The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044346	Escherichia coli strain P225M chromosome, complete genome	4771080	869605	933103	4771080	holin,tail,transposase,integrase,head,capsid	Enterobacteria_phage(43.9%)	68	869534:869593	915885:916137
869534:869593	attL	GAGCCTGTACATAGATTTGTGTAATTGCCTGATTTTGATATGTTCAATCCAGCATCAAAT	NA	NA	NA	NA
WP_000343717.1|869605_870814_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	3.7e-47
WP_000885611.1|870924_871500_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000279080.1|871499_874574_-	hypothetical protein	NA	U5N099	Enterobacteria_phage	82.1	2.5e-68
WP_001230375.1|874638_875238_-	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	5.7e-110
WP_157701474.1|878522_878804_-|tail	phage tail protein	tail	C6ZCZ5	Enterobacteria_phage	98.6	9.4e-31
WP_000090895.1|878866_879499_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	89.5	5.5e-95
WP_000194783.1|879435_880179_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.2e-146
WP_001152640.1|880184_880883_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	1.5e-133
WP_000847379.1|880882_881212_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000840342.1|881208_883770_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	91.7	0.0e+00
WP_000479142.1|884177_884600_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.1e-70
WP_000683105.1|885359_885755_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975070.1|885751_886330_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000753007.1|886341_886695_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	99.1	4.4e-62
WP_000158905.1|886706_887105_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	99.2	1.2e-63
WP_087604858.1|887146_887911_-|capsid	major capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	99.6	1.0e-140
WP_001178671.1|890073_890457_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000190772.1|890468_890810_-|head	head decoration protein	head	NA	NA	NA	NA
WP_025693427.1|890819_891860_-|capsid	phage capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.4	2.6e-65
WP_001710062.1|892076_892526_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001356810.1|892522_892780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000425298.1|894809_895109_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_016247986.1|895126_895348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001156310.1|895348_895540_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	59.3	1.1e-11
WP_000920681.1|895539_895725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061351175.1|895717_896050_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_024164959.1|896060_896252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000737990.1|897621_897852_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000896722.1|897853_899089_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	44.9	1.4e-99
WP_001365132.1|899221_899491_-|capsid	capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	100.0	5.3e-39
WP_001295978.1|899553_899886_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_157701475.1|900753_900903_-	hypothetical protein	NA	A0A2I6TC87	Escherichia_phage	100.0	7.9e-13
WP_157701476.1|901581_901833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000198149.1|902723_902930_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_000453611.1|904764_905310_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001309517.1|906900_907056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|907135_907201_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_157701477.1|908020_908467_-	DUF2514 family protein	NA	A0A291LBG9	Klebsiella_phage	49.1	6.3e-05
WP_001092971.1|908463_908997_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_097727610.1|908993_909248_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	58.7	7.2e-14
WP_157701478.1|910384_910585_-|holin	holin	holin	A5LH82	Enterobacteria_phage	92.9	1.1e-22
WP_157701479.1|911853_912063_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|912117_912207_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|912484_913237_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265199.1|913250_914300_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	2.8e-112
WP_012304870.1|914301_914580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310834.1|916487_916844_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
915885:916137	attR	ATTTGATGCTGGATTGAACATATCAAAATCAGGCAATTACACAAATCTATGTACAGGCTCTGGCGCGTAGCACTGCCGACTGAATAACACATCCCCGTCAATACGGTTCTTGCTGCACGCTTACTCAAAACTGATGTTATATTTAGCTGAACAAAAATCAGCCACTTTGTTCTTCCTCATCGTCTTTTATTTCGTGGTATGAGTAATTGCAGTAGTTAAAGAAAATTTCTTATGCTCCGTCATGAATTTCCTC	NA	NA	NA	NA
WP_001151262.1|916840_917263_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_000054512.1|917303_918269_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	2.2e-55
WP_000705358.1|918249_918771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|918754_918985_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|919068_919476_+	helix-turn-helix domain-containing protein	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|919642_919798_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171942.1|919957_920176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329848.1|920179_920344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|920743_920932_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083297.1|920928_921120_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_025693413.1|921212_923684_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001296941.1|923771_924008_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_157701480.1|925343_925454_-	transporter	NA	NA	NA	NA	NA
