The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044298	Escherichia coli strain P59A chromosome, complete genome	4678881	1073995	1083436	4678881		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569315.1|1073995_1074922_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.0e-08
WP_000783120.1|1074926_1075658_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1075638_1075746_-	protein YohO	NA	NA	NA	NA	NA
WP_089580340.1|1075805_1076537_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.4e-110
WP_001295431.1|1076758_1078444_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1078440_1079160_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|1079206_1079677_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|1079716_1080178_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001375261.1|1080302_1082303_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001333512.1|1082299_1083436_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 2
NZ_CP044298	Escherichia coli strain P59A chromosome, complete genome	4678881	2501518	2543862	4678881	portal,terminase,capsid,integrase,protease,tail,lysis,head	Enterobacteria_phage(61.67%)	61	2522691:2522706	2545570:2545585
WP_001491017.1|2501518_2502103_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	5.4e-105
WP_072133999.1|2502102_2505465_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_001230375.1|2505529_2506129_-	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	5.7e-110
WP_157705044.1|2506198_2509612_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	97.7	0.0e+00
WP_000090944.1|2509672_2510281_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.6	7.6e-102
WP_096943825.1|2510217_2510961_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.3	3.0e-145
WP_001152634.1|2510966_2511665_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	2.1e-132
WP_000847379.1|2511664_2511994_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_134240115.1|2511990_2514552_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.6	0.0e+00
WP_000459457.1|2514544_2514979_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_001535872.1|2514960_2515383_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.0	7.7e-69
WP_044502411.1|2515398_2516139_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.8	2.5e-131
WP_000683129.1|2516146_2516542_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_032298608.1|2516538_2517117_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	1.7e-79
WP_000752994.1|2517128_2517482_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_021571135.1|2517493_2517892_-	hypothetical protein	NA	A0A0K2FIR1	Enterobacteria_phage	82.6	3.4e-50
WP_000063274.1|2517933_2518959_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.5	7.3e-190
WP_001299443.1|2519014_2519347_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_069904422.1|2519356_2520676_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	3.1e-233
WP_053271575.1|2520656_2522258_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	4.2e-309
WP_000198149.1|2522254_2522461_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027292.1|2522457_2524383_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	0.0e+00
2522691:2522706	attL	GCTCTTCAGCAGTCAG	NA	NA	NA	NA
WP_000453580.1|2524357_2524903_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001663509.1|2525291_2525525_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_001059339.1|2526303_2526828_-	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	94.2	4.5e-87
WP_001139682.1|2527030_2527183_-	hypothetical protein	NA	Q716B2	Shigella_phage	100.0	2.1e-21
WP_157705045.1|2527170_2527638_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	96.1	8.8e-74
WP_157705046.1|2527634_2528132_-	glycoside hydrolase family protein	NA	A0A291AWW2	Escherichia_phage	99.4	5.8e-92
WP_000839596.1|2528131_2528347_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737263.1|2528936_2530019_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	78.7	4.4e-161
WP_001204780.1|2530207_2530591_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_032084198.1|2530676_2530817_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	65.1	4.7e-07
WP_157705047.1|2530813_2531176_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	94.0	1.1e-58
WP_000950956.1|2531195_2531390_-	protein ninF	NA	NA	NA	NA	NA
WP_000386641.1|2531382_2531724_-	DUF2591 domain-containing protein	NA	Q76H72	Enterobacteria_phage	95.6	6.2e-61
WP_001254223.1|2531726_2531903_-	NinE family protein	NA	K7PHE6	Enterobacteria_phage	98.3	1.4e-27
WP_000153280.1|2531899_2532427_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000736903.1|2532423_2532864_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000145933.1|2532937_2533228_-	protein ren	NA	K7P7K7	Enterobacteria_phage	100.0	9.6e-47
WP_000788877.1|2533224_2533926_-	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	100.0	9.9e-130
WP_016063181.1|2533922_2534822_-	replication protein	NA	K7P7F0	Enterobacteria_phage	100.0	8.4e-174
WP_001177650.1|2534856_2535135_-	transcriptional regulator	NA	K7P7A2	Enterobacteria_phage	100.0	1.6e-43
