The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	0	27219	4544936	integrase	Staphylococcus_phage(100.0%)	15	NA	NA
WP_120795387.1|1348_1471_+	protein YneP	NA	NA	NA	NA	NA
WP_001301030.1|1436_2594_-	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_001295684.1|2645_4328_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_157716807.1|4724_5489_-	acid stress response transcriptional regulator YdeO	NA	NA	NA	NA	NA
WP_157716808.1|6004_8284_-	acid resistance putative oxidoreductase YdeP	NA	NA	NA	NA	NA
WP_072778976.1|8621_9536_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000825452.1|9594_10098_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000876763.1|10110_10641_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000017447.1|10654_11803_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_072157032.1|13405_14746_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_072778584.1|15062_16370_-	type II toxin-antitoxin system serine/threonine protein kinase toxin HipA	NA	NA	NA	NA	NA
WP_001301023.1|16369_16636_-	type II toxin-antitoxin system antitoxin HipB	NA	NA	NA	NA	NA
WP_000113148.1|22810_24403_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_000154352.1|24481_25435_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001194916.1|25683_27219_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	24.0	9.4e-16
>prophage 2
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	35091	36510	4544936		Bacillus_phage(100.0%)	1	NA	NA
WP_157716810.1|35091_36510_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	1.9e-18
>prophage 3
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	43983	45362	4544936		Klebsiella_phage(50.0%)	3	NA	NA
WP_000273128.1|43983_44304_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	42.3	7.2e-19
WP_000843419.1|44523_44958_+	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000091199.1|44978_45362_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 4
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	48364	49255	4544936		Bacillus_phage(100.0%)	1	NA	NA
WP_000592802.1|48364_49255_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	6.2e-20
>prophage 5
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	54622	70236	4544936	lysis,terminase	Enterobacteria_phage(46.67%)	21	NA	NA
WP_000214712.1|54622_54826_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_072778588.1|54860_56321_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.5	7.3e-42
WP_072778595.1|56409_57693_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_157716811.1|59035_60019_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.4	1.5e-192
WP_000421823.1|60027_60567_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	99.4	1.8e-94
WP_000548593.1|61117_61324_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_157716812.1|61964_62120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122134696.1|62197_62263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524604.1|62265_62454_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|62464_62677_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071773.1|63030_63528_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_001092966.1|63524_64058_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	8.4e-97
WP_000189918.1|64054_64366_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	62.6	5.0e-25
WP_001616185.1|64370_64586_-|lysis	phage lysis protein	lysis	A5LH82	Enterobacteria_phage	93.0	8.5e-32
WP_000592549.1|65861_66821_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780584.1|67013_67538_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
WP_001204786.1|67693_68071_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	81.7	6.9e-53
WP_001265274.1|68088_69138_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	58.2	3.0e-114
WP_001325325.1|69139_69418_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	7.4e-12
WP_000887491.1|69871_70084_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_001557860.1|70128_70236_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
>prophage 6
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	73249	89076	4544936		Escherichia_phage(70.0%)	18	NA	NA
WP_057699112.1|73249_73672_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	87.1	2.4e-62
WP_000693853.1|74760_75186_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001072337.1|75182_75437_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000233320.1|75516_75936_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_157716813.1|76152_76359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001389342.1|76665_76794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836066.1|76851_77871_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|77882_79097_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|79302_79629_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_072778651.1|79763_80105_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|80139_80700_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|80702_81413_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001300836.1|81520_81826_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_112911065.1|82024_84451_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.0e-213
WP_001340362.1|84511_86935_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_024257739.1|86945_87563_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	1.2e-75
WP_072778629.1|87564_88419_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|88461_89076_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
>prophage 7
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	106838	108140	4544936		Bacillus_phage(100.0%)	1	NA	NA
WP_000732512.1|106838_108140_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.2	3.2e-17
>prophage 8
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	117679	119491	4544936		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945878.1|117679_119491_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	100.0	0.0e+00
>prophage 9
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	139289	140564	4544936	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001339629.1|139289_140564_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 10
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	147475	148974	4544936		Salmonella_phage(50.0%)	2	NA	NA
WP_001296937.1|147475_147997_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
WP_000250656.1|148077_148974_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
>prophage 11
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	157776	166657	4544936		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101193.1|157776_158592_+	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|158719_159301_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701044.1|159535_160705_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|160870_160960_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190982.1|161258_162284_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_072777956.1|162280_163213_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182363.1|163325_164537_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098896.1|164827_165976_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_000493947.1|166015_166657_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 12
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	172161	174428	4544936		Edwardsiella_phage(50.0%)	3	NA	NA
WP_157716816.1|172161_172974_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
WP_001069979.1|172977_173763_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001310861.1|173759_174428_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
>prophage 13
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	182715	185925	4544936		environmental_halophage(50.0%)	3	NA	NA
WP_000577988.1|182715_183936_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
WP_000907979.1|183932_185204_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948863.1|185178_185925_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.0	3.9e-07
>prophage 14
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	206366	210502	4544936		Staphylococcus_phage(50.0%)	2	NA	NA
WP_000553704.1|206366_208067_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.3	3.0e-31
WP_000069375.1|208123_210502_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
>prophage 15
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	215657	225961	4544936	tRNA	Tupanvirus(33.33%)	12	NA	NA
WP_001209795.1|215657_216122_-	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
WP_000029466.1|216199_216949_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154168.1|216948_217500_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956528.1|217562_218543_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|218643_218943_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672380.1|218947_221335_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018596.1|221349_222333_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|222616_222661_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
WP_000124850.1|222783_223140_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|223192_223390_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|223486_224029_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144202.1|224032_225961_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
>prophage 16
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	238141	240403	4544936		Tupanvirus(100.0%)	1	NA	NA
WP_000077873.1|238141_240403_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.3e-143
>prophage 17
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	246732	247560	4544936		Bacillus_virus(100.0%)	1	NA	NA
WP_000175026.1|246732_247560_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	1.7e-72
>prophage 18
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	255036	256257	4544936		Klosneuvirus(100.0%)	1	NA	NA
WP_000081986.1|255036_256257_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	4.2e-27
>prophage 19
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	263018	263672	4544936		Bacillus_phage(100.0%)	1	NA	NA
WP_001300558.1|263018_263672_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.0	5.1e-11
>prophage 20
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	269270	271232	4544936		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235800.1|269270_271232_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.2e-40
>prophage 21
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	276158	280244	4544936		Tupanvirus(50.0%)	4	NA	NA
WP_001135066.1|276158_276800_+	bifunctional pyrazinamidase/nicotinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.2e-19
WP_104774000.1|276892_278251_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719088.1|278368_279127_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000723723.1|279263_280244_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	7.9e-08
>prophage 22
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	289831	290686	4544936		Indivirus(100.0%)	1	NA	NA
WP_001186374.1|289831_290686_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 23
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	294004	298581	4544936		Bacillus_phage(100.0%)	3	NA	NA
WP_000219686.1|294004_295288_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_071685803.1|295707_296910_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_072778033.1|297090_298581_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	4.9e-09
>prophage 24
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	315132	323234	4544936	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_000758422.1|315132_316818_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_157716822.1|317022_317604_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220966.1|317643_318339_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128847.1|318396_320307_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001295493.1|320438_320783_+	RidA family protein	NA	NA	NA	NA	NA
WP_001407564.1|321176_321500_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|321619_321799_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000855022.1|321872_323234_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	2.0e-41
>prophage 25
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	327096	328653	4544936		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|327096_328653_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 26
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	334292	334502	4544936		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|334292_334502_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 27
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	339828	341877	4544936		Moraxella_phage(100.0%)	1	NA	NA
WP_001055779.1|339828_341877_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.8e-86
>prophage 28
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	349373	353843	4544936		Escherichia_phage(33.33%)	7	NA	NA
WP_000812732.1|349373_350030_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	8.0e-57
WP_000976472.1|350425_350767_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879295.1|350779_351652_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168747.1|351655_352030_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|352168_352399_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011658.1|352500_353157_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944258.1|353180_353843_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
>prophage 29
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	361899	363375	4544936		Cyanophage(100.0%)	1	NA	NA
WP_000301719.1|361899_363375_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	3.7e-78
>prophage 30
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	367373	374430	4544936		Bacillus_virus(50.0%)	9	NA	NA
WP_001184045.1|367373_368696_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001300644.1|368711_369644_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|369722_370478_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571479.1|370474_371260_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|371406_372417_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580327.1|372425_373037_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_157716988.1|373168_373237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024904.1|373304_373907_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|373908_374430_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 31
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	378448	380499	4544936		Escherichia_coli_phage(50.0%)	3	NA	NA
WP_000639274.1|378448_379267_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|379319_379715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019588.1|379755_380499_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
>prophage 32
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	387116	388850	4544936	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025322.1|387116_388850_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
>prophage 33
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	394102	399746	4544936		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_000763867.1|394102_394492_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036371.1|394506_395556_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204342.1|395558_396419_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483223.1|396437_398039_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	8.3e-15
