The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046728	Mycobacterium tuberculosis strain TCDC11 chromosome, complete genome	4418417	2937219	2975491	4418417	terminase,head,integrase,protease,tRNA,capsid	Mycobacterium_phage(30.0%)	47	2966020:2966047	2975644:2975671
WP_003413486.1|2937219_2939298_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2939406_2939634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009940032.1|2939630_2941016_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2941360_2941861_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2941877_2942318_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2942464_2943142_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2943126_2943480_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2943492_2943918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003901438.1|2943914_2944589_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2944666_2945488_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2945623_2946517_+	universal stress protein TB31.7	NA	NA	NA	NA	NA
WP_003413594.1|2946519_2947338_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2947352_2948534_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2948592_2949024_-	hypoxic response protein Hrp1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2949537_2950779_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2951088_2951451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003902322.1|2951797_2952922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2952923_2953463_+	archease	NA	NA	NA	NA	NA
WP_003413616.1|2953602_2954901_+	RtcB family protein	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2954939_2955221_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2955365_2955851_-	non-heme di-iron catalase	NA	NA	NA	NA	NA
WP_003908019.1|2955877_2956132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2956135_2958472_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2958500_2958743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2958743_2959421_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2959616_2960273_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2960435_2960882_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2961056_2961389_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2961508_2961868_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2961969_2962428_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2962563_2962944_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2962940_2964437_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_003912823.1|2964671_2964863_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
2966020:2966047	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2966153_2966585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2966581_2967580_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2967593_2968058_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003908028.1|2968045_2968297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003901443.1|2968467_2969907_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2969914_2970448_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003900541.1|2970600_2971092_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	9.4e-18
WP_003899414.1|2971258_2971582_-	type II toxin-antitoxin system toxin	NA	NA	NA	NA	NA
WP_003899415.1|2971661_2971907_-	type II toxin-antitoxin system antitoxin	NA	NA	NA	NA	NA
WP_003899416.1|2971903_2973331_-	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_003899417.1|2973332_2973725_-	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_003899418.1|2973721_2973982_-	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
WP_003900543.1|2973998_2974361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899420.1|2974363_2975491_-|integrase	site-specific integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
2975644:2975671	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