WP_000620665.1|2535243_2535438_-	hypothetical protein	NA	K7PLQ6	Enterobacteria_phage	100.0	1.8e-28
WP_016063179.1|2535544_2536261_+	helix-turn-helix domain-containing protein	NA	K7P7K3	Enterobacteria_phage	100.0	9.2e-123
WP_016063178.1|2536278_2536647_+	hypothetical protein	NA	K7P6G1	Enterobacteria_phage	100.0	1.0e-56
WP_016063176.1|2537210_2537483_+	hypothetical protein	NA	K7P7A1	Enterobacteria_phage	100.0	3.6e-27
WP_021566050.1|2537498_2538080_-	hypothetical protein	NA	K7P6T7	Enterobacteria_phage	99.5	4.4e-99
WP_000213971.1|2538293_2538473_+	Restriction inhibitor protein ral	NA	M1FQU1	Enterobacteria_phage	100.0	6.6e-30
WP_053892839.1|2538676_2539045_+	DUF2528 family protein	NA	K7PGR6	Enterobacteria_phage	97.5	2.2e-64
WP_001198861.1|2539117_2539282_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372941.1|2539250_2539394_+	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_000995439.1|2539468_2539765_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100845.1|2539770_2540556_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000186779.1|2540552_2541233_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.1	7.9e-132
WP_000682306.1|2541229_2541412_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000548531.1|2541384_2541576_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_077630928.1|2541586_2541868_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.2e-46
WP_000763389.1|2541966_2542185_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	94.4	1.2e-33
WP_000488407.1|2542231_2542510_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_061351518.1|2542595_2542814_+	excisionase	NA	Q77WA4	Escherichia_phage	97.2	1.1e-34
WP_000533645.1|2542791_2543862_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	1.5e-201
2545570:2545585	attR	GCTCTTCAGCAGTCAG	NA	NA	NA	NA
>prophage 3
NZ_CP044298	Escherichia coli strain P59A chromosome, complete genome	4678881	3066444	3142466	4678881	plate,tRNA,protease	Bradyrhizobium_phage(12.5%)	58	NA	NA
WP_000611744.1|3066444_3066858_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_157705068.1|3066861_3068712_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|3068675_3069758_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_157705140.1|3071444_3072704_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_097451525.1|3072708_3073470_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_157705139.1|3076407_3076986_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_122545204.1|3078522_3081957_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087741.1|3081967_3083320_+	membrane protein	NA	NA	NA	NA	NA
WP_001284199.1|3083343_3083826_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_096967358.1|3083869_3084784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086141.1|3085405_3086191_-	lipoprotein	NA	NA	NA	NA	NA
WP_001340895.1|3086726_3087458_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
WP_000917883.1|3087522_3087990_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001326702.1|3087986_3088709_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052715.1|3088742_3089498_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|3089569_3090928_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000016007.1|3090975_3091599_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_001230983.1|3091602_3092403_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648572.1|3092643_3093558_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997010.1|3093554_3094358_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_039026197.1|3099942_3100518_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000594006.1|3100705_3101737_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
WP_001294600.1|3101729_3102383_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874226.1|3102422_3103238_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|3103355_3103760_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|3103756_3104464_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260712.1|3104575_3106294_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001336393.1|3106347_3107172_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000239163.1|3107371_3108082_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635537.1|3108095_3108518_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185290.1|3108514_3109060_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|3109225_3109426_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|3109412_3109673_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176549.1|3109721_3111020_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901099.1|3111084_3111474_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020973.1|3111530_3113672_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|3113770_3114730_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294757.1|3114742_3118225_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|3118261_3118858_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_000565966.1|3120003_3120792_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|3120795_3121251_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139279.1|3121355_3122381_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|3122384_3122870_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|3122991_3125424_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001295561.1|3125453_3126806_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_000922446.1|3126817_3127675_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000811923.1|3128632_3129829_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_000622418.1|3129920_3130478_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_000224573.1|3130769_3131495_-	UMP kinase	NA	NA	NA	NA	NA