WP_001297437.1|398084_399746_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
>prophage 34
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	409823	411338	4544936		Cedratvirus(100.0%)	1	NA	NA
WP_001187819.1|409823_411338_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
>prophage 35
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	423330	424083	4544936		Bacillus_virus(100.0%)	1	NA	NA
WP_001272994.1|423330_424083_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 36
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	435996	437916	4544936	transposase	uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000334609.1|435996_436668_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	5.6e-82
WP_157716825.1|436707_437916_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.3	3.2e-208
>prophage 37
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	455153	467521	4544936		Bacillus_phage(28.57%)	12	NA	NA
WP_001355498.1|455153_456848_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|457018_457201_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922682.1|457279_458197_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212240.1|458369_459290_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786004.1|459278_459749_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001157238.1|459729_461148_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.8e-101
WP_000365544.1|461214_461910_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_001313057.1|461949_462315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824370.1|462882_463941_+	outer membrane protein F	NA	Q1MVN1	Enterobacteria_phage	49.3	1.1e-92
WP_072778765.1|464532_465384_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826747.1|465491_466850_-	heavy metal sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	8.7e-05
WP_001362894.1|466849_467521_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.6	3.1e-32
>prophage 38
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	471065	471596	4544936		Escherichia_phage(100.0%)	1	NA	NA
WP_001079074.1|471065_471596_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
>prophage 39
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	493214	497138	4544936		Stx2-converting_phage(50.0%)	2	NA	NA
WP_032145576.1|493214_494378_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.7	9.7e-223
WP_157716829.1|496625_497138_+	acyltransferase family protein	NA	A0A1R3Y5Q6	Salmonella_virus	44.9	4.1e-32
>prophage 40
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	500774	507769	4544936	integrase	Enterobacteria_phage(44.44%)	11	490784:490799	508412:508427
490784:490799	attL	TGAAAATGATGACGGT	NA	NA	NA	NA
WP_047083750.1|500774_501035_+	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	97.7	8.1e-37
WP_157716831.1|501404_502601_-	hypothetical protein	NA	E7C9U5	Salmonella_phage	87.4	2.7e-82
WP_045172990.1|503342_503675_+	antitermination protein	NA	Q716D8	Shigella_phage	98.2	4.2e-54
WP_112040569.1|503965_504037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032243332.1|504158_504434_+	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	97.8	2.9e-45
WP_157716989.1|504602_505184_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	82.9	4.5e-51
WP_000476264.1|505315_505558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001336413.1|505535_505688_+	hypothetical protein	NA	Q71T70	Escherichia_phage	73.7	5.1e-07
WP_157716832.1|505906_506074_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	96.4	8.3e-27
WP_157716833.1|506418_506610_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	98.4	6.4e-31
WP_097451079.1|506590_507769_-|integrase	site-specific integrase	integrase	K7P7J2	Enterobacteria_phage	99.5	4.4e-231
508412:508427	attR	TGAAAATGATGACGGT	NA	NA	NA	NA
>prophage 41
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	514941	515841	4544936		Cellulophaga_phage(100.0%)	1	NA	NA
WP_157716836.1|514941_515841_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 42
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	524543	527365	4544936		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000704791.1|524543_525710_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.5	6.7e-115
WP_024245839.1|525958_527365_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.1e-37
>prophage 43
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	536083	538546	4544936		Bacillus_phage(50.0%)	2	NA	NA
WP_000183060.1|536083_536977_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001774554.1|537151_538546_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.5	6.3e-19
>prophage 44
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	544258	551052	4544936		Bacillus_phage(25.0%)	6	NA	NA
WP_001313977.1|544258_545629_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	2.2e-32
WP_021530570.1|545821_547258_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	4.3e-47
WP_157716842.1|547260_548484_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000479838.1|548480_548960_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_157716843.1|548962_549928_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.5	1.1e-86
WP_000048190.1|549930_551052_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 45
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	555414	566417	4544936		uncultured_marine_virus(16.67%)	10	NA	NA
WP_000654494.1|555414_556254_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	7.5e-07
WP_099452301.1|556346_558509_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_024236668.1|558511_558955_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|558960_560100_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000454701.1|560752_562336_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_157716846.1|562673_562895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000687871.1|562884_563175_+	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	37.2	2.1e-09
WP_099145462.1|563227_565081_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_157716847.1|565102_565684_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001295424.1|565775_566417_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 46
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	571142	572495	4544936		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_072778226.1|571142_572495_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	21.8	1.3e-05
>prophage 47
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	585324	592769	4544936	tRNA	Bacillus_phage(50.0%)	7	NA	NA
WP_000675144.1|585324_586728_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
WP_000137877.1|586724_587447_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000124651.1|588796_589048_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|589049_589346_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_053291816.1|589448_590810_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	7.1e-217
WP_001302529.1|591139_591400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040063730.1|591869_592769_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 48
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	601990	605547	4544936		Serratia_phage(50.0%)	4	NA	NA
WP_069912998.1|601990_602995_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	2.2e-13
WP_072778710.1|602991_603957_+	sugar kinase	NA	NA	NA	NA	NA
WP_072778709.1|603930_604677_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_072778708.1|604728_605547_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	3.3e-23
>prophage 49
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	616177	625187	4544936	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_072778699.1|616177_618211_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_157716991.1|619176_619464_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	98.9	8.7e-40
WP_001295430.1|619505_619976_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|620022_620742_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|620738_622424_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|622645_623377_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|623436_623544_+	protein YohO	NA	NA	NA	NA	NA
WP_021556975.1|623524_624256_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_072777907.1|624260_625187_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	5.7e-08
>prophage 50
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	645718	647239	4544936		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255032.1|645718_647239_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 51
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	650933	654707	4544936		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|650933_651602_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_072777891.1|651859_652696_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000489254.1|652727_654707_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	1.9e-13
>prophage 52
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	658773	659631	4544936		Catovirus(100.0%)	1	NA	NA
WP_000873890.1|658773_659631_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 53
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	674128	678429	4544936		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_001091940.1|674128_675595_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	2.3e-43
WP_000198828.1|675712_676699_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000594599.1|676737_677451_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|677862_678429_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 54
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	684183	691831	4544936		Vibrio_phage(50.0%)	7	NA	NA
WP_000194927.1|684183_685773_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
WP_000202798.1|685776_686121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213361.1|686453_687644_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_001234850.1|687671_688367_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578092.1|688515_690276_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	4.2e-100
WP_000494183.1|690400_690685_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050793.1|690823_691831_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.6	4.1e-84
>prophage 55
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	703705	704323	4544936		Bacillus_virus(100.0%)	1	NA	NA
WP_000888560.1|703705_704323_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 56
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	713426	719204	4544936		Bacillus_phage(25.0%)	5	NA	NA
WP_000422182.1|713426_715070_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	1.2e-13
WP_000884971.1|715145_715796_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	33.0	8.3e-06
WP_000710375.1|715795_716860_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000406064.1|716933_717989_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865568.1|718100_719204_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.3	5.2e-117
>prophage 57
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	723481	728324	4544936		Hokovirus(50.0%)	2	NA	NA
WP_157716855.1|723481_726331_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	2.4e-41
WP_000559125.1|726497_728324_+	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	27.3	1.5e-20
>prophage 58
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	743307	745935	4544936		Bacillus_virus(100.0%)	1	NA	NA
WP_001281242.1|743307_745935_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
>prophage 59
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	751383	757442	4544936		Pseudomonas_phage(50.0%)	5	NA	NA
WP_001075164.1|751383_753669_+	ribonucleoside-diphosphate reductase 1 subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	2.5e-283
WP_000332037.1|753814_754945_+	ribonucleoside-diphosphate reductase 1 subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.5e-175
WP_000135040.1|754944_755199_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000301050.1|755252_755903_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000779105.1|756365_757442_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	3.0e-08
>prophage 60
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	763334	767845	4544936	transposase	Sodalis_phage(50.0%)	5	NA	NA
WP_000140569.1|763334_764234_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.5e-69
WP_000150333.1|764246_764432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000992954.1|764472_765276_-	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_001295288.1|765293_766583_-	MFS transporter	NA	NA	NA	NA	NA
WP_001319848.1|766639_767845_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	1.2e-26
>prophage 61
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	771445	776449	4544936		Tupanvirus(50.0%)	4	NA	NA
WP_000879112.1|771445_772048_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	4.4e-09
WP_001355579.1|772355_773495_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	30.1	5.0e-30
WP_000461657.1|773498_774467_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	8.8e-36
WP_000860273.1|774466_776449_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
>prophage 62
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	794958	795624	4544936		Escherichia_phage(100.0%)	1	NA	NA
WP_113409878.1|794958_795624_-	hypothetical protein	NA	A0A2L1IV26	Escherichia_phage	44.8	7.7e-07
>prophage 63
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	816030	819258	4544936		Salmonella_phage(50.0%)	3	NA	NA
WP_000813859.1|816030_816630_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012899.1|816688_818521_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203392.1|818607_819258_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	35.4	3.1e-08
>prophage 64
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	829817	831678	4544936	transposase	Sodalis_phage(50.0%)	2	NA	NA
WP_000156149.1|829817_830708_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	43.9	8.9e-67
WP_001293613.1|830904_831678_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 65
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	835889	837407	4544936		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|835889_837407_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 66
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	843883	845020	4544936		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699145.1|843883_845020_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	5.9e-23
>prophage 67
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	853556	854642	4544936		Pandoravirus(100.0%)	1	NA	NA
WP_001333535.1|853556_854642_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	9.1e-90
>prophage 68
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	872462	873395	4544936		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000368140.1|872462_873395_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
>prophage 69
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	881312	884906	4544936		Bacillus_phage(100.0%)	1	NA	NA
WP_001355656.1|881312_884906_+	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	1.1e-09
>prophage 70
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	892589	893510	4544936		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|892589_893510_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 71
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	897328	898063	4544936		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|897328_898063_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 72