WP_000836066.1|925511_926531_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|926542_927757_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|927962_928289_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|928423_928765_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|928799_929360_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|929362_930073_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_157701559.1|930250_930472_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041675.1|930676_933103_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
>prophage 2
NZ_CP044346	Escherichia coli strain P225M chromosome, complete genome	4771080	2125962	2139725	4771080	transposase	Escherichia_phage(50.0%)	12	NA	NA
WP_001272928.1|2125962_2128524_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_025693381.1|2128629_2129286_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	45.8	5.2e-48
WP_001300386.1|2129336_2130104_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000847985.1|2130299_2131208_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590403.1|2131204_2132467_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_001278994.1|2132463_2133102_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136934.1|2133106_2133883_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104441.1|2133971_2135336_+	GntP family transporter	NA	NA	NA	NA	NA
WP_157701563.1|2135429_2136278_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	4.0e-32
WP_157701502.1|2136389_2137580_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	99.7	4.2e-229
WP_001272592.1|2137819_2138959_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|2139098_2139725_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
>prophage 3
NZ_CP044346	Escherichia coli strain P225M chromosome, complete genome	4771080	3372320	3451226	4771080	holin,tail,terminase,lysis,tRNA,protease,plate,portal,head,capsid	Escherichia_phage(58.97%)	77	NA	NA
WP_000560983.1|3372320_3372758_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001297068.1|3372802_3373744_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_157701578.1|3375088_3375313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000331377.1|3377201_3378104_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_077248221.1|3378116_3381167_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000753617.1|3381360_3382194_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_001295677.1|3382350_3383406_+	YiiG family protein	NA	NA	NA	NA	NA
WP_000931299.1|3383455_3385204_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_001019486.1|3385203_3386274_-	aminopeptidase	NA	NA	NA	NA	NA
WP_000446015.1|3386263_3387715_-	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000729595.1|3387725_3388172_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000619493.1|3388474_3388789_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_001179741.1|3388798_3389623_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_001311268.1|3389884_3391144_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144073.1|3391140_3392610_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217137.1|3392897_3393734_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_000863142.1|3393717_3394656_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_157701526.1|3394652_3395687_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_000122641.1|3395971_3396592_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	8.4e-64
WP_001166063.1|3396851_3397835_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270260.1|3397983_3398658_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_157701527.1|3400416_3400635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001308179.1|3402781_3403054_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000217670.1|3403223_3403724_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|3403787_3404012_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277952.1|3404011_3404314_+	hypothetical protein	NA	A0A0F7LDT6	Escherichia_phage	96.0	2.5e-45
WP_001113270.1|3404313_3404538_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_000027659.1|3404534_3404810_+	hypothetical protein	NA	A0A0F7LCM4	Escherichia_phage	100.0	2.3e-45
WP_000268627.1|3404799_3407079_+	replication endonuclease	NA	Q858T4	Yersinia_virus	96.6	0.0e+00
WP_157701528.1|3407271_3409803_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_000038166.1|3410174_3411209_-|portal	phage portal protein	portal	U5N087	Enterobacteria_phage	99.1	1.6e-200
WP_000156872.1|3411208_3412981_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_001085956.1|3413154_3414009_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.6	1.7e-136
WP_001248567.1|3414067_3415141_+|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	98.9	2.2e-200
WP_024176422.1|3415144_3415888_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	96.4	4.6e-125
WP_000988633.1|3415987_3416497_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846414.1|3416496_3416700_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	2.6e-30
WP_000123123.1|3416703_3416985_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144097.1|3416984_3417482_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.5e-92
WP_000736582.1|3417496_3417922_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	92.9	3.7e-55
WP_000040631.1|3417909_3418335_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	94.3	1.3e-63
WP_000917160.1|3418442_3418910_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	3.3e-81
WP_001001770.1|3418902_3419355_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	97.3	4.5e-75
WP_001093698.1|3419421_3420057_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.5e-111
WP_000127167.1|3420053_3420401_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	3.8e-58
WP_001121501.1|3420405_3421314_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	3.7e-161
WP_001285346.1|3421306_3421918_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	1.4e-116