WP_000818114.1|3131641_3132493_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_000246882.1|3132750_3133476_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_001018194.1|3133843_3134638_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_001094586.1|3134699_3137372_+	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_001186650.1|3137402_3138227_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_000625631.1|3138280_3139093_+	phosphodiesterase YaeI	NA	NA	NA	NA	NA
WP_000272188.1|3139254_3139641_+	DUF3461 family protein	NA	NA	NA	NA	NA
WP_000929443.1|3139729_3140887_-	CdaR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000753946.1|3141041_3142466_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 1
NZ_CP044300	Escherichia coli strain P59A plasmid pP59A-2, complete sequence	116995	0	16999	116995		Salmonella_phage(100.0%)	20	NA	NA
WP_123902832.1|1426_2173_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	92.3	1.7e-127
WP_025670519.1|2503_3073_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	80.4	7.9e-85
WP_032187593.1|3338_4217_+	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	98.6	5.2e-160
WP_087905085.1|4384_5500_+	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	99.5	9.6e-220
WP_123902833.1|5501_5915_+	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	97.8	9.5e-72
WP_053292504.1|5911_6388_+	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	98.7	2.6e-89
WP_157705162.1|6387_7032_+	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	95.8	8.6e-112
WP_025670513.1|7095_7515_+	hypothetical protein	NA	J9Q743	Salmonella_phage	95.7	4.6e-66
WP_025670512.1|7524_8079_+	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	95.1	2.8e-95
WP_096098934.1|8123_9080_+	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	72.4	1.4e-97
WP_004109976.1|9234_9828_+	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	100.0	2.1e-112
WP_025670509.1|10030_10261_+	hypothetical protein	NA	J9Q7H5	Salmonella_phage	97.3	3.3e-34
WP_063085666.1|10854_11463_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	98.0	6.0e-115
WP_032187601.1|11605_12106_+	hypothetical protein	NA	J9Q6J9	Salmonella_phage	84.3	1.7e-67
WP_063085669.1|12115_12304_+	hypothetical protein	NA	J9Q800	Salmonella_phage	74.2	7.9e-18
WP_077881864.1|12467_13226_+	hypothetical protein	NA	J9Q7T3	Salmonella_phage	97.1	1.1e-129
WP_063085676.1|13334_13907_+	hypothetical protein	NA	J9Q7H6	Salmonella_phage	97.4	3.8e-95
WP_124062457.1|13932_14349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149019170.1|14505_16209_+	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	95.9	0.0e+00
WP_063085701.1|16297_16999_+	hypothetical protein	NA	J9Q6K2	Salmonella_phage	70.3	2.7e-79
>prophage 2
NZ_CP044300	Escherichia coli strain P59A plasmid pP59A-2, complete sequence	116995	20431	66888	116995	tail,terminase	Salmonella_phage(91.49%)	52	NA	NA
WP_001711135.1|20431_20743_+	hypothetical protein	NA	J9Q7T7	Salmonella_phage	64.1	3.0e-30
WP_032187823.1|20864_21260_+	hypothetical protein	NA	J9Q7I1	Salmonella_phage	63.8	2.0e-42
WP_050489710.1|21341_21752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148726034.1|22081_22369_+	ABC transporter	NA	J9Q753	Salmonella_phage	79.6	3.6e-38
WP_001009192.1|22573_23056_+	hypothetical protein	NA	J9Q805	Salmonella_phage	69.8	7.9e-62
WP_001711144.1|23679_23910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105906915.1|23960_24611_-	hypothetical protein	NA	J9Q754	Salmonella_phage	95.8	2.5e-111
WP_053292515.1|24932_25460_-	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	96.6	6.4e-81
WP_001711179.1|25946_26225_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	92.4	2.1e-38
WP_096098941.1|26227_27787_-	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	98.7	9.2e-293
WP_033870685.1|27851_28550_+	chromosome partitioning protein ParB	NA	J9Q756	Salmonella_phage	98.3	2.4e-123
WP_000164561.1|28549_29218_+	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	99.5	1.1e-114
WP_016051719.1|29214_29853_+	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	100.0	3.8e-112
WP_001113021.1|29845_30100_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	98.8	4.1e-41
WP_029463959.1|30096_30996_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.3	3.1e-168
WP_000176291.1|31005_31272_+	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_023135664.1|31467_32109_+	hypothetical protein	NA	J9Q6D4	Salmonella_phage	98.6	5.2e-109
WP_096098942.1|32111_33368_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	98.6	7.7e-250