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	923746	936400	4544936		Streptococcus_phage(40.0%)	12	NA	NA
WP_000443661.1|923746_925762_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.5	1.7e-150
WP_001300494.1|925832_926819_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254839.1|927048_927810_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|927994_928966_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|929349_929607_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623140.1|929651_931379_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	1.3e-16
WP_000522247.1|931419_931929_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_072777984.1|931971_932823_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719962.1|932927_933302_+	YfeK family protein	NA	NA	NA	NA	NA
WP_000745534.1|933334_934069_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_001336044.1|934257_935169_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.3	3.8e-57
WP_000021036.1|935302_936400_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	39.4	2.8e-30
>prophage 73
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	939417	940209	4544936		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000517431.1|939417_940209_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	8.9e-18
>prophage 74
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	943687	948807	4544936		Mycobacterium_phage(33.33%)	6	NA	NA
WP_104773952.1|943687_944992_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	25.6	6.2e-08
WP_000084590.1|945231_946131_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838944.1|946226_946802_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000842944.1|946862_947312_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000405996.1|947298_947724_-	acetyltransferase YpeA	NA	NA	NA	NA	NA
WP_000102886.1|947937_948807_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
>prophage 75
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	960988	961683	4544936	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_104773949.1|960988_961683_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	95.2	1.2e-127
>prophage 76
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	975388	976339	4544936		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|975388_976339_+	transaldolase A	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 77
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	993545	994259	4544936		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|993545_994259_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 78
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1015343	1019345	4544936		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198328.1|1015343_1016633_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
WP_001295473.1|1016718_1017345_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295474.1|1017669_1018707_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001028614.1|1018706_1019345_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
>prophage 79
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1025780	1032075	4544936		Escherichia_phage(60.0%)	6	NA	NA
WP_001344399.1|1025780_1025954_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
WP_000669402.1|1026267_1026783_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.0e-62
WP_000755173.1|1026798_1027338_+	hypothetical protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
WP_000138270.1|1027430_1029008_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001299507.1|1029076_1030543_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000937912.1|1030704_1032075_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	2.4e-42
>prophage 80
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1051476	1052760	4544936		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000133591.1|1051476_1052760_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.9e-34
>prophage 81
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1056158	1056551	4544936		uncultured_virus(100.0%)	1	NA	NA
WP_157716997.1|1056158_1056551_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.8	1.3e-51
>prophage 82
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1069272	1069416	4544936		Shigella_phage(100.0%)	1	NA	NA
WP_157716998.1|1069272_1069416_-	hypothetical protein	NA	U5P0U6	Shigella_phage	97.0	2.3e-09
>prophage 83
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1073179	1074691	4544936		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000493470.1|1073179_1074691_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.9	2.5e-08
>prophage 84
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1080545	1091835	4544936		Bacillus_phage(50.0%)	7	NA	NA
WP_000919159.1|1080545_1081799_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883122.1|1082126_1083317_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717691.1|1083361_1083700_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001298983.1|1083760_1085095_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215861.1|1085084_1085798_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001351828.1|1085962_1087390_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_000970096.1|1087947_1091835_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	1.3e-130
>prophage 85
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1095954	1096215	4544936		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|1095954_1096215_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 86
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1099677	1103420	4544936		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|1099677_1100358_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|1100630_1101605_-	signal peptidase I	NA	NA	NA	NA	NA
WP_094324117.1|1101620_1103420_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 87
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1109191	1115450	4544936	tRNA	Cafeteria_roenbergensis_virus(25.0%)	7	NA	NA
WP_000219193.1|1109191_1110526_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001351830.1|1110734_1111616_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|1111718_1112306_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|1112361_1112745_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_072778597.1|1113049_1113739_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	5.5e-56
WP_000997403.1|1113786_1114824_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|1115030_1115450_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
>prophage 88
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1120743	1122042	4544936		Burkholderia_virus(100.0%)	1	NA	NA
WP_000841103.1|1120743_1122042_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 89
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1127812	1130386	4544936		Enterobacteria_phage(100.0%)	1	NA	NA
WP_157716871.1|1127812_1130386_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	3.4e-127
>prophage 90
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1136292	1137363	4544936		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168037.1|1136292_1137363_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 91
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1151763	1154219	4544936	integrase	Staphylococcus_phage(50.0%)	2	1151441:1151454	1172526:1172539
1151441:1151454	attL	TACCGCCGCAGTCA	NA	NA	NA	NA
WP_000162574.1|1151763_1152246_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001062342.1|1152989_1154219_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	86.6	4.6e-207
1172526:1172539	attR	TGACTGCGGCGGTA	NA	NA	NA	NA
>prophage 92
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1159388	1159607	4544936		Salmonella_phage(100.0%)	1	NA	NA
WP_071524906.1|1159388_1159607_-	DNA invertase	NA	A0A1S6L009	Salmonella_phage	70.0	4.1e-10
>prophage 93
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1169030	1173082	4544936		Klosneuvirus(50.0%)	4	NA	NA
WP_001087611.1|1169030_1170311_+	4-aminobutyrate aminotransferase GabT	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.9e-33
WP_001295173.1|1170548_1171949_+	GABA permease	NA	NA	NA	NA	NA
WP_000156811.1|1171969_1172632_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522415.1|1172632_1173082_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 94
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1176997	1181425	4544936		Bacillus_phage(33.33%)	3	NA	NA
WP_157717001.1|1176997_1177273_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	43.0	2.2e-08
WP_157716873.1|1178933_1179869_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	67.1	8.9e-118
WP_000985494.1|1180222_1181425_+	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 95
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1194475	1199861	4544936	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|1194475_1194661_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047184.1|1194895_1197526_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000140508.1|1197653_1198154_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|1198222_1199284_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132231.1|1199363_1199861_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
>prophage 96
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1205327	1206293	4544936		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287420.1|1205327_1206293_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	2.3e-36
>prophage 97
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1213768	1214782	4544936		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001300815.1|1213768_1214782_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.4	9.3e-28
>prophage 98
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1232607	1245742	4544936		Escherichia_phage(50.0%)	12	NA	NA
WP_001272895.1|1232607_1235169_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	4.6e-31
WP_001141322.1|1235274_1235931_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_157716874.1|1235981_1236749_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	9.7e-70
WP_000847985.1|1236944_1237853_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590403.1|1237849_1239112_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_001278994.1|1239108_1239747_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136934.1|1239751_1240528_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104441.1|1240616_1241981_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|1242074_1243067_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272581.1|1243129_1244221_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|1244360_1244987_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|1244980_1245742_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 99
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1248854	1250887	4544936		Tupanvirus(50.0%)	2	NA	NA
WP_001173676.1|1248854_1249460_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	3.2e-28
WP_001090386.1|1249459_1250887_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.1	1.1e-29
>prophage 100
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1275373	1276159	4544936		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021321.1|1275373_1276159_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	6.5e-21
>prophage 101
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1280738	1285660	4544936		Vibrio_phage(33.33%)	4	NA	NA
WP_001199973.1|1280738_1281410_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
WP_001268460.1|1281704_1282577_+	YgcG family protein	NA	NA	NA	NA	NA
WP_000036723.1|1282636_1283935_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|1284022_1285660_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 102
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1289692	1293807	4544936		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_000046812.1|1289692_1290994_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.9	5.2e-39
WP_000186450.1|1291050_1293807_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
>prophage 103
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1301341	1302190	4544936		Vibrio_phage(100.0%)	1	NA	NA
WP_000100421.1|1301341_1302190_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	1.0e-40
>prophage 104
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1307048	1307804	4544936		Bacillus_phage(100.0%)	1	NA	NA
WP_000268232.1|1307048_1307804_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 105
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1321004	1334633	4544936	tRNA	Bacillus_phage(40.0%)	7	NA	NA
WP_000117728.1|1321004_1321811_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_157716875.1|1322049_1323147_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000016907.1|1323505_1324759_-	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237947.1|1324990_1326322_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000775955.1|1326383_1328210_-	RecBCD enzyme subunit RecD	NA	A0A1P8DII4	Virus_Rctr197k	26.7	3.5e-25
WP_001397724.1|1328209_1331752_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.9	1.5e-08
WP_001138201.1|1331744_1334633_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	5.3e-68
>prophage 106
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1340109	1346882	4544936		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|1340109_1340904_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|1340910_1341786_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957910.1|1341936_1344183_-	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_126656918.1|1344195_1344726_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082201.1|1345410_1346100_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|1346168_1346882_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 107
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1356512	1359011	4544936		Aichi_virus(50.0%)	2	NA	NA
WP_000256438.1|1356512_1357931_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603502.1|1358249_1359011_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
>prophage 108
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1370750	1371506	4544936		Clostridium_phage(100.0%)	1	NA	NA
WP_001301085.1|1370750_1371506_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 109
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1395965	1397366	4544936		environmental_Halophage(100.0%)	1	NA	NA
WP_001280192.1|1395965_1397366_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
>prophage 110
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1402865	1411240	4544936	tRNA	Enterobacteria_phage(20.0%)	8	NA	NA
WP_001295374.1|1402865_1404314_+	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001050745.1|1404315_1404441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001192788.1|1404562_1405111_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003071.1|1405153_1406671_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|1406680_1407779_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_110843999.1|1407869_1409603_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	1.4e-60
WP_000715222.1|1409608_1410319_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806650.1|1410343_1411240_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	1.8e-30
>prophage 111
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1415045	1419518	4544936		Pandoravirus(50.0%)	2	NA	NA
