The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046772	Vibrio alginolyticus strain 2014V-1011 chromosome 1, complete sequence	3341568	871392	878176	3341568		Staphylococcus_phage(50.0%)	7	NA	NA
WP_005383771.1|871392_872532_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.0	4.5e-63
WP_158173707.1|872549_873800_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.7	1.1e-99
WP_005381578.1|874006_874456_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_025768890.1|874463_875591_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.8	1.9e-45
WP_158173708.1|875599_876253_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	36.6	4.0e-32
WP_005381573.1|876426_877536_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.8	1.2e-65
WP_005381572.1|877705_878176_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.7	1.7e-32
>prophage 2
NZ_CP046772	Vibrio alginolyticus strain 2014V-1011 chromosome 1, complete sequence	3341568	1311152	1320921	3341568	tRNA	Mycobacterium_phage(16.67%)	8	NA	NA
WP_158173774.1|1311152_1314200_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.0	1.3e-88
WP_104978964.1|1314261_1314888_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_045368976.1|1314894_1316244_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	43.2	4.9e-85
WP_005437179.1|1316335_1317643_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	42.8	7.6e-91
WP_017634398.1|1317846_1318749_+	DUF3380 domain-containing protein	NA	A0A291LBS7	Pseudomonas_phage	43.5	2.2e-36
WP_158174226.1|1318738_1319167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017634396.1|1319304_1319571_+	DksA/TraR family C4-type zinc finger protein	NA	A0A1S6UBD1	Serratia_phage	46.6	6.2e-16
WP_158173775.1|1319640_1320921_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.9	3.6e-21
>prophage 3
NZ_CP046772	Vibrio alginolyticus strain 2014V-1011 chromosome 1, complete sequence	3341568	2420173	2449662	3341568	tail,terminase,capsid,integrase,head,portal	Vibrio_phage(84.85%)	37	2413560:2413604	2449809:2449853
2413560:2413604	attL	TAAAGCTTTATATCCACTTTAATAATTAAACCTTTAAAATCATTT	NA	NA	NA	NA
WP_158174075.1|2420173_2420776_-	hemolysin	NA	A0A2I7RNJ4	Vibrio_phage	85.0	4.4e-102
WP_158174076.1|2420762_2421950_-	hypothetical protein	NA	A0A2I7RNJ7	Vibrio_phage	82.5	6.3e-193
WP_025589745.1|2421949_2422291_-	DUF2590 family protein	NA	A0A2I7RNH9	Vibrio_phage	80.9	4.0e-44
WP_158174077.1|2422290_2424177_-|tail	phage tail tape measure protein	tail	A0A1D9C9V3	Salinivibrio_phage	59.0	6.6e-221
WP_047508669.1|2424370_2424634_-	hypothetical protein	NA	A0A1D9C9R9	Salinivibrio_phage	55.3	1.7e-18
WP_045607483.1|2424630_2424915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158174078.1|2424917_2425148_-	hypothetical protein	NA	W6B371	Vibrio_phage	42.9	3.5e-07
WP_158174079.1|2425144_2425642_-	hypothetical protein	NA	A0A2I7S7C4	Vibrio_phage	48.8	9.8e-23
WP_031856783.1|2425638_2425857_-	molecular chaperone DnaK	NA	A0A2I7RNJ6	Vibrio_phage	73.5	1.2e-22
WP_158174080.1|2425869_2426319_-	DUF2597 family protein	NA	A0A2I7RNI0	Vibrio_phage	96.0	2.1e-77
WP_158174081.1|2426322_2427453_-	DUF2586 family protein	NA	A0A2I7RNI8	Vibrio_phage	84.6	7.3e-183
WP_158174082.1|2427456_2428113_-	virion morphogenesis protein	NA	A0A2I7RNI6	Vibrio_phage	82.1	1.3e-99
WP_158174083.1|2428096_2428588_-|tail	phage tail protein	tail	A0A2I7RNH2	Vibrio_phage	85.6	6.8e-77
WP_158174084.1|2428584_2429004_-|head	head completion/stabilization protein	head	A0A2I7RNH7	Vibrio_phage	76.3	2.9e-52
WP_158174085.1|2429118_2429835_-|terminase	terminase	terminase	A0A2I7RNJ0	Vibrio_phage	83.9	1.4e-102
WP_158174086.1|2429845_2430850_-|capsid	phage major capsid protein, P2 family	capsid	R9TPZ5	Vibrio_phage	63.7	3.9e-111
WP_158174087.1|2430849_2431707_-|capsid	phage capsid protein	capsid	A0A2I7RNH1	Vibrio_phage	66.9	6.5e-99
WP_158174088.1|2431873_2433625_+|terminase	terminase	terminase	A0A2I7RNI3	Vibrio_phage	88.1	8.7e-308
WP_158174089.1|2433621_2434650_+|portal	phage portal protein	portal	A0A2I7RNI9	Vibrio_phage	73.5	4.8e-149
WP_079765352.1|2434728_2434980_+	ogr/Delta-like zinc finger family protein	NA	R9TNQ2	Vibrio_phage	85.5	1.9e-35
WP_158174260.1|2434981_2435254_-	hypothetical protein	NA	U3PDF9	Vibrio_phage	65.7	2.2e-16
WP_158174090.1|2436462_2436657_+	hypothetical protein	NA	Q8HA45	Vibrio_phage	73.4	1.1e-17
