The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046722	Pantoea agglomerans strain ASB05 chromosome, complete genome	4022781	1182179	1264695	4022781	plate,transposase,tRNA,integrase,head,tail,capsid	Enterobacteria_phage(23.68%)	92	1213667:1213688	1241602:1241623
WP_158131468.1|1182179_1182632_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_022625112.1|1182646_1183117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158131469.1|1183208_1184594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158131470.1|1185090_1185408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088234235.1|1185468_1186615_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.7	3.2e-149
WP_158131471.1|1186691_1187135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158131472.1|1187265_1187970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158131473.1|1188002_1189337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158131474.1|1189608_1189821_+	AlpA family phage regulatory protein	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	39.2	8.7e-05
WP_158131475.1|1189861_1190473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158131476.1|1190797_1192018_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_158131477.1|1192004_1193318_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_158131478.1|1193314_1194946_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_158131479.1|1194946_1195372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158131480.1|1195445_1195847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158131481.1|1196010_1197024_-	DUF4263 domain-containing protein	NA	NA	NA	NA	NA
WP_158131482.1|1197026_1197359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158131483.1|1198633_1199731_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_158131484.1|1199736_1200141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158131485.1|1200572_1201151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158131486.1|1201414_1201687_+	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
WP_158131487.1|1201683_1203078_+	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	28.5	8.5e-48
WP_158131488.1|1203070_1204183_+	His-Xaa-Ser system radical SAM maturase HxsC	NA	NA	NA	NA	NA
WP_132499757.1|1204179_1204815_+	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
WP_132499756.1|1204834_1206445_+	sporadically distributed, TIGR04141 family protein	NA	NA	NA	NA	NA
WP_158131489.1|1206441_1207314_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_158131490.1|1207321_1208194_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_158131491.1|1208194_1209727_-	recombinase family protein	NA	A0A097BYD1	Leuconostoc_phage	26.1	2.7e-07
WP_158131492.1|1210202_1210601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158131493.1|1210680_1211127_-	DUF943 family protein	NA	NA	NA	NA	NA
WP_158131494.1|1211119_1211923_-	DUF3289 family protein	NA	NA	NA	NA	NA
WP_158131495.1|1212183_1213434_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	41.5	6.4e-79
1213667:1213688	attL	ATATCCATTTAACTAAGAGGAC	NA	NA	NA	NA
WP_158131496.1|1213881_1215051_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	83.3	2.3e-195
WP_158131497.1|1215267_1215615_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	67.0	5.2e-39
WP_158131498.1|1215614_1216370_-	DNA cytosine methyltransferase	NA	A0A2I7QZY6	Vibrio_phage	54.1	1.4e-60
WP_158131499.1|1216366_1216993_-	hypothetical protein	NA	M1F3E2	Salmonella_phage	61.7	1.3e-69
WP_158131500.1|1216989_1217718_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	30.1	3.2e-14
WP_158131501.1|1217714_1218131_-	hypothetical protein	NA	A0A248SL59	Klebsiella_phage	40.7	4.8e-15
WP_158131502.1|1218127_1218571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033771331.1|1218582_1218747_-	DUF1317 family protein	NA	NA	NA	NA	NA
WP_158131503.1|1218733_1219270_-	HD family hydrolase	NA	A0A192Y8M4	Salmonella_phage	58.1	1.1e-51
WP_158131504.1|1220585_1221311_-	phage repressor protein C	NA	K7PK07	Enterobacteria_phage	67.6	9.2e-54
WP_134160974.1|1221423_1221654_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	58.6	1.8e-16
WP_158131505.1|1221685_1222222_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	42.3	2.0e-21
WP_158131506.1|1222507_1222690_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_158131507.1|1222686_1223580_+	transcriptional regulator	NA	H2DE83	Erwinia_phage	62.2	5.6e-37