WP_001394742.1|1415045_1416479_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	1.5e-31
WP_000195039.1|1416644_1419518_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	3.7e-263
>prophage 112
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1427653	1428886	4544936		Catovirus(100.0%)	1	NA	NA
WP_001151603.1|1427653_1428886_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	3.3e-104
>prophage 113
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1446726	1447404	4544936		Bacillus_virus(100.0%)	1	NA	NA
WP_000956899.1|1446726_1447404_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.6	8.4e-09
>prophage 114
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1461837	1462992	4544936		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|1461837_1462992_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 115
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1488819	1491444	4544936	transposase	Pseudomonas_phage(50.0%)	2	NA	NA
WP_157716881.1|1488819_1490082_+	DUF4102 domain-containing protein	NA	A0A1B0VMI6	Pseudomonas_phage	42.6	2.2e-79
WP_096954148.1|1490520_1491444_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	6.6e-166
>prophage 116
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1502821	1505131	4544936	transposase	Shigella_phage(50.0%)	3	NA	NA
WP_001395295.1|1502821_1503046_-|transposase	transposase	transposase	Q76S41	Shigella_phage	70.8	1.2e-17
WP_001398324.1|1504593_1504773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000691818.1|1504909_1505131_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	2.5e-10
>prophage 117
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1523550	1524723	4544936		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524970.1|1523550_1524723_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	5.5e-40
>prophage 118
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1546934	1547819	4544936		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018760.1|1546934_1547819_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 119
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1553895	1563246	4544936		Staphylococcus_phage(33.33%)	7	NA	NA
WP_000013149.1|1553895_1554723_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
WP_000691619.1|1554922_1555849_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848528.1|1555899_1556157_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095187.1|1556199_1558419_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000059388.1|1558529_1559942_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000965722.1|1560016_1560754_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_072777792.1|1560987_1563246_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	2.4e-84
>prophage 120
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1566556	1566949	4544936		Stx_converting_phage(100.0%)	1	NA	NA
WP_000712658.1|1566556_1566949_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 121
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1570776	1581736	4544936		Bacillus_virus(20.0%)	12	NA	NA
WP_000195296.1|1570776_1572669_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
WP_000105733.1|1572697_1573279_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444752.1|1573278_1574106_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|1574130_1574553_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917138.1|1574553_1575183_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	4.1e-18
WP_000735278.1|1575387_1576869_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|1577016_1577688_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442860.1|1577693_1578854_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000188362.1|1578891_1579707_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_001295627.1|1579822_1580596_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000469266.1|1580653_1580824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076997.1|1581082_1581736_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
>prophage 122
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1591250	1592684	4544936		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|1591250_1592684_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 123
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1597821	1599060	4544936	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708487.1|1597821_1599060_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.9	3.5e-93
>prophage 124
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1605460	1621656	4544936	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001264352.1|1605460_1606474_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
WP_001144069.1|1606711_1606927_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918827.1|1607037_1608783_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437375.1|1608977_1610819_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228937.1|1610897_1611404_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001066494.1|1611657_1612422_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018003.1|1612709_1613333_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000094721.1|1613486_1615007_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
WP_000627220.1|1615313_1616804_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.2e-33
WP_000450594.1|1616845_1617178_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212475.1|1617396_1618380_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_001082856.1|1618563_1621656_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.0	2.5e-156
>prophage 125
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1633283	1634249	4544936		Escherichia_phage(100.0%)	1	NA	NA
WP_001098806.1|1633283_1634249_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 126
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1654829	1657124	4544936		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|1654829_1657124_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 127
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1665069	1666215	4544936		Streptococcus_phage(100.0%)	1	NA	NA
WP_001300387.1|1665069_1666215_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 128
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1689217	1697011	4544936		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809262.1|1689217_1690078_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.5e-50
WP_000249107.1|1690142_1692179_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000246830.1|1692136_1692532_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158034.1|1692551_1693142_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646033.1|1693151_1693727_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147571.1|1693840_1694881_-	permease	NA	NA	NA	NA	NA
WP_001300423.1|1694953_1695589_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000037608.1|1695716_1696235_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_000449030.1|1696214_1696658_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189333.1|1696708_1697011_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	53.8	7.8e-15
>prophage 129
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1702713	1704603	4544936		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|1702713_1704603_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 130
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1710084	1716723	4544936		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133044.1|1710084_1712757_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
WP_001031057.1|1712781_1714269_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|1714296_1714749_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207680.1|1715379_1716723_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 131
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1720805	1723678	4544936	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764731.1|1720805_1721654_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
WP_001107467.1|1721743_1723678_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 132
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1730452	1731931	4544936		Indivirus(50.0%)	2	NA	NA
WP_001047336.1|1730452_1731424_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445413.1|1731652_1731931_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
>prophage 133
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1735999	1750794	4544936		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|1735999_1736809_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922901.1|1737018_1737996_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|1738009_1738996_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030005.1|1739016_1739583_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|1739579_1740155_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|1740123_1740681_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|1740687_1741413_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809057.1|1741460_1742894_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|1742916_1743204_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183676.1|1743321_1743813_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|1743858_1744713_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|1744709_1744982_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620405.1|1745195_1745828_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047091.1|1745824_1746553_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001300411.1|1746549_1747203_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809774.1|1747432_1749769_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001299745.1|1749864_1750794_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 134
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1758164	1762534	4544936		Salmonella_phage(50.0%)	5	NA	NA
WP_072145225.1|1758164_1758914_+	DUF1016 family protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	3.1e-73
WP_000979882.1|1758973_1759438_-	DUF386 domain-containing protein	NA	NA	NA	NA	NA
WP_000209011.1|1759434_1760310_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000054239.1|1760306_1760996_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000108459.1|1761043_1762534_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 135
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1766238	1766736	4544936	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366126.1|1766238_1766736_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
>prophage 136
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1770702	1773227	4544936	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001295271.1|1770702_1772070_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497723.1|1772159_1773227_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 137
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1790005	1791049	4544936		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|1790005_1791049_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 138
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1801614	1802499	4544936		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258895.1|1801614_1802499_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.9e-24
>prophage 139
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1809615	1813769	4544936		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000738568.1|1809615_1810641_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	1.8e-71
WP_000019655.1|1810708_1811890_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001300681.1|1811899_1813003_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078349.1|1813010_1813769_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	9.1e-20
>prophage 140
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1824181	1825653	4544936	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114984.1|1824181_1824691_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000004473.1|1824705_1825653_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 141
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1846861	1848814	4544936		Vibrio_phage(100.0%)	1	NA	NA
WP_001326512.1|1846861_1848814_+	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	30.9	9.2e-32
>prophage 142
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1857645	1866205	4544936		uncultured_Caudovirales_phage(40.0%)	8	NA	NA
WP_104774102.1|1857645_1860339_-	bifunctional chitinase/lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	36.0	8.7e-41
WP_000031783.1|1860631_1861816_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|1861886_1864001_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|1864097_1864568_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|1864664_1865039_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903373.1|1865164_1865452_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820714.1|1865459_1865819_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_001209680.1|1865818_1866205_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	3.3e-18
>prophage 143
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1871775	1881316	4544936		Tupanvirus(25.0%)	9	NA	NA
WP_000634798.1|1871775_1873689_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
WP_000057356.1|1873688_1874711_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|1874704_1874923_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274680.1|1874976_1875846_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|1875900_1876305_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|1876606_1877239_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001295162.1|1877289_1879380_+	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000963792.1|1879446_1880667_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000601847.1|1880752_1881316_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
>prophage 144
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1905557	1906394	4544936		Vibrio_phage(100.0%)	1	NA	NA
WP_000742141.1|1905557_1906394_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 145
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1923299	1927066	4544936		Bacillus_phage(66.67%)	3	NA	NA
WP_157716891.1|1923299_1924922_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
WP_001253696.1|1924997_1926350_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001157751.1|1926346_1927066_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 146
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1933629	1934508	4544936		Sodalis_phage(100.0%)	1	NA	NA
WP_000039072.1|1933629_1934508_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	2.5e-69
>prophage 147
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1940542	1942936	4544936		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_072778043.1|1940542_1942936_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 148
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1947315	1948542	4544936		Ralstonia_phage(100.0%)	1	NA	NA
WP_072778045.1|1947315_1948542_-	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	59.8	8.9e-134
>prophage 149
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1954597	1957045	4544936		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|1954597_1957045_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 150
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1976830	1978641	4544936		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073599.1|1976830_1977574_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	2.9e-10