WP_001032315.1|3423212_3423629_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	46.0	3.4e-21
WP_024176421.1|3423600_3424203_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	75.5	2.5e-81
WP_001333405.1|3424217_3424733_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	56.8	5.0e-46
WP_000839179.1|3424874_3425279_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_157701579.1|3427200_3427710_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	93.3	1.6e-73
WP_001031307.1|3429605_3429881_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|3429913_3430033_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_157701529.1|3430025_3432473_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.1	0.0e+00
WP_000978889.1|3432487_3432967_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_000882940.1|3432966_3434130_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	4.8e-206
WP_000468308.1|3434211_3434430_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001145759.1|3434687_3435200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001076742.1|3435407_3436310_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_000591795.1|3436490_3437453_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001045683.1|3437772_3438762_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001326656.1|3438868_3439624_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216326.1|3439678_3440446_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802214.1|3440553_3441153_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155257.1|3441253_3441694_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655989.1|3441905_3442205_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323556.1|3442231_3442660_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796332.1|3442664_3443411_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|3443507_3444518_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136788.1|3444652_3446161_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|3446183_3447029_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|3447453_3447699_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|3447783_3448269_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|3448361_3449288_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293341.1|3449354_3450686_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|3450695_3451226_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 4
NZ_CP044346	Escherichia coli strain P225M chromosome, complete genome	4771080	4167346	4243588	4771080	plate,protease,tRNA	uncultured_Mediterranean_phage(10.0%)	60	NA	NA
WP_000753946.1|4167346_4168771_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
WP_000929443.1|4168925_4170083_+	CdaR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000272188.1|4170171_4170558_-	DUF3461 family protein	NA	NA	NA	NA	NA
WP_000625631.1|4170719_4171532_-	phosphodiesterase YaeI	NA	NA	NA	NA	NA
WP_001186650.1|4171585_4172410_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_001094586.1|4172440_4175113_-	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_001018194.1|4175174_4175969_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_000246882.1|4176336_4177062_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_000818114.1|4177319_4178171_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_000224573.1|4178317_4179043_+	UMP kinase	NA	NA	NA	NA	NA
WP_000622418.1|4179334_4179892_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_000811923.1|4179983_4181180_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_025693400.1|4181368_4182127_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
WP_000922446.1|4182139_4182997_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001295561.1|4183008_4184361_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|4184390_4186823_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|4186944_4187430_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|4187433_4188459_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|4188563_4189019_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|4189022_4189811_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139654.1|4189810_4190959_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|4190955_4191552_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|4191588_4195071_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|4195083_4196043_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|4196141_4198283_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901099.1|4198339_4198729_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176549.1|4198793_4200092_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|4200140_4200401_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|4200387_4200588_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|4200753_4201299_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635537.1|4201295_4201718_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239163.1|4201731_4202442_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001336393.1|4202641_4203466_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260712.1|4203519_4205238_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|4205349_4206057_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|4206053_4206458_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874226.1|4206575_4207391_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|4207430_4208084_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000594006.1|4208076_4209108_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