WP_157705164.1|33385_34975_+	hypothetical protein	NA	J9Q7R1	Salmonella_phage	97.3	2.0e-295
WP_032187310.1|34997_35894_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	95.6	1.5e-146
WP_032187309.1|35920_36796_+	hypothetical protein	NA	J9Q710	Salmonella_phage	98.6	4.2e-162
WP_032187308.1|36870_37299_+	Ig-like domain-containing protein	NA	J9Q6D6	Salmonella_phage	57.2	2.3e-52
WP_032187307.1|37342_37777_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	93.8	3.2e-70
WP_096098944.1|37776_38610_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	95.7	2.5e-148
WP_032187305.1|38707_39052_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	95.6	1.5e-54
WP_032187304.1|39042_39516_+	hypothetical protein	NA	J9Q711	Salmonella_phage	96.8	1.4e-79
WP_032187303.1|39517_39901_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	96.9	2.5e-66
WP_032187301.1|39975_40722_+	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	97.6	2.6e-128
WP_000163862.1|40781_41099_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_002228782.1|41179_41449_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	8.4e-37
WP_157705165.1|41456_46028_+	tape measure protein	NA	J9Q712	Salmonella_phage	84.1	0.0e+00
WP_063122783.1|46070_46406_+|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	85.5	8.8e-52
WP_096098946.1|46455_47187_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	99.1	3.3e-136
WP_096098947.1|47179_47977_+|tail	phage tail protein	tail	J9Q7R4	Salmonella_phage	97.4	3.4e-158
WP_064674264.1|47964_48558_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	93.9	4.3e-102
WP_157705166.1|48568_53149_+	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	86.9	0.0e+00
WP_063122796.1|54640_56437_+|tail	tail fiber protein	tail	X2KTY7	Enterobacteria_phage	60.8	3.0e-05
WP_001711183.1|56433_57336_+	macro domain protein	NA	A0A0M4QWS3	Salmonella_phage	67.0	1.9e-96
WP_063122786.1|57344_57926_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	86.9	7.3e-94
WP_001711185.1|58059_58383_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	80.4	1.4e-38
WP_024172707.1|58396_59089_+	membrane protein	NA	J9Q7Y7	Salmonella_phage	90.0	2.7e-119
WP_023135660.1|59091_59343_+	hypothetical protein	NA	J9Q7R6	Salmonella_phage	65.1	1.0e-20
WP_032187665.1|59511_60033_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001711191.1|60040_60310_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_023135658.1|60629_61295_+	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	98.2	2.0e-116
WP_023135657.1|61294_61654_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.5e-44
WP_001711193.1|61706_62474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032187666.1|62757_63483_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	96.3	1.3e-137
WP_097296309.1|63543_64884_+	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	99.1	8.5e-247
WP_096945091.1|64944_66156_+	DNA primase	NA	J9Q720	Salmonella_phage	94.6	3.7e-209
WP_032187669.1|66289_66667_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	92.0	1.6e-57
WP_001603498.1|66666_66888_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	94.5	8.1e-30
>prophage 3
NZ_CP044300	Escherichia coli strain P59A plasmid pP59A-2, complete sequence	116995	73771	77324	116995		Salmonella_phage(100.0%)	7	NA	NA
WP_033546495.1|73771_74584_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	84.4	3.0e-122
WP_033546513.1|74883_75141_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	87.1	3.5e-32
WP_063122715.1|75175_76498_+	DNA ligase	NA	J9Q7G5	Salmonella_phage	97.7	2.1e-253
WP_031614921.1|76497_76674_+	hypothetical protein	NA	J9Q729	Salmonella_phage	91.4	3.2e-21
WP_149016823.1|76663_76870_+	hypothetical protein	NA	J9Q6I3	Salmonella_phage	91.2	3.8e-29
WP_149016822.1|76869_77022_+	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	82.0	1.0e-15
WP_023135645.1|77018_77324_+	hypothetical protein	NA	J9Q7S1	Salmonella_phage	92.1	2.3e-46
>prophage 4
NZ_CP044300	Escherichia coli strain P59A plasmid pP59A-2, complete sequence	116995	84916	116283	116995	integrase	Salmonella_phage(80.0%)	23	77890:77905	90976:90991
77890:77905	attL	ATGATTCCATACATCT	NA	NA	NA	NA
WP_063073125.1|84916_86020_+|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	33.9	1.9e-26
WP_003980690.1|86014_86404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032187681.1|86658_86871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063122717.1|86983_89215_+	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	84.9	0.0e+00
WP_063085645.1|89310_90546_+	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	98.5	3.7e-236
WP_064674289.1|90726_94245_+	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	98.5	0.0e+00
90976:90991	attR	AGATGTATGGAATCAT	NA	NA	NA	NA
WP_049885240.1|94273_94834_-	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	85.0	1.1e-78
WP_053292493.1|94943_95375_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	98.6	5.8e-72
WP_064674288.1|95494_96511_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.7	4.4e-163
WP_023135728.1|96571_97516_+	exonuclease	NA	J9Q7S6	Salmonella_phage	99.0	2.0e-181