WP_157716892.1|1977570_1978641_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 151
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1982182	1983665	4544936		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416900.1|1982182_1982896_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
WP_000082098.1|1982897_1983665_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 152
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1989399	1992218	4544936		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|1989399_1990254_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|1990498_1991557_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|1991549_1992218_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 153
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	1995224	1999356	4544936		Dickeya_phage(50.0%)	4	NA	NA
WP_000964718.1|1995224_1995851_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_157716893.1|1995924_1998123_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.4	1.9e-118
WP_000130621.1|1998224_1998470_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100469.1|1998690_1999356_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.1	2.8e-57
>prophage 154
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2007249	2008056	4544936		Bacillus_virus(100.0%)	1	NA	NA
WP_000173631.1|2007249_2008056_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	2.6e-17
>prophage 155
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2016252	2018988	4544936		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000149154.1|2016252_2018988_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	5.4e-22
>prophage 156
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2033367	2035410	4544936		Indivirus(100.0%)	1	NA	NA
WP_001298719.1|2033367_2035410_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	6.8e-46
>prophage 157
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2039532	2041667	4544936		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000008957.1|2039532_2039886_+	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
WP_072778457.1|2039939_2041229_+	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.1	6.6e-172
WP_000065769.1|2041241_2041667_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
>prophage 158
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2045057	2045705	4544936		Bacillus_virus(100.0%)	1	NA	NA
WP_001296814.1|2045057_2045705_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 159
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2092427	2094412	4544936		Bacillus_virus(50.0%)	2	NA	NA
WP_000107012.1|2092427_2093432_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
WP_001196486.1|2093428_2094412_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
>prophage 160
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2104591	2106925	4544936		Escherichia_phage(100.0%)	1	NA	NA
WP_072778784.1|2104591_2106925_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.2	3.5e-70
>prophage 161
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2110579	2110792	4544936		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|2110579_2110792_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 162
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2116376	2117372	4544936		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182650.1|2116376_2117372_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 163
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2122690	2124232	4544936		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146479.1|2122690_2124232_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 164
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2136583	2136757	4544936		Escherichia_phage(100.0%)	1	NA	NA
WP_157716898.1|2136583_2136757_+	hypothetical protein	NA	A0A2L1IV26	Escherichia_phage	90.0	2.6e-07
>prophage 165
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2140980	2142825	4544936		Tupanvirus(100.0%)	1	NA	NA
WP_072778742.1|2140980_2142825_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	26.3	2.1e-14
>prophage 166
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2167131	2177860	4544936		Rhizobium_phage(16.67%)	9	NA	NA
WP_000024392.1|2167131_2167383_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001156181.1|2167524_2167956_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_001350558.1|2168200_2169745_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214147.1|2169754_2171038_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483847.1|2171041_2172001_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982115.1|2171987_2173022_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000646007.1|2173260_2174286_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213834.1|2174295_2175492_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000587760.1|2176927_2177860_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	6.5e-36
>prophage 167
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2182112	2183093	4544936		Archaeal_BJ1_virus(100.0%)	1	NA	NA
WP_096264889.1|2182112_2183093_-	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.9	4.0e-12
>prophage 168
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2190519	2195082	4544936		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171873.1|2190519_2190999_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.6	6.3e-27
WP_001114533.1|2191037_2191847_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001051798.1|2191944_2192112_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|2192132_2192369_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001297375.1|2192585_2193254_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000050139.1|2193425_2194646_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_001298007.1|2194626_2195082_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
>prophage 169
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2198456	2205206	4544936		Morganella_phage(25.0%)	6	NA	NA
WP_001300958.1|2198456_2199281_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	76.6	2.4e-90
WP_000924289.1|2199571_2200189_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_000870036.1|2200185_2201868_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	1.5e-22
WP_001295237.1|2202125_2202749_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|2202803_2203079_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280488.1|2203097_2205206_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 170
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2209642	2211034	4544936		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|2209642_2211034_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 171
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2231664	2237877	4544936	transposase	Micromonas_sp._RCC1109_virus(33.33%)	8	NA	NA
WP_072778937.1|2231664_2233353_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	3.2e-57
WP_001300753.1|2233458_2233557_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000060506.1|2234121_2234211_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_000828746.1|2234490_2235675_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000148061.1|2235682_2236180_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|2236176_2236539_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|2236528_2236876_-	YidH family protein	NA	NA	NA	NA	NA
WP_157717003.1|2237448_2237877_-|transposase	transposase	transposase	A0A1W6JP07	Morganella_phage	91.3	1.3e-42
>prophage 172
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2244601	2245555	4544936		Synechococcus_phage(50.0%)	2	NA	NA
WP_001243431.1|2244601_2245030_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|2245141_2245555_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 173
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2249982	2251131	4544936		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|2249982_2251131_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 174
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2255837	2263206	4544936		Bacillus_virus(33.33%)	8	NA	NA
WP_000072067.1|2255837_2258252_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060112.1|2258280_2259354_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|2259353_2260454_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|2260458_2261862_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_120795392.1|2262158_2262239_+	protein YsdD	NA	NA	NA	NA	NA
WP_000831330.1|2262468_2262609_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|2262625_2262985_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|2262948_2263206_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 175
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2273404	2274742	4544936		Moraxella_phage(100.0%)	1	NA	NA
WP_000019348.1|2273404_2274742_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 176
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2285718	2293326	4544936		Bacillus_phage(25.0%)	6	NA	NA
WP_000063125.1|2285718_2286492_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251991.1|2286674_2287565_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|2287564_2288524_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|2288610_2289651_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000334099.1|2289964_2291794_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
WP_000933736.1|2291955_2293326_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
>prophage 177
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2305280	2306273	4544936		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845113.1|2305280_2306273_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.9e-50
>prophage 178
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2309441	2313409	4544936		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_000102319.1|2309441_2311310_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
WP_001301979.1|2311476_2311896_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387770.1|2311903_2313409_+	ribose ABC transporter ATP-binding protein RbsA	NA	G3M9Y6	Bacillus_virus	27.7	5.1e-14
>prophage 179
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2328047	2329694	4544936		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012608.1|2328047_2329694_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	1.6e-66
>prophage 180
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2338109	2343521	4544936		Bacillus_phage(33.33%)	4	NA	NA
WP_001238884.1|2338109_2340131_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	4.9e-113
WP_001299253.1|2340177_2341662_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047499.1|2341795_2343061_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|2343191_2343521_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 181
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2347563	2353707	4544936		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000866670.1|2347563_2348694_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.0e-27
WP_000006621.1|2348690_2349953_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_001226602.1|2349952_2351020_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	3.0e-101
WP_000676056.1|2351038_2351920_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001145183.1|2351897_2352572_+	dTDP-fucosamine acetyltransferase	NA	NA	NA	NA	NA
WP_000612043.1|2352576_2353707_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 182
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2361791	2363447	4544936		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000406041.1|2361791_2363447_-	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	29.5	1.4e-44
>prophage 183
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2373771	2377630	4544936		Bacillus_phage(100.0%)	3	NA	NA
WP_000130691.1|2373771_2374668_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_001213584.1|2374667_2375384_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383406.1|2375467_2377630_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 184
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2383340	2385170	4544936		Catovirus(100.0%)	1	NA	NA
WP_001395096.1|2383340_2385170_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 185
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2397702	2400989	4544936		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187530.1|2397702_2399343_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
WP_001351992.1|2399421_2399691_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459594.1|2399694_2400210_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109943.1|2400212_2400989_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 186
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2409921	2410536	4544936		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296979.1|2409921_2410536_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 187
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2424111	2426898	4544936		uncultured_virus(100.0%)	1	NA	NA
WP_000250007.1|2424111_2426898_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	2.2e-71
>prophage 188
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2431012	2433483	4544936		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001188777.1|2431012_2432422_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190577.1|2432433_2433483_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 189
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2450590	2453370	4544936		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000718901.1|2450590_2451487_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
WP_000621647.1|2451654_2452551_+	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000059678.1|2452584_2453370_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
>prophage 190
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2460690	2463741	4544936		Escherichia_phage(100.0%)	1	NA	NA
WP_077249888.1|2460690_2463741_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 191
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2478445	2485735	4544936	integrase	Bacillus_thuringiensis_phage(20.0%)	8	2481142:2481156	2488089:2488103
WP_000122641.1|2478445_2479066_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	8.4e-64
WP_001166063.1|2479325_2480309_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270260.1|2480457_2481132_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
2481142:2481156	attL	TGTAGGCCTGATAAG	NA	NA	NA	NA
WP_000580417.1|2481237_2482611_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|2482607_2483306_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|2483455_2483956_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_104774017.1|2484142_2485123_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	99.4	2.3e-185
WP_141094366.1|2485510_2485735_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	8.5e-35
2488089:2488103	attR	CTTATCAGGCCTACA	NA	NA	NA	NA
>prophage 192
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2496747	2501250	4544936		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_000084268.1|2496747_2497593_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|2498017_2498263_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|2498347_2498833_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|2498925_2499852_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293341.1|2499918_2501250_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