WP_158131508.1|1223592_1224027_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_158131509.1|1225680_1226895_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	81.3	5.6e-181
WP_069730023.1|1227235_1227565_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	51.9	4.2e-22
WP_158131510.1|1227566_1227956_+|head	phage head closure protein	head	U5P0R0	Shigella_phage	57.4	4.3e-34
WP_158131511.1|1227948_1228455_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	77.7	5.8e-71
WP_158131512.1|1228451_1229012_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	68.3	1.9e-70
WP_158131513.1|1229015_1229204_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	55.4	8.0e-10
WP_158131514.1|1229203_1230700_+|tail	phage tail protein	tail	A0A192Y7L1	Salmonella_phage	66.3	1.4e-184
WP_010246516.1|1230699_1231056_+	hypothetical protein	NA	Q8W622	Enterobacteria_phage	83.1	2.0e-49
WP_010246514.1|1231052_1231322_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	77.5	1.1e-33
WP_158131515.1|1231463_1233347_+|tail	phage tail tape measure protein	tail	M1FQW0	Enterobacteria_phage	75.4	2.0e-172
WP_158131516.1|1233359_1233854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158131517.1|1233897_1235274_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	53.3	2.3e-130
WP_158131518.1|1235270_1236341_+|plate	baseplate protein	plate	M1FN92	Enterobacteria_phage	68.8	1.9e-140
WP_158131519.1|1236340_1236898_+|plate	phage baseplate assembly protein V	plate	A0A192Y8K5	Salmonella_phage	64.9	3.9e-60
WP_158131520.1|1236894_1237308_+	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	64.2	6.8e-46
WP_158131521.1|1237300_1238368_+|plate	phage baseplate protein	plate	Q8SBG4	Shigella_phage	63.7	3.3e-132
WP_158131522.1|1238358_1238940_+	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	62.4	4.2e-65
WP_158131523.1|1238942_1239605_+|integrase	integrase	integrase	K7P7Q7	Enterobacteria_phage	45.2	5.3e-24
WP_158132150.1|1239604_1240204_+|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	45.9	3.1e-39
WP_158131524.1|1240924_1241164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158131525.1|1241166_1241490_+	phage repressor protein	NA	A0A2H4J4R6	uncultured_Caudovirales_phage	63.6	1.0e-33
WP_010671426.1|1241927_1242863_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	77.2	1.7e-116
1241602:1241623	attR	ATATCCATTTAACTAAGAGGAC	NA	NA	NA	NA
WP_033767505.1|1243105_1243723_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A1V0SE00	Indivirus	26.8	2.9e-08
WP_010257910.1|1243722_1244382_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_158131526.1|1244450_1245191_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_010257916.1|1245187_1245421_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_010671430.1|1245417_1245903_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_010257919.1|1245899_1247858_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_158131527.1|1247854_1248412_+	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_022625093.1|1248408_1248861_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_158131528.1|1248860_1250069_+	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_010257927.1|1250219_1250984_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_010671434.1|1251120_1252404_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_010671435.1|1252762_1253059_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_022625090.1|1253217_1254528_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_158131529.1|1254527_1256624_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_010257941.1|1256848_1257331_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_010257944.1|1257360_1257909_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_158131530.1|1258068_1259001_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_010257950.1|1259046_1260132_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.7	4.5e-89
WP_010257953.1|1260136_1260961_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_010257955.1|1260969_1261773_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_003854284.1|1261792_1262338_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_010257960.1|1262370_1262655_+	YfcL family protein	NA	NA	NA	NA	NA
WP_158131531.1|1262688_1264695_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP046722	Pantoea agglomerans strain ASB05 chromosome, complete genome	4022781	2296564	2306787	4022781	tRNA	Bacillus_phage(14.29%)	12	NA	NA