WP_000920226.1|97515_97782_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_064674287.1|97784_100124_+	recombinase RecA	NA	J9Q736	Salmonella_phage	87.8	6.0e-30
WP_064674286.1|100426_103504_-	DEAD/DEAH box helicase	NA	A0A2K5B2C2	Erysipelothrix_phage	33.0	3.5e-126
WP_157705174.1|103982_104933_-	hypothetical protein	NA	A0A2K5B255	Erysipelothrix_phage	43.6	2.3e-60
WP_023315979.1|105007_105694_-	DUF4391 domain-containing protein	NA	NA	NA	NA	NA
WP_064674285.1|105697_109030_-	helicase	NA	A0A2K5B2B9	Erysipelothrix_phage	41.9	1.1e-239
WP_023135696.1|109538_109814_+	hypothetical protein	NA	J9Q738	Salmonella_phage	91.2	1.1e-44
WP_023135695.1|109853_110033_+	hypothetical protein	NA	J9Q6J1	Salmonella_phage	81.4	1.6e-15
WP_023135694.1|110029_110365_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	84.5	4.5e-48
WP_063122723.1|110364_110577_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	9.9e-33
WP_033545611.1|111227_112283_-	replication protein RepA	NA	J9Q7H0	Salmonella_phage	92.1	4.4e-174
WP_023135693.1|113025_113670_+	hypothetical protein	NA	J9Q739	Salmonella_phage	98.6	1.4e-122
WP_032187693.1|115197_116283_+	exonuclease	NA	J9Q7S9	Salmonella_phage	97.8	2.5e-204
>prophage 1
NZ_CP044301	Escherichia coli strain P59A plasmid pP59A-3, complete sequence	83169	85	56492	83169	transposase,integrase	Bacillus_phage(22.22%)	41	3215:3231	71599:71615
WP_000935452.1|85_1390_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001067855.1|1436_2141_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_011264039.1|2213_2453_+	macrolide transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	46.2	9.5e-08
WP_054377175.1|2598_3462_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
3215:3231	attL	CACTGCGCGATGAGCTG	NA	NA	NA	NA
WP_001354008.1|3499_3745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095725.1|7521_8781_-	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001206356.1|9042_9834_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|9839_10130_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|10241_10739_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845039.1|10883_11897_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000844627.1|14405_14648_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_021536379.1|14679_15357_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_001493765.1|15435_16635_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|16666_17551_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001351729.1|17688_18081_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_012477564.1|19969_20560_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_001493762.1|20696_21269_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_001493761.1|21305_22697_+|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
WP_034167712.1|22928_23336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032482496.1|23397_23595_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_032482493.1|26054_27026_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	38.1	2.4e-49
WP_000336323.1|28321_28489_-	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	68.0	1.6e-14
WP_025989258.1|28605_30525_-	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A2K5B2A5	Erysipelothrix_phage	96.4	0.0e+00
WP_012386611.1|30540_30627_-	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_001235713.1|33256_33814_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001067858.1|34260_34965_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_157705175.1|35050_35731_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	31.9	1.2e-10
WP_000758221.1|38573_39014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001398209.1|42136_43429_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_001246155.1|43542_43896_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_038988996.1|43923_45309_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_000697965.1|45498_46179_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	1.2e-31
WP_000555737.1|46171_47647_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_000790483.1|47897_48329_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_000694953.1|48472_48823_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	54.3	1.9e-20
WP_001372261.1|49210_50119_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_011251353.1|50756_51731_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_000796235.1|52661_53333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022631000.1|53352_54141_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.5e-52
WP_001326966.1|54198_54390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001254932.1|55340_56492_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
71599:71615	attR	CAGCTCATCGCGCAGTG	NA	NA	NA	NA
>prophage 1
NZ_CP044299	Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence	253160	0	8048	253160		Salmonella_phage(50.0%)	7	NA	NA
WP_001281654.1|1181_2339_-	DNA-binding protein	NA	A0A2P9HXK7	Yersinia_phage	24.6	1.1e-19
WP_001225593.1|2698_3523_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A2P9J4Y7	Pectobacterium_phage	37.6	2.8e-46