WP_158174091.1|2436660_2437140_+	hypothetical protein	NA	Q8HA46	Vibrio_phage	69.6	1.5e-60
WP_158174092.1|2437242_2439786_-	replication endonuclease	NA	A0A166YHE2	Vibrio_phage	64.4	0.0e+00
WP_158174093.1|2439827_2440103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158174094.1|2440326_2440554_-	hypothetical protein	NA	U3PIK2	Vibrio_phage	70.7	4.3e-26
WP_158174095.1|2440928_2441330_-	hypothetical protein	NA	R9TRR4	Vibrio_phage	75.2	2.3e-54
WP_158174261.1|2441326_2441893_-	3'-5' exoribonuclease	NA	K7PM77	Enterobacteria_phage	49.7	7.2e-38
WP_158174096.1|2441904_2442333_-	hypothetical protein	NA	R9TNP8	Vibrio_phage	43.2	2.2e-10
WP_158174097.1|2442407_2442743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158174098.1|2442752_2443292_-	transcriptional regulator	NA	U3PIJ8	Vibrio_phage	58.1	3.4e-53
WP_045588167.1|2443403_2443616_-	hypothetical protein	NA	R9TMQ7	Vibrio_phage	75.7	1.2e-22
WP_158174099.1|2443769_2444417_+	chromosome partitioning protein ParA	NA	A0A166YHA0	Vibrio_phage	72.9	1.3e-86
WP_158174100.1|2444447_2444951_+	hypothetical protein	NA	A0A1D9C9Q4	Salinivibrio_phage	58.3	5.8e-47
WP_158174101.1|2444996_2446583_+	DUF4041 domain-containing protein	NA	A0A142LP25	Marinitoga_camini_virus	63.8	1.3e-79
WP_158174102.1|2446725_2448624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158174103.1|2448639_2449662_+|integrase	tyrosine-type recombinase/integrase	integrase	R9TMQ4	Vibrio_phage	53.2	1.7e-98
2449809:2449853	attR	TAAAGCTTTATATCCACTTTAATAATTAAACCTTTAAAATCATTT	NA	NA	NA	NA
>prophage 4
NZ_CP046772	Vibrio alginolyticus strain 2014V-1011 chromosome 1, complete sequence	3341568	2889194	2902663	3341568	tRNA	uncultured_Mediterranean_phage(22.22%)	13	NA	NA
WP_033907431.1|2889194_2891777_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.1	5.9e-79
WP_005383799.1|2891919_2892387_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_158156857.1|2892278_2892458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005380874.1|2892514_2893558_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.0	8.1e-112
WP_005383794.1|2893758_2894241_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	48.1	1.8e-26
WP_033907432.1|2894325_2896887_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	23.2	1.3e-30
WP_158174158.1|2896969_2897956_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.2	6.9e-36
WP_017633546.1|2898036_2898960_-	peptidoglycan DD-metalloendopeptidase family protein	NA	D7RWE0	Brochothrix_phage	35.2	4.1e-06
WP_005380892.1|2898973_2899600_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	54.5	2.3e-37
WP_005380894.1|2899599_2900376_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	49.4	2.3e-66
WP_017821624.1|2900375_2901419_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_005380896.1|2901464_2901941_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_017821625.1|2901955_2902663_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	A0A2H4UTB4	Bodo_saltans_virus	23.6	9.1e-06
>prophage 1
NZ_CP046774	Vibrio alginolyticus strain 2014V-1011 plasmid unnamed1, complete sequence	137319	16459	55207	137319		Escherichia_phage(53.85%)	38	NA	NA
WP_158174272.1|16459_17377_+	ParB/RepB/Spo0J family partition protein	NA	S5VTK0	Leptospira_phage	30.4	3.3e-08
WP_079878982.1|17398_17731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158174273.1|17823_19269_-	hypothetical protein	NA	Q71TE6	Escherichia_phage	59.8	1.6e-145
WP_158174274.1|19551_20235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158174275.1|20303_25097_-	hypothetical protein	NA	Q1MVM7	Enterobacteria_phage	33.3	4.0e-20
WP_017634054.1|25093_25720_-	hypothetical protein	NA	O21969	Escherichia_phage	37.3	6.3e-19
WP_136976912.1|25712_26126_-	hypothetical protein	NA	A0A077SK09	Escherichia_phage	35.8	9.6e-08
WP_017634052.1|26122_26446_-	hypothetical protein	NA	Q37876	Escherichia_phage	36.4	4.1e-06
WP_158174276.1|26836_29485_-	hypothetical protein	NA	A0A140B3F5	Vibrio_phage	53.7	8.5e-57
WP_136976915.1|29575_30694_-	hypothetical protein	NA	A0A1B0XUH9	Freshwater_phage	32.4	5.6e-18
WP_158174277.1|30765_32025_-	hypothetical protein	NA	X2L0B8	Vibrio_phage	46.3	3.3e-06
WP_033905433.1|32024_32486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054579128.1|32542_33382_-	hypothetical protein	NA	A0A1B0V7F2	Salmonella_phage	40.3	1.5e-36
