 1398-82 chromosome 2, complete sequence	1010325	300248	337925	1010325	integrase,transposase	Shigella_phage(40.0%)	47	290074:290105	317047:317078
290074:290105	attL	GACTTTCTAAGCTGCCTATGCGGCAGTGAACA	NA	NA	NA	NA
WP_078927564.1|300248_301109_-|integrase	site-specific integrase	integrase	A0A0S2SYQ7	Pseudomonas_phage	33.2	4.6e-28
WP_078927563.1|301089_302229_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_115173883.1|304437_305763_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.3	2.0e-30
WP_078927605.1|306905_307715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078927604.1|307704_308148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078927603.1|308175_308301_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_078927602.1|308282_308714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078927601.1|308868_309192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115173940.1|309233_309356_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_004394087.1|309434_309707_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_078927600.1|309703_310201_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_115173900.1|310221_310362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115173899.1|310310_311144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078927599.1|311143_311989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078927598.1|312160_313135_-	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_158116599.1|313183_314035_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	42.7	4.4e-55
WP_115173898.1|314539_314953_-	GFA family protein	NA	NA	NA	NA	NA
WP_115173897.1|315459_315582_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_115173894.1|315619_316033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072668974.1|317355_317466_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
317047:317078	attR	GACTTTCTAAGCTGCCTATGCGGCAGTGAACA	NA	NA	NA	NA
WP_078927644.1|317462_317897_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_139364804.1|317911_318007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078927646.1|318429_318729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158116599.1|319395_320247_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	42.7	4.4e-55
WP_113594551.1|322132_322249_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_113594550.1|322245_322548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158142139.1|322548_322704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025590728.1|322864_323284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115173896.1|323285_323492_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_038970004.1|324682_325342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078927623.1|325477_325993_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	38.4	6.0e-15
WP_078927624.1|326147_326744_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_000351249.1|326900_327302_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A222YZ88	Escherichia_phage	29.8	7.2e-08
WP_001080654.1|327301_327472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115173939.1|327542_327668_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_078927625.1|327649_328636_-	DUF3644 domain-containing protein	NA	NA	NA	NA	NA
WP_158142140.1|328701_329553_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	42.7	1.5e-55
WP_001071517.1|331050_331410_-	VOC family protein	NA	NA	NA	NA	NA
WP_115173938.1|332448_332565_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_078927613.1|332627_333026_-	aegerolysin	NA	NA	NA	NA	NA
WP_115173937.1|333151_333268_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_062907537.1|333264_333702_-	helix-turn-helix domain-containing protein	NA	A0A0P0IRJ4	Acinetobacter_phage	38.3	2.1e-21
WP_078927615.1|333712_334054_-	DUF4258 domain-containing protein	NA	NA	NA	NA	NA
WP_045570037.1|335351_335567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078927617.1|335704_336202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078927618.1|336188_336902_-	hypothetical protein	NA	C9DG53	Deftia_phage	38.6	1.0e-20
WP_158116599.1|337073_337925_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	42.7	4.4e-55
>prophage 3
NZ_CP046816	Vibrio cincinnatiensis strain 1398-82 chromosome 2, complete sequence	1010325	343054	399563	1010325	transposase,integrase,tRNA	Shigella_phage(25.0%)	60	342019:342033	391983:391997
342019:342033	attL	GTTCTAAAACAAGCT	NA	NA	NA	NA
WP_158116599.1|343054_343906_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	42.7	4.4e-55
WP_078927665.1|344792_344903_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_078927664.1|344982_345213_+	secretion protein	NA	NA	NA	NA	NA
WP_080115560.1|346288_346399_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_115173892.1|346454_346745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108315877.1|347272_347389_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_078927658.1|347379_347844_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_078927656.1|347991_348744_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	32.0	1.6e-21
WP_078927662.1|348835_349969_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_115173883.1|350203_351529_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.3	2.0e-30
WP_078927652.1|353381_354044_-	Vat family streptogramin A O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	39.6	2.5e-26
WP_078927653.1|354162_354615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115173891.1|355382_355898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078927642.1|355974_356064_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_078927640.1|356867_357155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078927641.1|357400_357703_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000861987.1|357690_357948_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_001012254.1|358213_358492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158116599.1|358550_359402_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	42.7	4.4e-55
WP_139364809.1|359896_360664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078927662.1|360705_361839_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_115173883.1|362073_363399_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.3	2.0e-30
WP_032480862.1|364474_364753_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_002033296.1|364745_365015_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_078927637.1|365149_365857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078927636.1|366042_366600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139364803.1|366723_366912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158116599.1|367637_368489_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	42.7	4.4e-55
WP_078927669.1|369472_370072_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_115173889.1|372589_372679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078927655.1|372883_373306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115173888.1|373549_374578_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_078927661.1|374627_375011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078927660.1|375157_375988_-	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_158116599.1|376037_376889_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	42.7	4.4e-55
WP_115173886.1|377735_377912_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_078927626.1|377908_378283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078927627.1|378440_379643_-	DUF3644 domain-containing protein	NA	A0A0N9RUA4	Staphylococcus_phage	27.1	9.3e-27
WP_078927628.1|379786_380899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078927629.1|381112_381295_-	DUF645 family protein	NA	NA	NA	NA	NA
WP_078927648.1|382633_382822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078927649.1|383133_383610_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_115173931.1|384587_384698_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_000126952.1|384754_385003_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_000221349.1|384992_385283_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	57.4	9.1e-21
WP_113594551.1|385331_385448_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_113594550.1|385444_385747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158142139.1|385747_385903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115173884.1|386448_386562_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_078927668.1|386654_386897_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_039428516.1|386905_387205_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_078927662.1|387326_388460_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_115173883.1|388694_390020_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.3	2.0e-30
WP_078925954.1|390682_391645_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	41.6	2.0e-56
WP_040992521.1|391691_392045_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
391983:391997	attR	AGCTTGTTTTAGAAC	NA	NA	NA	NA
WP_004727973.1|392086_392281_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_078925953.1|392380_392932_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	35.8	2.4e-14
WP_078925952.1|392935_394864_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.6	1.4e-128
WP_078925966.1|395070_396969_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.8	8.6e-51
WP_078925951.1|397562_399563_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	23.1	2.0e-29
