The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046754	Vibrio parahaemolyticus strain 2015AW-0174 chromosome 1, complete sequence	3326911	439454	456852	3326911	tRNA	uncultured_Mediterranean_phage(20.0%)	14	NA	NA
WP_005455581.1|439454_441095_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.4	4.2e-155
WP_005455579.1|441173_442475_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	59.2	4.2e-134
WP_005455577.1|443102_443384_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_005493934.1|443385_444090_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	A0A2H4UTB4	Bodo_saltans_virus	24.3	3.4e-05
WP_005493937.1|444107_444584_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_005493940.1|444630_445674_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_005493942.1|445673_446450_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	6.6e-66
WP_005455562.1|446449_447076_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.1	1.3e-35
WP_005455560.1|447090_448014_+	peptidoglycan DD-metalloendopeptidase family protein	NA	D7RWE0	Brochothrix_phage	35.2	4.1e-06
WP_005493944.1|449163_451725_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	23.9	4.4e-34
WP_005493945.1|451809_452292_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	48.7	2.9e-27
WP_005478550.1|452492_453536_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	60.7	8.1e-112
WP_005493947.1|453659_454127_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005455546.1|454269_456852_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.9	1.0e-78
>prophage 2
NZ_CP046754	Vibrio parahaemolyticus strain 2015AW-0174 chromosome 1, complete sequence	3326911	1746458	1755294	3326911		Vibrio_phage(25.0%)	13	NA	NA
WP_005495398.1|1746458_1748684_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	31.7	8.2e-61
WP_005483265.1|1748978_1749191_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	61.2	2.9e-16
WP_005495400.1|1750095_1750299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005495402.1|1750521_1750929_-	APSE-2 prophage; Q protein	NA	NA	NA	NA	NA
WP_005495404.1|1750965_1751367_-	NinG recombination protein/bacteriophage lambda NinG family protein	NA	A0A2I7S3K0	Vibrio_phage	45.0	3.7e-20
WP_005495406.1|1751356_1751539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005495408.1|1751535_1752186_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	36.5	7.0e-21
WP_005495410.1|1752178_1752559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005495412.1|1752555_1753509_-	helix-turn-helix domain-containing protein	NA	A0A1V0E831	Vibrio_phage	35.3	3.8e-39
WP_005495414.1|1753574_1753793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005495415.1|1753789_1754254_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	48.0	3.0e-18
WP_005495417.1|1754273_1754525_-	hypothetical protein	NA	A0A1I9KFF6	Aeromonas_phage	41.9	3.8e-07
WP_079749494.1|1754496_1755294_+	helix-turn-helix domain-containing protein	NA	G9L676	Escherichia_phage	37.2	2.1e-22
>prophage 3
NZ_CP046754	Vibrio parahaemolyticus strain 2015AW-0174 chromosome 1, complete sequence	3326911	2461357	2468059	3326911		Staphylococcus_phage(50.0%)	7	NA	NA
WP_005440184.1|2461357_2461828_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.3	1.7e-32
WP_005496254.1|2461997_2463107_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.6	1.5e-63
WP_005496255.1|2463276_2463930_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.0	2.1e-33
WP_005496256.1|2463942_2465067_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	36.0	1.8e-48
WP_005482986.1|2465074_2465524_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_005496257.1|2465651_2466902_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.9	3.6e-98
WP_005483011.1|2466919_2468059_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.7	1.3e-62
>prophage 1
NZ_CP046753	Vibrio parahaemolyticus strain 2015AW-0174 chromosome 2, complete sequence	1833636	834869	886320	1833636	protease,integrase,transposase	Vibrio_phage(37.5%)	44	840889:840913	855768:855792
WP_021448338.1|834869_839240_+|protease	SslE/AcfD family lipoprotein zinc metalloprotease	protease	NA	NA	NA	NA
WP_005499492.1|839350_839755_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_100198882.1|839970_840873_+	OspB protein	NA	A0A0P0ZCT1	Stx2-converting_phage	35.3	1.2e-29
840889:840913	attL	TCTGACCGAATTACGCAACAAAGCC	NA	NA	NA	NA
WP_021448339.1|841097_841988_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	86.9	1.6e-153
WP_005499483.1|842312_842882_-	TDH-related hemolysin TRH1	NA	NA	NA	NA	NA
WP_005499480.1|843318_844167_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005499478.1|844313_844940_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	27.3	1.8e-05
WP_005499477.1|844936_845629_-	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	24.3	9.8e-05
WP_005499475.1|845616_846417_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_023650108.1|846433_847402_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005499471.1|847392_848931_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005499470.1|849336_850179_+	urease accessory protein ureD	NA	NA	NA	NA	NA
WP_005499469.1|850196_850499_+	urease subunit gamma	NA	NA	NA	NA	NA
WP_005499468.1|850509_850833_+	urease subunit beta	NA	NA	NA	NA	NA
WP_005499467.1|850829_852533_+	urease subunit alpha	NA	NA	NA	NA	NA
WP_005499466.1|852587_853067_+	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_020842398.1|853094_853760_+	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_005499462.1|853768_854407_+	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_080332365.1|854601_854877_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_021448344.1|855821_856742_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	91.1	1.2e-162
855768:855792	attR	GGCTTTGTTGCGTAATTCGGTCAGA	NA	NA	NA	NA
WP_023650135.1|856955_857525_+	thermostable direct hemolysin TDH	NA	NA	NA	NA	NA
WP_011106469.1|857828_857924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021448345.1|858196_860023_+	cell motility protein	NA	NA	NA	NA	NA
WP_005499452.1|861392_861761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005499450.1|861977_862502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021448349.1|865029_865950_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	88.5	2.3e-158
WP_005499427.1|867738_868053_-	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
WP_025548618.1|868045_868687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079748682.1|870382_871006_-	cupin	NA	NA	NA	NA	NA
WP_005499420.1|871245_872388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079748673.1|872359_873307_+	zinc ABC transporter solute-binding protein	NA	NA	NA	NA	NA
WP_079451942.1|873303_874113_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_101893994.1|874124_874238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005499414.1|874381_875101_+	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_005499413.1|875283_875874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005499407.1|877881_878721_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005499405.1|878804_878987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005499403.1|879235_879769_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_005499401.1|879868_880435_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005499399.1|880647_881505_+	glutathione-dependent disulfide-bond oxidoreductase	NA	NA	NA	NA	NA
WP_011106462.1|881992_882295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005499397.1|882931_884101_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	45.6	3.4e-82
WP_005499396.1|884387_884792_+	cell division protein DamX	NA	NA	NA	NA	NA
WP_005499394.1|885027_886320_+|protease	serine protease	protease	V5LS29	Emiliania_huxleyi_virus	22.7	4.5e-11