WP_158174278.1|33497_34895_-	hypothetical protein	NA	A0A1B0VAD6	Salmonella_phage	35.0	5.9e-73
WP_033905435.1|34891_35239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158174279.1|35242_37900_-	hypothetical protein	NA	A0A222YXR4	Escherichia_phage	35.7	2.3e-09
WP_158174280.1|38028_38841_-	hypothetical protein	NA	A0A222YZ63	Escherichia_phage	38.6	5.5e-47
WP_158174281.1|38840_39356_-	hypothetical protein	NA	A0A222YY05	Escherichia_phage	41.1	4.5e-31
WP_158174358.1|39367_39616_-	hypothetical protein	NA	Q71TN7	Escherichia_phage	46.9	1.3e-12
WP_158174282.1|40191_40572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017634038.1|40588_40984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158174283.1|41040_41709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017634036.1|41705_42521_-	hypothetical protein	NA	K4K6E1	Caulobacter_phage	36.4	4.2e-23
WP_017635630.1|43194_43443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158174284.1|43685_45017_+	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	30.6	1.6e-24
WP_017635634.1|45082_45580_-	hypothetical protein	NA	A0A222YWE4	Escherichia_phage	45.1	2.7e-33
WP_158174285.1|45593_46202_-	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	34.7	6.4e-24
WP_017635636.1|46211_46880_-	hypothetical protein	NA	A0A222YXT7	Escherichia_phage	35.3	4.4e-10
WP_158174286.1|46902_48477_-	hypothetical protein	NA	Q71TB2	Escherichia_phage	41.6	1.3e-105
WP_054577210.1|48469_48901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158174287.1|48947_50597_-	hypothetical protein	NA	A0A222YWC7	Escherichia_phage	32.0	2.0e-64
WP_017635640.1|50879_51230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158174288.1|51229_51781_-	hypothetical protein	NA	A0A2I7RXW8	Vibrio_phage	44.5	4.6e-29
WP_158174289.1|52014_52194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158174290.1|52406_53162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042522745.1|53171_53456_-	hypothetical protein	NA	Q1MVI7	Enterobacteria_phage	34.4	1.2e-06
WP_140203490.1|53462_54233_-	hypothetical protein	NA	A0A222YWF1	Escherichia_phage	37.7	2.1e-19
WP_158174291.1|54229_55207_-	hypothetical protein	NA	A0A222YXZ0	Escherichia_phage	28.2	1.2e-32
>prophage 2
NZ_CP046774	Vibrio alginolyticus strain 2014V-1011 plasmid unnamed1, complete sequence	137319	82524	90209	137319	plate,tail	Escherichia_phage(66.67%)	8	NA	NA
WP_158174306.1|82524_84087_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.9	2.9e-20
WP_158174307.1|84474_85974_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_158174308.1|86210_86723_-	hypothetical protein	NA	A0A222YXU3	Escherichia_phage	44.5	4.8e-33
WP_158174309.1|86719_87871_-|tail	phage tail protein	tail	Q71T88	Escherichia_phage	49.2	8.2e-73
WP_158174310.1|87874_88198_-|plate	baseplate protein	plate	NA	NA	NA	NA
WP_158174311.1|88190_88823_-	hypothetical protein	NA	A0A222YZ79	Escherichia_phage	30.1	4.9e-19
WP_158174312.1|88912_89197_-	recombination enhancement function domain protein	NA	A0A222YXV2	Escherichia_phage	47.8	9.9e-12
WP_158174313.1|89675_90209_-	hypothetical protein	NA	K7R9C0	Vibrio_phage	34.0	1.2e-10
>prophage 1
NZ_CP046773	Vibrio alginolyticus strain 2014V-1011 plasmid unnamed2, complete sequence	131705	85313	131506	131705	transposase,integrase	Escherichia_phage(30.0%)	61	124961:125020	131609:131705
WP_000543934.1|85313_86324_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_000997323.1|86328_87198_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	35.1	3.5e-23
WP_000139717.1|87194_87686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001097010.1|88012_88888_+	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_000101568.1|89040_90081_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000101263.1|90080_90359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000811656.1|90367_91879_+	ATP-dependent helicase	NA	A0A2D1GN12	Pseudoalteromonas_phage	30.7	3.6e-44
WP_001326396.1|91989_93030_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_024126941.1|93031_94465_+	conjugal transfer pilus assembly protein TraH	NA	NA	NA	NA	NA
WP_000534551.1|94477_98092_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_000683483.1|98129_98492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356489.1|99207_99480_+	nucleotide excision repair protein	NA	A0A2H4J3B6	uncultured_Caudovirales_phage	41.0	1.3e-08