>prophage 193
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2518548	2525795	4544936		Synechococcus_phage(33.33%)	5	NA	NA
WP_000424840.1|2518548_2519211_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_001185137.1|2519222_2521724_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_001004454.1|2522032_2523112_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|2523126_2523447_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000184868.1|2523497_2525795_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 194
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2543141	2544986	4544936		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591359.1|2543141_2544986_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 195
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2553546	2556599	4544936		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|2553546_2554497_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_000031784.1|2555414_2556599_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 196
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2560715	2569044	4544936		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|2560715_2564744_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653944.1|2564820_2569044_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 197
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2578261	2580025	4544936		Klosneuvirus(50.0%)	3	NA	NA
WP_000362388.1|2578261_2578933_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000940106.1|2578975_2579566_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|2579752_2580025_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 198
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2585387	2586977	4544936		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187559.1|2585387_2586977_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	2.9e-68
>prophage 199
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2602758	2606442	4544936		Dickeya_phage(100.0%)	1	NA	NA
WP_072778149.1|2602758_2606442_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 200
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2626506	2627622	4544936		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|2626506_2627622_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 201
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2636841	2637450	4544936		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|2636841_2637450_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 202
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2650795	2654408	4544936		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357740.1|2650795_2653618_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000168305.1|2653871_2654408_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 203
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2658225	2659575	4544936		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|2658225_2659575_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 204
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2665154	2667113	4544936		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078209.1|2665154_2667113_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 205
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2676848	2678996	4544936		Escherichia_phage(100.0%)	1	NA	NA
WP_077250012.1|2676848_2678996_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	24.0	1.4e-33
>prophage 206
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2683069	2684602	4544936		Bacillus_virus(100.0%)	1	NA	NA
WP_157716906.1|2683069_2684602_-	D-allose ABC transporter ATP-binding protein AlsA	NA	G3M9Y6	Bacillus_virus	27.4	1.7e-12
>prophage 207
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2690836	2692386	4544936		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000611395.1|2690836_2691517_-	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.1	4.9e-09
WP_001075518.1|2691627_2692386_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	4.7e-16
>prophage 208
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2697974	2698763	4544936		Cedratvirus(100.0%)	1	NA	NA
WP_001193408.1|2697974_2698763_-	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	6.5e-13
>prophage 209
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2703796	2705299	4544936		Burkholderia_virus(100.0%)	1	NA	NA
WP_001298520.1|2703796_2705299_+	proline/glycine betaine transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	2.4e-56
>prophage 210
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2726483	2729695	4544936	tRNA	Catovirus(50.0%)	2	NA	NA
WP_001295074.1|2726483_2728001_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_072778207.1|2728237_2729695_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.2	3.4e-47
>prophage 211
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2743971	2745955	4544936		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|2743971_2744265_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|2744308_2745955_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 212
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2751238	2751772	4544936		Morganella_phage(100.0%)	1	NA	NA
WP_001238369.1|2751238_2751772_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 213
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2756692	2757670	4544936		Tupanvirus(100.0%)	1	NA	NA
WP_000004770.1|2756692_2757670_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	1.2e-27
>prophage 214
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2765097	2765643	4544936		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|2765097_2765643_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 215
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2769555	2782586	4544936	protease,tRNA	Vibrio_phage(20.0%)	11	NA	NA
WP_000990333.1|2769555_2770893_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_072778200.1|2770902_2772750_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	2.6e-60
WP_001280345.1|2772742_2773693_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|2773778_2774087_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|2774162_2775443_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|2775528_2776788_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|2776790_2777795_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|2777876_2778074_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|2778177_2779476_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177644.1|2779680_2780106_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076332.1|2780144_2782586_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	3.8e-67
>prophage 216
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2786508	2787672	4544936		Ralstonia_phage(100.0%)	1	NA	NA
WP_000943964.1|2786508_2787672_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
>prophage 217
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2824120	2830608	4544936		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_000055072.1|2824120_2824651_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000265933.1|2824960_2825917_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205790.1|2826056_2827559_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.1e-11
WP_001355584.1|2827572_2828595_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596015.1|2828581_2829577_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|2829609_2830608_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 218
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2834924	2837686	4544936		Cronobacter_phage(50.0%)	2	NA	NA
WP_001106238.1|2834924_2835389_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	1.1e-52
WP_000187778.1|2835547_2837686_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
>prophage 219
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2841324	2847421	4544936		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_001181324.1|2841324_2842272_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|2842456_2842510_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471866.1|2842650_2845347_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047539.1|2845552_2845939_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|2846011_2846473_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|2846485_2847421_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 220
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2855794	2867784	4544936	integrase,tRNA	Klosneuvirus(20.0%)	8	2850747:2850761	2872941:2872955
2850747:2850761	attL	TGGCAGTGAAATAAT	NA	NA	NA	NA
WP_000416407.1|2855794_2858650_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786399.1|2858649_2859093_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|2859350_2860862_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|2861128_2862229_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|2862228_2863311_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001351898.1|2863429_2864932_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	4.6e-84
WP_001299662.1|2865061_2866081_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	8.4e-45
WP_072778466.1|2866524_2867784_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.7	1.3e-74
2872941:2872955	attR	TGGCAGTGAAATAAT	NA	NA	NA	NA
>prophage 221
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2873142	2874123	4544936		Escherichia_phage(100.0%)	1	NA	NA
WP_000338799.1|2873142_2874123_-	sialate O-acetylesterase	NA	H6WZJ9	Escherichia_phage	55.0	1.6e-101
>prophage 222
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2877406	2878009	4544936		Escherichia_phage(100.0%)	1	NA	NA
WP_000790583.1|2877406_2878009_+	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
>prophage 223
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2888139	2889600	4544936		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208195.1|2888139_2889600_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	9.5e-50
>prophage 224
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2896167	2896722	4544936		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151863.1|2896167_2896722_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.0	6.0e-37
>prophage 225
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2904846	2905305	4544936	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_023486887.1|2904846_2905305_+|transposase	transposase	transposase	Q2A0A7	Sodalis_phage	46.6	1.4e-12
>prophage 226
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2927872	2933240	4544936		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_000919593.1|2927872_2929537_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.3	3.6e-13
WP_000410147.1|2929585_2930947_-	MFS transporter	NA	NA	NA	NA	NA
WP_000091585.1|2931161_2932076_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000106034.1|2932214_2933240_+	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
>prophage 227
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2936462	2937742	4544936		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|2936462_2937200_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_157716916.1|2937202_2937742_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	61.7	2.4e-27
>prophage 228
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2945402	2948278	4544936		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175943.1|2945402_2946992_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|2947384_2947990_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|2948116_2948278_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 229
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2953913	2955236	4544936		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|2953913_2955236_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 230
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2961979	2967334	4544936		Enterococcus_phage(33.33%)	3	NA	NA
WP_000093810.1|2961979_2963212_+	trifunctional nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase/transcriptional regulator NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_000046749.1|2963518_2965186_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409451.1|2965396_2967334_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 231
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2970566	2972680	4544936		Bacillus_phage(50.0%)	2	NA	NA
WP_001188659.1|2970566_2971256_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_072778387.1|2971255_2972680_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	1.6e-09
>prophage 232
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	2984444	2996308	4544936	transposase	Cyanophage(16.67%)	11	NA	NA
WP_000130185.1|2984444_2985398_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
WP_001295414.1|2985512_2986100_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528538.1|2986134_2986701_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_047669459.1|2986849_2987563_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000843568.1|2987588_2987993_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|2988369_2990286_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118475.1|2990374_2991505_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.3	7.9e-28
WP_001300563.1|2991767_2992880_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000935262.1|2992957_2993167_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_118394057.1|2993209_2994579_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_000681368.1|2995141_2996308_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.8	9.2e-88
>prophage 233
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3003311	3006128	4544936	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286857.1|3003311_3006128_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 234
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3010571	3011720	4544936		Halovirus(100.0%)	1	NA	NA
WP_001355532.1|3010571_3011720_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.5	1.7e-49
>prophage 235
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3017189	3022861	4544936		Hepacivirus(50.0%)	4	NA	NA
WP_001297614.1|3017189_3018743_-	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	25.4	4.7e-31
WP_000349932.1|3018816_3020034_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|3020173_3021316_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787103.1|3021346_3022861_-	L-carnitine/gamma-butyrobetaine antiporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 236
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3032636	3033485	4544936		Microcystis_phage(100.0%)	1	NA	NA
WP_000257184.1|3032636_3033485_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
>prophage 237
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3041229	3046652	4544936		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001117011.1|3041229_3044136_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_050010187.1|3044300_3046652_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.8e-37
>prophage 238
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3052985	3053684	4544936		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916323.1|3052985_3053684_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	2.8e-23
>prophage 239
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3066369	3068094	4544936		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425668.1|3066369_3068094_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.9e-36
>prophage 240