WP_001178650.1|3537_4359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000682872.1|4639_5347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000357613.1|5343_5544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001015069.1|5561_6638_-	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	31.8	7.8e-09
WP_001282731.1|7172_8048_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	43.5	1.6e-60
>prophage 2
NZ_CP044299	Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence	253160	23416	24424	253160		Aeromonas_phage(100.0%)	1	NA	NA
WP_001278833.1|23416_24424_+	peptide transporter	NA	A0A1I9KFW9	Aeromonas_phage	32.1	3.9e-10
>prophage 3
NZ_CP044299	Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence	253160	27667	30595	253160	transposase	Enterobacteria_phage(50.0%)	3	NA	NA
WP_000137273.1|27667_28702_+	hypothetical protein	NA	A0A0A7NPX4	Enterobacteria_phage	34.3	6.7e-42
WP_157705147.1|28745_29423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019448.1|29614_30595_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
>prophage 4
NZ_CP044299	Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence	253160	50662	52447	253160		Bacillus_phage(100.0%)	1	NA	NA
WP_000517883.1|50662_52447_+	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	26.4	2.1e-19
>prophage 5
NZ_CP044299	Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence	253160	60226	61480	253160		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001113001.1|60226_61480_+	hypothetical protein	NA	A0A0H5AWB1	Pseudomonas_phage	29.7	3.0e-12
>prophage 6
NZ_CP044299	Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence	253160	72779	148838	253160	integrase,transposase	Salmonella_phage(35.0%)	62	124654:124713	148842:148972
WP_001086279.1|72779_73961_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001324690.1|74175_74388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001232452.1|78124_79198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001247564.1|79275_79419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000416123.1|79454_79931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000111572.1|80078_80354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011011074.1|80343_80544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000341067.1|80610_81003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493077.1|81415_81619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001255860.1|81773_82979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088474850.1|83148_83646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016236836.1|83712_84636_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	98.7	7.1e-176
WP_000583905.1|84807_85035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001209044.1|85144_85951_+	HNH endonuclease	NA	G0X580	Salmonella_phage	37.9	1.3e-13
WP_011011075.1|86056_86476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000097904.1|86783_87233_+	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	34.3	4.9e-05
WP_001287388.1|87998_88403_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001189577.1|91587_93138_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
WP_124038505.1|94471_94663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000062400.1|95833_96289_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000272280.1|96457_96646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010892342.1|96648_97869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000323423.1|97923_98127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000529857.1|98164_99460_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_011011077.1|99484_99655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000282148.1|99783_101211_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.0e-101
WP_000173534.1|101434_101950_+	thermonuclease family protein	NA	V5UN65	Mycobacterium_phage	28.3	7.1e-08
WP_011011078.1|101946_102879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000250919.1|102934_103714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157705149.1|104609_105218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000429836.1|108353_108788_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|108859_109210_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_157705158.1|111456_112710_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_015387340.1|112965_113841_+	class A extended-spectrum beta-lactamase CTX-M-55	NA	A0A1B0VBP7	Salmonella_phage	82.1	2.4e-125
WP_001393253.1|113887_114220_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_074150773.1|119369_119714_-	resolvase	NA	A0A219YB42	Aeromonas_phage	44.6	9.8e-14
WP_001067858.1|119749_120454_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000587837.1|122036_122579_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|123060_123252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001330846.1|123257_123503_+	hypothetical protein	NA	NA	NA	NA	NA
124654:124713	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|124716_125421_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_157705159.1|125976_127167_+	macrolide efflux MFS transporter Mef(B)	NA	A0A1B0RXA6	Streptococcus_phage	39.1	8.0e-71