WP_001140187.1|4209295_4209871_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997010.1|4215633_4216437_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_000648572.1|4216433_4217348_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|4217588_4218389_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000016007.1|4218392_4219016_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000644685.1|4219063_4220422_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001326702.1|4221279_4222002_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|4221998_4222466_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001340895.1|4222530_4223262_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
WP_157701535.1|4223793_4224435_+	aminopeptidase	NA	NA	NA	NA	NA
WP_001087741.1|4226512_4227865_-	membrane protein	NA	NA	NA	NA	NA
WP_122545204.1|4227875_4231310_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240525.1|4231418_4232831_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000614325.1|4233574_4236340_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
WP_000343289.1|4236348_4237110_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246443.1|4237114_4238446_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|4238448_4238973_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113713.1|4238969_4240250_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|4240274_4241357_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393852.1|4241320_4243171_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611744.1|4243174_4243588_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 5
NZ_CP044346	Escherichia coli strain P225M chromosome, complete genome	4771080	4276979	4290982	4771080		Morganella_phage(18.18%)	15	NA	NA
WP_000893278.1|4276979_4278233_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_000035054.1|4280229_4280433_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
WP_000412531.1|4280432_4280864_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.7	2.3e-28
WP_032312024.1|4280876_4281710_+	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
WP_025693500.1|4281879_4282947_+	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	38.4	5.0e-16
WP_001065738.1|4282939_4283134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001024675.1|4283130_4283394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000181940.1|4283390_4283612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001058748.1|4283604_4284207_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	36.3	2.6e-25
WP_000628967.1|4284217_4284559_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	61.5	2.5e-33
WP_001208878.1|4284551_4284923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001585368.1|4284909_4287666_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.3	1.8e-299
WP_000420674.1|4288428_4288890_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	72.2	2.9e-61
WP_000909175.1|4288883_4289561_+	hypothetical protein	NA	Q2A0B2	Sodalis_phage	71.6	9.2e-56
WP_025693499.1|4289560_4290982_+	DNA transfer protein	NA	B6SCW4	Bacteriophage	52.7	4.1e-122
>prophage 6
NZ_CP044346	Escherichia coli strain P225M chromosome, complete genome	4771080	4544383	4633484	4771080	tail,lysis,tRNA,protease,transposase,integrase,portal,head	Enterobacteria_phage(42.31%)	82	4566495:4566541	4613232:4613278
WP_001118619.1|4544383_4545307_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
WP_001310618.1|4545895_4547131_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703900.1|4547152_4548202_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580822.1|4548520_4550188_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_025693488.1|4550197_4551457_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|4551467_4552283_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855378.1|4552279_4553173_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815571.1|4553367_4554435_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|4554431_4554941_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212247.1|4555058_4555781_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|4555783_4556278_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912385.1|4556451_4557837_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|4557872_4558394_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|4558501_4558714_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|4558715_4559582_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_001333622.1|4561442_4564046_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_157701541.1|4564024_4565062_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_157701542.1|4565072_4565609_+	fimbria assembly protein	NA	NA	NA	NA	NA
4566495:4566541	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_000051902.1|4566554_4567718_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000446905.1|4567573_4567945_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000488407.1|4567916_4568195_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763385.1|4568242_4568461_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_001386642.1|4568559_4568841_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000548514.1|4568851_4569043_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000682305.1|4569015_4569198_-	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	98.3	2.8e-28
WP_157701543.1|4569194_4569875_-	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	6.7e-131
WP_000100847.1|4569871_4570657_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|4570662_4570959_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_157701544.1|4571032_4571176_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	7.9e-18
WP_001198865.1|4571144_4571309_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	98.1	3.1e-26
WP_000065359.1|4571381_4571750_-	DUF2528 family protein	NA	K7PGR6	Enterobacteria_phage	98.4	7.6e-65
WP_000392425.1|4571945_4572395_-	hypothetical protein	NA	I6RSN8	Salmonella_phage	88.6	1.9e-70
WP_000088205.1|4572679_4572952_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	2.2e-40
WP_000478870.1|4573378_4573663_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_000854876.1|4573674_4573971_-	DUF1902 domain-containing protein	NA	NA	NA	NA	NA