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3094072	3095116	4544936		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217351.1|3094072_3095116_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	4.8e-104
>prophage 241
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3099361	3099913	4544936		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923727.1|3099361_3099913_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.5e-11
>prophage 242
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3108549	3109974	4544936		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|3108549_3109974_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 243
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3117719	3124195	4544936		Mamastrovirus(33.33%)	5	NA	NA
WP_001189582.1|3117719_3119270_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
WP_001393627.1|3119316_3121707_-	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|3121920_3122457_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|3122497_3123160_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|3123268_3124195_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 244
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3127457	3128390	4544936	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_157716921.1|3127457_3128390_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	49.8	1.4e-59
>prophage 245
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3138547	3145353	4544936	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174643.1|3138547_3139966_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937443.1|3140004_3140931_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|3140967_3141423_-	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
WP_000396037.1|3141600_3142305_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294687.1|3142319_3142850_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_072777777.1|3142923_3145353_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.6	2.3e-40
>prophage 246
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3150494	3151292	4544936		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|3150494_3151292_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 247
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3157326	3157671	4544936		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|3157326_3157671_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 248
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3161600	3163025	4544936	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|3161600_3163025_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 249
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3174874	3175633	4544936		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|3174874_3175633_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 250
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3184461	3188577	4544936		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_000569420.1|3184461_3185058_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	6.7e-26
WP_001294774.1|3185094_3188577_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
>prophage 251
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3201447	3202479	4544936		Planktothrix_phage(100.0%)	1	NA	NA
WP_000594006.1|3201447_3202479_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
>prophage 252
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3208900	3216532	4544936		Indivirus(25.0%)	9	NA	NA
WP_000997010.1|3208900_3209704_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_000648572.1|3209700_3210615_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|3210855_3211656_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000016007.1|3211659_3212283_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000644685.1|3212330_3213689_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052709.1|3213760_3214516_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001326702.1|3214549_3215272_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|3215268_3215736_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001340895.1|3215800_3216532_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
>prophage 253
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3232368	3232947	4544936		Caulobacter_phage(100.0%)	1	NA	NA
WP_000284050.1|3232368_3232947_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
>prophage 254
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3236426	3272166	4544936	integrase,transposase,tail,head,capsid	Shigella_phage(38.46%)	44	3251522:3251537	3279369:3279384
WP_000006255.1|3236426_3236924_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|3237147_3238887_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_001301266.1|3238846_3239617_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_157716925.1|3239902_3240811_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000896590.1|3241400_3241694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086540.1|3242062_3242635_+	resolvase	NA	A0A219Y9V9	Aeromonas_phage	37.5	8.1e-21
WP_157716926.1|3242638_3243601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024046392.1|3243638_3245183_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000691315.1|3245244_3246297_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554757.1|3246348_3246642_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263493.1|3246644_3247043_+	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_001059847.1|3247052_3247505_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_072778562.1|3247738_3248005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329160.1|3247937_3248474_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001293003.1|3248530_3249988_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|3250248_3250707_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189541.1|3250798_3252043_+	esterase FrsA	NA	NA	NA	NA	NA
3251522:3251537	attL	ACCCAGGACTCCAGCC	NA	NA	NA	NA
WP_000174677.1|3252100_3252502_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|3252540_3253596_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|3253882_3254986_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893277.1|3254997_3256251_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	9.8e-96
WP_001471955.1|3256455_3257619_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	5.3e-229
WP_077873866.1|3257495_3257930_-	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	6.4e-79
WP_001471956.1|3257845_3258190_-	hypothetical protein	NA	U5P0J0	Shigella_phage	80.7	2.0e-30
WP_157716927.1|3258186_3259059_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	92.4	7.7e-164
WP_000008187.1|3259049_3259586_-	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	98.9	1.8e-99
WP_042108889.1|3259713_3260538_-	DUF2303 family protein	NA	K7PJQ6	Enterobacteria_phage	98.5	1.5e-148
WP_000135682.1|3260603_3260966_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000917896.1|3261566_3261863_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_001020634.1|3262140_3262833_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_001191674.1|3262930_3263191_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_000515845.1|3263183_3263735_+	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001250269.1|3263910_3264090_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_157716928.1|3264079_3265063_+	GntR family transcriptional regulator	NA	A0A291AWU7	Escherichia_phage	98.4	3.0e-140
WP_001471961.1|3265070_3266060_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	2.8e-194
WP_000609696.1|3266074_3266653_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	53.9	1.6e-45
WP_000220228.1|3266759_3267356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157716929.1|3267446_3268064_+|capsid	phage major capsid protein	capsid	A0A1B5FPI9	Escherichia_phage	100.0	2.0e-65
WP_000601360.1|3268113_3268314_+	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000927711.1|3268316_3268640_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_157717004.1|3270172_3270781_+|tail	tail fiber assembly protein	tail	K7P870	Enterobacteria_phage	95.5	4.6e-107
WP_157716930.1|3270752_3271184_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	72.9	1.4e-41
WP_157717005.1|3271186_3271582_-	hypothetical protein	NA	F1BUP1	Erwinia_phage	37.3	2.3e-14
WP_000904960.1|3271611_3272166_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	89.0	5.7e-88
3279369:3279384	attR	ACCCAGGACTCCAGCC	NA	NA	NA	NA
>prophage 255
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3280479	3283722	4544936		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000919795.1|3280479_3283722_-	DEAD/DEAH box helicase	NA	A0A1B1ISM1	uncultured_Mediterranean_phage	25.9	2.2e-30
>prophage 256
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3289476	3305729	4544936	integrase	Plesiomonas_phage(20.0%)	10	3290555:3290569	3303176:3303190
WP_001057701.1|3289476_3291186_+	type I restriction-modification system subunit M	NA	A0A2I6PG28	Plesiomonas_phage	26.0	1.4e-12
3290555:3290569	attL	CACCGCCGCAGGGCA	NA	NA	NA	NA
WP_001557760.1|3291175_3292645_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_000278725.1|3292637_3293825_+	DUF4268 domain-containing protein	NA	NA	NA	NA	NA
WP_157716934.1|3293824_3295366_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	29.6	5.3e-35
WP_001557761.1|3295542_3298575_+	AAA family ATPase	NA	A0A1V0SG90	Hokovirus	23.4	3.5e-14
WP_000836815.1|3298574_3299390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157716935.1|3299541_3300858_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4QX09	Salmonella_phage	27.0	2.8e-16
WP_001111348.1|3302175_3302586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000121346.1|3302564_3303521_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
3303176:3303190	attR	CACCGCCGCAGGGCA	NA	NA	NA	NA
WP_000667036.1|3303530_3305729_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.7	4.3e-38
>prophage 257
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3326697	3328023	4544936		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_001046307.1|3326697_3328023_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
>prophage 258
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3333598	3339518	4544936	holin	Catovirus(50.0%)	4	NA	NA
WP_072778813.1|3333598_3335269_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	1.8e-60
WP_000089110.1|3335282_3336755_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001335745.1|3336768_3337356_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|3337484_3339518_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
>prophage 259
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3350603	3351653	4544936		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_000692754.1|3350603_3351653_+	NADPH-dependent aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.6	2.8e-72
>prophage 260
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3360294	3362181	4544936		Staphylococcus_phage(100.0%)	1	NA	NA
WP_157716938.1|3360294_3362181_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	4.1e-53
>prophage 261
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3365379	3366279	4544936		Lactobacillus_phage(100.0%)	1	NA	NA
WP_000952503.1|3365379_3366279_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
>prophage 262
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3370819	3375099	4544936		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_000177905.1|3370819_3373894_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	99.9	0.0e+00
WP_000805902.1|3374016_3375099_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
>prophage 263
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3380509	3382470	4544936		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_000044314.1|3380509_3381460_+	acetaldehyde dehydrogenase (acetylating)	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
WP_001013494.1|3381456_3382470_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	9.2e-44
>prophage 264
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3385851	3386961	4544936		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|3385851_3386961_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 265
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3392262	3393030	4544936		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939399.1|3392262_3393030_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-25
>prophage 266
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3399981	3401139	4544936		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830738.1|3399981_3401139_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	3.9e-06
>prophage 267
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3408556	3410498	4544936		Bacillus_phage(50.0%)	2	NA	NA
WP_000484048.1|3408556_3409672_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
WP_157716939.1|3409688_3410498_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	39.7	7.9e-38
>prophage 268
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3413961	3424038	4544936		Bacillus_phage(60.0%)	7	NA	NA
WP_072778078.1|3413961_3414873_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	4.6e-103
WP_001219309.1|3414997_3415906_+	fructokinase	NA	NA	NA	NA	NA
WP_001393815.1|3416150_3417335_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_157716940.1|3417460_3420607_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001221319.1|3420603_3421806_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000113933.1|3421995_3422685_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_000893623.1|3422742_3424038_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.7e-26
>prophage 269
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3430990	3439971	4544936	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667319.1|3430990_3432118_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|3432140_3432473_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934822.1|3432500_3434348_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|3434358_3435330_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974813.1|3435458_3435806_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295328.1|3435982_3436867_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001326929.1|3437165_3437705_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|3437855_3438305_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001150457.1|3438308_3439412_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.8	2.8e-54
WP_001021161.1|3439500_3439971_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 270
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3461530	3463554	4544936	protease	Agrobacterium_phage(50.0%)	2	NA	NA
WP_000122253.1|3461530_3462154_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|3462279_3463554_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
>prophage 271
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3474717	3478264	4544936		Bacillus_phage(100.0%)	2	NA	NA
WP_001235622.1|3474717_3476490_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	2.6e-49
WP_001256201.1|3476482_3478264_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	2.3e-42
>prophage 272
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3487096	3490246	4544936		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|3487096_3490246_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 273