WP_001354008.1|128209_128455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|128923_129715_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_000800531.1|130894_131227_-	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_011113049.1|131396_132188_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA25	NA	NA	NA	NA	NA
WP_001336345.1|132193_132484_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_000845039.1|133233_134247_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|134449_134800_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|134925_135486_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_015344976.1|135488_138440_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
WP_046788546.1|138448_138850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067784.1|138934_139639_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_001447541.1|140563_141448_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_058657119.1|141664_142879_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_001255015.1|142906_143212_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001445143.1|144851_145103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|144996_145299_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|145385_146201_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_085940648.1|146290_147380_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_157705150.1|147577_147850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157705151.1|148583_148838_-	hypothetical protein	NA	A0A077SL39	Escherichia_phage	64.1	2.0e-08
148842:148972	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCACTTCGACGACTACCTGCTGCCGGCCGAGAAGTTCGCCGCACTCAAGCGCGAGCAGGCCCTGCCCCTGGCG	NA	NA	NA	NA
>prophage 7
NZ_CP044299	Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence	253160	152188	153394	253160		Yersinia_phage(100.0%)	1	NA	NA
WP_000108723.1|152188_153394_+	DNA-binding protein	NA	A0A2P9HXK7	Yersinia_phage	27.5	2.0e-13
>prophage 8
NZ_CP044299	Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence	253160	157458	159370	253160		Clostridioides_phage(50.0%)	2	NA	NA
WP_011011085.1|157458_158172_-	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	36.4	5.7e-08
WP_000476770.1|158188_159370_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	28.1	7.5e-05
>prophage 9
NZ_CP044299	Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence	253160	182340	182775	253160		Morganella_phage(100.0%)	1	NA	NA
WP_001395519.1|182340_182775_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	41.1	1.2e-21
>prophage 10
NZ_CP044299	Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence	253160	196353	197835	253160		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_088475060.1|196353_197835_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.6	3.2e-45
>prophage 11
NZ_CP044299	Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence	253160	208830	209166	253160		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000046891.1|208830_209166_+	thermonuclease family protein	NA	G8DH70	Emiliania_huxleyi_virus	35.7	2.8e-05
>prophage 12
NZ_CP044299	Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence	253160	214314	220291	253160	transposase	Enterobacteria_phage(75.0%)	4	NA	NA
WP_157705156.1|214314_215019_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	5.3e-139
WP_012817690.1|215518_218527_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.5	0.0e+00
WP_001235713.1|218690_219248_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|219430_220291_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
>prophage 13
NZ_CP044299	Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence	253160	225805	228805	253160		Salmonella_phage(66.67%)	6	NA	NA
WP_011011059.1|225805_226126_-	hypothetical protein	NA	S4TRP7	Salmonella_phage	40.0	5.3e-06
WP_094337918.1|226202_226556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000478449.1|226571_227180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001395478.1|227210_227735_-	HNH endonuclease	NA	C6ZR29	Salmonella_phage	62.8	6.2e-44
WP_001058453.1|227765_228077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016246464.1|228073_228805_-	hypothetical protein	NA	Q71T76	Escherichia_phage	56.1	4.3e-67
>prophage 14
NZ_CP044299	Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence	253160	236291	236588	253160		Escherichia_phage(100.0%)	1	NA	NA
WP_000581856.1|236291_236588_-	toxin-plasmid maintenance system killer protein	NA	A0A222YWE2	Escherichia_phage	35.1	4.9e-06
>prophage 15
NZ_CP044299	Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence	253160	240215	241507	253160		Escherichia_phage(50.0%)	2	NA	NA
WP_000902167.1|240215_240575_+	hypothetical protein	NA	M9UXL5	Escherichia_phage	45.1	2.9e-08
WP_000178072.1|240802_241507_+	hypothetical protein	NA	A0A1W6DXB8	Sphingobium_phage	25.2	7.1e-11
>prophage 16
NZ_CP044299	Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence	253160	246675	247557	253160		Salmonella_phage(100.0%)	1	NA	NA
WP_000097746.1|246675_247557_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	41.3	6.5e-54