WP_010245666.1|2296564_2297023_-	endopeptidase	NA	A0A217EQL1	Bacillus_phage	37.5	5.5e-12
WP_158131744.1|2297091_2297841_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	NA	NA	NA	NA
WP_010670029.1|2297841_2298387_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	37.4	3.5e-13
WP_033771623.1|2298437_2299421_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_003853259.1|2299600_2299903_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.3e-13
WP_062757528.1|2299907_2302295_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	32.0	4.1e-10
WP_158131745.1|2302309_2303293_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	37.6	2.9e-34
WP_106120997.1|2303440_2303485_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_003853267.1|2303607_2303964_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_010245683.1|2304006_2304204_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_029519030.1|2304303_2304855_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.4	6.4e-15
WP_010245687.1|2304858_2306787_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	3.7e-126
>prophage 3
NZ_CP046722	Pantoea agglomerans strain ASB05 chromosome, complete genome	4022781	2495031	2502247	4022781	integrase	Phage_21(33.33%)	10	2487781:2487796	2508477:2508492
2487781:2487796	attL	TAATCTGCTCCAGCAT	NA	NA	NA	NA
WP_158131818.1|2495031_2495970_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	60.4	1.2e-85
WP_158131819.1|2495959_2496157_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_158131820.1|2496406_2496895_-	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	69.8	1.9e-63
WP_158131821.1|2496887_2497112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158131822.1|2497165_2497846_+	helix-turn-helix domain-containing protein	NA	K7PM82	Enterobacteria_phage	33.3	2.8e-20
WP_158131823.1|2498328_2498766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158131824.1|2498765_2499491_+	DUF2786 domain-containing protein	NA	A0A1W6DYA0	Aeromonas_phage	28.6	4.9e-07
WP_158131825.1|2499516_2499768_+	excisionase	NA	NA	NA	NA	NA
WP_158131826.1|2499742_2500876_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	73.7	3.8e-155
WP_158131827.1|2500996_2502247_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	85.2	2.2e-18
2508477:2508492	attR	ATGCTGGAGCAGATTA	NA	NA	NA	NA
>prophage 4
NZ_CP046722	Pantoea agglomerans strain ASB05 chromosome, complete genome	4022781	3101601	3109327	4022781	tRNA	uncultured_Mediterranean_phage(50.0%)	9	NA	NA
WP_010255369.1|3101601_3102072_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.7	1.2e-30
WP_158131957.1|3102162_3103263_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.3	6.7e-48
WP_009091750.1|3103266_3103716_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_010255362.1|3103904_3104342_+	peptidoglycan-binding protein LysM	NA	G3MBQ1	Bacillus_virus	50.0	7.3e-06
WP_158131958.1|3104358_3104928_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_010255357.1|3104994_3105963_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	39.9	3.6e-45
WP_010255355.1|3105973_3107821_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_010255353.1|3107846_3108179_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	36.3	5.7e-11
WP_010255351.1|3108178_3109327_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.4	1.9e-90
>prophage 5
NZ_CP046722	Pantoea agglomerans strain ASB05 chromosome, complete genome	4022781	3179556	3188927	4022781		Streptococcus_phage(25.0%)	10	NA	NA
WP_003854408.1|3179556_3179769_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	71.4	9.3e-23
WP_010671164.1|3180150_3181905_-	phage-like EPS depolymerase	NA	A0A1S6L3G8	Erwinia_phage	46.0	5.0e-154
WP_010255207.1|3182108_3182402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010255205.1|3182398_3182746_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	45.6	4.1e-20
WP_010255203.1|3182742_3183210_-	glycoside hydrolase family protein	NA	H9C148	Vibrio_phage	44.0	6.8e-26
WP_071785064.1|3183414_3183693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010255201.1|3184116_3184848_-	chromophore lyase	NA	A0A2I6PIE7	Escherichia_phage	37.1	1.1e-46
WP_033756712.1|3185208_3186462_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.6	5.1e-92
WP_010255198.1|3186472_3187576_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	1.7e-59
WP_010255197.1|3187814_3188927_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.2	3.3e-111