WP_096246228.1|4574143_4574839_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	99.1	4.3e-133
WP_000067727.1|4574914_4575130_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000438492.1|4575271_4575568_+	Regulatory protein CII from phage origin	NA	A0A0N7KZD0	Stx2-converting_phage	99.0	8.9e-48
WP_000185506.1|4575600_4576500_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	99.7	5.5e-173
WP_000788798.1|4576496_4577198_+	hypothetical protein	NA	A0A0P0ZD31	Stx2-converting_phage	99.1	3.8e-129
WP_000676507.1|4577194_4577485_+	hypothetical protein	NA	A0A1I9LJP5	Stx_converting_phage	99.0	3.7e-46
WP_000736903.1|4577558_4577999_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000153280.1|4577995_4578523_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_001254223.1|4578519_4578696_+	NinE family protein	NA	K7PHE6	Enterobacteria_phage	98.3	1.4e-27
WP_000386643.1|4578698_4579040_+	DUF2591 domain-containing protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_000950955.1|4579032_4579227_+	protein ninF	NA	NA	NA	NA	NA
WP_001099655.1|4579246_4579609_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	97.4	7.3e-60
WP_000971071.1|4579605_4579746_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	2.5e-08
WP_157701545.1|4579831_4580242_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	81.7	3.2e-56
WP_000737266.1|4580401_4581499_-	porin	NA	Q1MVN1	Enterobacteria_phage	76.5	2.2e-155
WP_000839596.1|4582089_4582305_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001362419.1|4582304_4582799_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	1.7e-88
WP_001228695.1|4583015_4583198_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|4583288_4583582_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001415975.1|4583944_4584139_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_000198149.1|4586962_4587169_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001349919.1|4587165_4588767_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.6	5.9e-311
WP_001358225.1|4590055_4590388_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
WP_000785282.1|4591911_4592265_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000975081.1|4592276_4592855_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683105.1|4592851_4593247_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_157701546.1|4597300_4597588_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	97.8	2.1e-46
WP_000140728.1|4598276_4599020_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	5.4e-150
WP_157701547.1|4598917_4599310_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	100.0	1.1e-64
WP_001233090.1|4603175_4603775_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_157701548.1|4608980_4609649_-	methyltransferase	NA	NA	NA	NA	NA
WP_157701549.1|4609705_4610017_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001201842.1|4611854_4612808_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177471.1|4613321_4614083_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
4613232:4613278	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224604.1|4614265_4615156_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001333623.1|4615156_4618129_-	phage receptor	NA	NA	NA	NA	NA
WP_000383969.1|4618115_4620353_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000253839.1|4620502_4621945_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.2	3.0e-11
WP_000770953.1|4621934_4622618_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000074234.1|4622774_4624148_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000709870.1|4624305_4624638_+	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000717157.1|4624653_4625877_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000573945.1|4625888_4629032_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
WP_000786319.1|4629133_4630510_+	phenylalanine transporter	NA	NA	NA	NA	NA
WP_001153148.1|4630590_4631838_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000351487.1|4631945_4632599_-	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_001067855.1|4632779_4633484_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 1
NZ_CP044348	Escherichia coli strain P225M plasmid pP225M-2, complete sequence	94752	42183	88221	94752	protease,transposase,integrase	Escherichia_phage(50.0%)	31	59758:59817	73521:74342
WP_072134990.1|42183_42516_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001398199.1|42800_43202_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001351729.1|50137_50530_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000844627.1|52342_52585_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000470728.1|52616_53294_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000058717.1|54579_55464_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001351729.1|55601_55994_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_157701613.1|57615_58317_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	91.5	6.2e-124
WP_000018329.1|58856_59672_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
59758:59817	attL	AGGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGC	NA	NA	NA	NA
WP_001067834.1|59822_60527_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_157701614.1|60974_61994_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	42.5	4.4e-62
WP_004201280.1|62149_62623_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_157701615.1|62692_63364_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	93.1	1.9e-114
WP_000427619.1|66807_67812_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000954592.1|67993_68170_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001043260.1|68499_69315_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001067855.1|69391_70096_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002063889.1|71074_71617_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001067834.1|72810_73515_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_001067855.1|75939_76644_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