WP_000790610.1|99479_100013_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_000891157.1|100023_100632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001020646.1|100628_101180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000651490.1|101239_101659_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_000919078.1|101660_101954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000077458.1|101970_102954_-	ParM/StbA family protein	NA	A7KUY1	Bacillus_phage	24.4	2.1e-08
WP_000375812.1|103425_103992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000127321.1|103996_104284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000350011.1|104268_105369_+	plasmid replication protein	NA	NA	NA	NA	NA
WP_000883925.1|106405_106840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000946102.1|106857_107973_-	phosphoadenosine phosphosulfate reductase family protein	NA	H7BVI4	unidentified_phage	29.1	6.4e-46
WP_000849071.1|108241_108850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000393785.1|108854_109376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000805800.1|109378_109900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326180.1|110026_110470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902149.1|110459_110774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000539392.1|110778_111633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326179.1|111614_112592_+	S49 family peptidase	NA	Q9JMP1	Wolbachia_phage	31.5	7.1e-17
WP_000139698.1|112607_113468_+	DsbA family protein	NA	NA	NA	NA	NA
WP_000591074.1|113501_113930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422768.1|113986_114346_+	hypothetical protein	NA	A0A076G835	Escherichia_phage	49.4	5.6e-20
WP_000919345.1|114345_114792_+	Fe3+-siderophore ABC transporter permease	NA	NA	NA	NA	NA
WP_000210756.1|114788_115307_+	nitrite reductase	NA	NA	NA	NA	NA
WP_000972663.1|115306_115537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001167032.1|115523_116381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236377.1|116611_117139_+	thermonuclease family protein	NA	O64020	Bacillus_phage	37.0	1.3e-09
WP_001043047.1|117196_117469_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	59.6	4.2e-20
WP_001239997.1|117556_117850_+	chromosome segregation protein ParM	NA	NA	NA	NA	NA
WP_000124640.1|117876_118179_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000270043.1|118183_118534_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_001061574.1|118696_119245_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000343597.1|119585_119780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000516916.1|119790_120162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001281821.1|120154_120625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326176.1|120639_120981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000286591.1|121098_121560_+	DUF1643 domain-containing protein	NA	B5WZV8	Pseudomonas_phage	60.5	1.5e-46
WP_000062185.1|121562_122060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067834.1|122325_123030_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_000018329.1|123219_124035_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|124185_124890_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
124961:125020	attL	GTCGAGATTGGTGCAGATCACTTCTGATATTGAACTGTCAGGAGCTGGCTGCACAACAGC	NA	NA	NA	NA
WP_004152787.1|125263_125404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|125386_125887_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|126014_126854_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|126847_127195_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001355915.1|127395_127869_-	trimethoprim-resistant dihydrofolate reductase DfrA15	NA	G3MBI7	Bacillus_virus	30.8	6.9e-18
WP_000845048.1|128025_129039_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067855.1|129575_130280_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001389365.1|130420_131185_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001375131.1|131248_131506_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A077SL39	Escherichia_phage	61.9	8.9e-12
131609:131705	attR	GTCGAGATTGGTGCAGATCACTTCTGATATTGAACTGTCAGGAGCTGGCTGCACAACAGCCATTACGCCCAATCAACTGGTGCAGTCGTCTTCTGAA	NA	NA	NA	NA