73521:74342	attR	GCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCTATTTTTCGGGGATCTGATTGCCCTCTGGCAATATCATTCAGCACGCCATAGTCGGCATCATGGTCCATTCGCCAGAAAACCGAAGCACCGGCATCAGCCAGGCGTGGAGAAAACTGGTATCCCAGCAGCCAGAAAAGGCCAAAGACAAGTTCGCCAAGAATCCGCTGTATCGGTCATACTGGTTGATCTGTGCCCTCGAAACTTCCGTTCCAGAAGACCTTCCAGCACAAAGATAGAGTCCCTCAGCGTCCCCGGTATAACGATGCCATGAAAGCCGGAATACTGATCGGACACAAAGTTGTACCAGGTGATCCCTCTGTTATTACCAAAGTATTTGCGGTTCGGTCCGGCATTGATTGTTCTGACTGGCGTAACAAAGCGCATTCCATCTGCAGATGCCACTTCTCCTCCACCCCATATCTGTGCCAGTGGCAGCGTTGCCTGAAAATCAACCAGTCTGGCATTAGCGCTGGTGATAGTTTCAGCCCGCAGATAGTTCGCTTTTGTCCAGTTCAGCCGGTGTCGGGTCAGTGCAGGAACATTTGATCTGATCAGTGGTTCCAGACCGATATTGCAGGCTTCAGCCATCAGCACGGCGCTGATGCTGACGGGCAGATCATCAACTCTGGCACTGGCTTCACTAGCATGGAAAAACTCATCAGCAAATCCGGTATGGGCGTTAATTTCGAGCAGCAACTCCGTTAAATCCACCGGAGGGAGTAGATCACTGATCATTTTGCTCAGTCGTTTCAGACTGTCCGG	NA	NA	NA	NA
WP_072042932.1|77245_77479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001206316.1|78611_79403_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000800531.1|79572_79905_+	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_000034420.1|81084_81876_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_001354008.1|82344_82590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000612791.1|82627_83491_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_011264039.1|83636_83876_-	macrolide transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	46.2	9.5e-08
WP_001067834.1|83948_84653_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_000939727.1|84805_85627_-	lincosamide nucleotidyltransferase Lnu(F)	NA	NA	NA	NA	NA
WP_032491824.1|85758_86550_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA22	NA	NA	NA	NA	NA
WP_001067855.1|87516_88221_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 1
NZ_CP044347	Escherichia coli strain P225M plasmid pP225M-CTX-M-55, complete sequence	142472	45307	121598	142472	bacteriocin,tRNA,integrase,transposase	Enterobacteria_phage(23.08%)	43	45912:45927	130511:130526
WP_000911313.1|45307_45706_-|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_077944073.1|45705_45936_-	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
45912:45927	attL	TGAAAAATACGGTGGT	NA	NA	NA	NA
WP_000205749.1|51303_52050_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	29.7	8.7e-07
WP_000704513.1|52108_52969_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	9.7e-10
WP_001312851.1|54654_54804_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000083845.1|55087_55345_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001442103.1|55576_55651_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_001324615.1|55631_56126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000774297.1|56118_56976_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_000557619.1|58671_58929_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|58861_59263_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001067855.1|60573_61278_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000470728.1|63169_63847_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_157701595.1|63891_65121_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000845048.1|69656_70670_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067855.1|71357_72062_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_157701586.1|72432_75387_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.8	0.0e+00
WP_157701587.1|78267_78501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157701588.1|83703_83949_-	hypothetical protein	NA	Q1MVP5	Enterobacteria_phage	95.6	1.8e-17
WP_157701597.1|84001_84439_-	DUF4158 domain-containing protein	NA	Q1MVP5	Enterobacteria_phage	71.7	1.7e-47
WP_157701589.1|88574_88907_-	hypothetical protein	NA	A0A0K2CZ57	Paenibacillus_phage	40.0	2.6e-11
WP_157701591.1|88813_89110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157701592.1|90687_90960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157701598.1|92001_92208_-	macrolide transporter	NA	A0A1B0RXA6	Streptococcus_phage	47.5	3.1e-07
WP_157701593.1|94657_94840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157701599.1|97651_98440_+	class A beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	96.6	2.0e-139
WP_001393253.1|103044_103377_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_015387340.1|103423_104299_-	class A extended-spectrum beta-lactamase CTX-M-55	NA	A0A1B0VBP7	Salmonella_phage	82.1	2.4e-125
WP_000521603.1|106182_106800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000194575.1|108798_109389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343085.1|109388_109646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000350638.1|109999_112138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001044768.1|112299_112716_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261287.1|112712_112943_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000111771.1|113238_113529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000963206.1|113518_114418_+	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_000698737.1|114467_116693_-	phage T7 exclusion protein	NA	NA	NA	NA	NA
WP_000952217.1|116694_117783_-	transcriptional repressor PifC	NA	NA	NA	NA	NA
WP_000493379.1|118327_118678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796228.1|118721_119411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016493.1|119407_120199_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	2.7e-51
WP_000864812.1|120379_120733_+	colicin M immunity protein	NA	NA	NA	NA	NA
WP_001312845.1|120782_121598_-|bacteriocin	lipid II-degrading bacteriocin colicin M	bacteriocin	NA	NA	NA	NA
130511:130526	attR	TGAAAAATACGGTGGT	NA	NA	NA	NA