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3497254	3505816	4544936		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|3497254_3497806_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122013.1|3497934_3499866_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|3499918_3500248_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|3500247_3500853_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678201.1|3500962_3502837_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001220233.1|3503017_3503662_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250088.1|3503897_3504860_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801850.1|3504856_3505816_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	6.5e-15
>prophage 274
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3514060	3517222	4544936		Escherichia_phage(50.0%)	2	NA	NA
WP_000806442.1|3514060_3514402_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
WP_000083955.1|3514717_3517222_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	2.9e-115
>prophage 275
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3521761	3522439	4544936		Bacillus_virus(100.0%)	1	NA	NA
WP_001157540.1|3521761_3522439_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	1.4e-27
>prophage 276
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3525575	3533370	4544936		Planktothrix_phage(50.0%)	3	NA	NA
WP_001110573.1|3525575_3526262_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|3526258_3528673_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_157716950.1|3529098_3533370_+	DUF4329 domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.5	1.7e-22
>prophage 277
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3539325	3541107	4544936		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001355653.1|3539325_3541107_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
>prophage 278
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3547297	3548443	4544936		Streptococcus_phage(100.0%)	1	NA	NA
WP_000706355.1|3547297_3548443_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
>prophage 279
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3560020	3563151	4544936	tRNA	Moumouvirus(50.0%)	4	NA	NA
WP_000912345.1|3560020_3561406_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143558.1|3561441_3561963_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|3562070_3562283_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|3562284_3563151_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
>prophage 280
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3570232	3583816	4544936	integrase,lysis	Enterobacteria_phage(56.25%)	18	3570173:3570219	3587048:3587094
3570173:3570219	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001299447.1|3570232_3571396_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
WP_000446905.1|3571251_3571623_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000211451.1|3574315_3574924_+	hypothetical protein	NA	Q7Y5X0	Haemophilus_phage	42.1	6.3e-32
WP_000990010.1|3575159_3575669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072841938.1|3575765_3575867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053027.1|3575863_3576319_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	2.2e-61
WP_000224914.1|3576318_3576489_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774474.1|3576481_3576772_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	3.3e-47
WP_001099703.1|3576768_3577131_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	3.3e-60
WP_000971091.1|3577127_3577268_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	75.0	1.1e-08
WP_001204793.1|3577353_3577737_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	8.8e-56
WP_024238521.1|3577924_3579007_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	78.4	6.8e-162
WP_000839596.1|3579580_3579796_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_157716953.1|3579795_3580293_+	glycoside hydrolase family protein	NA	A0A1B5FP97	Escherichia_phage	97.0	2.1e-89
WP_001228702.1|3580509_3580716_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	5.3e-31
WP_001139678.1|3580744_3580897_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_000079508.1|3581248_3581659_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_157717006.1|3582010_3583816_+	short-chain dehydrogenase	NA	A0A077SK37	Escherichia_phage	67.7	2.4e-55
3587048:3587094	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 281
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3592263	3597036	4544936		Ralstonia_phage(50.0%)	3	NA	NA
WP_000103232.1|3592263_3594165_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.5	3.3e-26
WP_000253838.1|3594914_3596363_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
WP_000770953.1|3596352_3597036_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 282
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3600306	3603450	4544936		Leptospira_phage(100.0%)	1	NA	NA
WP_000573945.1|3600306_3603450_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
>prophage 283
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3615664	3621682	4544936		Tupanvirus(50.0%)	2	NA	NA
WP_000077805.1|3615664_3619546_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.0	1.6e-59
WP_000140647.1|3620866_3621682_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 284
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3636228	3638051	4544936		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502945.1|3636228_3636858_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
WP_000029821.1|3636830_3638051_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	33.0	1.2e-58
>prophage 285
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3641216	3643331	4544936		Bacillus_virus(50.0%)	2	NA	NA
WP_000887629.1|3641216_3642782_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_000278509.1|3642902_3643331_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
>prophage 286
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3658621	3659268	4544936		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|3658621_3658831_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939737.1|3658884_3659268_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	8.9e-24
>prophage 287
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3664082	3666521	4544936		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|3664082_3665294_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231430.1|3665432_3666521_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 288
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3673531	3676114	4544936	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001340834.1|3673531_3676114_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.5	1.0e-184
>prophage 289
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3683053	3686586	4544936		Bathycoccus_sp._RCC1105_virus(50.0%)	3	NA	NA
WP_000367875.1|3683053_3684724_-	molecular chaperone HscC	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	32.6	4.0e-76
WP_001207520.1|3684807_3685743_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631384.1|3685860_3686586_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 290
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3692470	3693550	4544936		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|3692470_3693550_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 291
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3697644	3699309	4544936		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337077.1|3697644_3699309_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	6.1e-85
>prophage 292
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3704075	3707954	4544936	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_104774040.1|3704075_3706022_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
WP_001287154.1|3706289_3707954_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
>prophage 293
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3712234	3712999	4544936		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773301.1|3712234_3712999_-	esterase	NA	A0A1J0GVH7	Mycobacterium_phage	35.4	4.4e-06
>prophage 294
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3721253	3727234	4544936		Bacillus_phage(33.33%)	4	NA	NA
WP_000186076.1|3721253_3721931_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	2.0e-26
WP_001310640.1|3721927_3724612_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	5.0e-12
WP_001300431.1|3724604_3725177_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_000087946.1|3725185_3727234_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.0	2.4e-27
>prophage 295
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3737831	3740881	4544936		Hokovirus(50.0%)	2	NA	NA
WP_000207142.1|3737831_3739250_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	3.1e-61
WP_001032689.1|3739399_3740881_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
>prophage 296
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3744259	3745051	4544936		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114026.1|3744259_3745051_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	31.5	2.2e-08
>prophage 297
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3781206	3784726	4544936		Vibrio_phage(33.33%)	4	NA	NA
WP_000345410.1|3781206_3781926_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
WP_000951292.1|3781922_3782864_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000784351.1|3782977_3783358_-	periplasmic protein	NA	NA	NA	NA	NA
WP_001109196.1|3783673_3784726_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
>prophage 298
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3789079	3795653	4544936		Tupanvirus(33.33%)	7	NA	NA
WP_001265438.1|3789079_3790096_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	6.1e-80
WP_000096869.1|3790356_3791829_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
WP_001147439.1|3791896_3792685_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|3792813_3792963_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_000101984.1|3793129_3793903_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604034.1|3793902_3794592_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891692.1|3794594_3795653_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.5e-20
>prophage 299
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3806785	3808075	4544936		Klosneuvirus(100.0%)	1	NA	NA
WP_001295303.1|3806785_3808075_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.3e-20
>prophage 300
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3814556	3815465	4544936		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|3814556_3815465_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 301
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3826062	3837274	4544936		Anomala_cuprea_entomopoxvirus(20.0%)	10	NA	NA
WP_000996107.1|3826062_3827799_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000743444.1|3827791_3828787_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001296991.1|3828789_3829461_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007101.1|3829689_3831054_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001145126.1|3831285_3831768_-	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.0	9.8e-36
WP_001340191.1|3831887_3834038_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
WP_000386551.1|3834065_3835028_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000443530.1|3835168_3836254_+	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000849301.1|3836482_3836743_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146343.1|3837007_3837274_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
>prophage 302
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3844488	3849709	4544936		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569083.1|3844488_3845211_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	5.6e-35
WP_001159065.1|3845207_3845867_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|3846005_3846752_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|3847155_3847659_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001295297.1|3847953_3848841_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|3849075_3849141_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|3849193_3849709_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 303
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3854706	3863048	4544936		Tupanvirus(33.33%)	6	NA	NA
WP_000961458.1|3854706_3856299_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_000168797.1|3856539_3857805_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000114272.1|3857956_3858772_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_157716964.1|3858917_3861350_-	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	44.9	1.6e-09
WP_001295295.1|3861355_3862255_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001336208.1|3862385_3863048_+	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.5	2.8e-25
>prophage 304
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3866263	3868135	4544936		Planktothrix_phage(100.0%)	1	NA	NA
WP_001301279.1|3866263_3868135_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	5.2e-16
>prophage 305
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3879470	3880673	4544936		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001300708.1|3879470_3880673_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	1.1e-99
>prophage 306
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3886807	3947683	4544936	plate,integrase,tail,lysis,protease,tRNA	Salmonella_phage(25.0%)	54	3884222:3884237	3955940:3955955
3884222:3884237	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
WP_000290950.1|3886807_3887860_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
WP_000900883.1|3888048_3888240_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_157716967.1|3888255_3888822_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	42.9	3.0e-36
WP_001247707.1|3888947_3889169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157716968.1|3889201_3889822_+	hypothetical protein	NA	E5G6L3	Salmonella_phage	97.1	2.9e-32
WP_001337513.1|3889830_3890259_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	77.3	2.9e-47
WP_088492046.1|3890354_3890786_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	87.4	1.2e-64
WP_048266800.1|3890778_3891225_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	78.4	4.3e-54
WP_000993753.1|3893344_3893923_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.4	1.5e-91
WP_000972391.1|3894880_3895099_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024876.1|3895334_3897020_-	transporter	NA	NA	NA	NA	NA
WP_000681108.1|3897289_3897667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001201560.1|3898890_3899178_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189159.1|3899161_3899884_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|3899944_3900847_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|3900934_3901411_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126073.1|3901761_3902874_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_072777991.1|3902968_3904102_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_001093854.1|3904111_3905065_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061665.1|3905061_3905907_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_072777990.1|3905966_3906455_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149756.1|3906495_3907623_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	6.0e-28
WP_001295339.1|3907821_3908553_-	ABC transporter arginine-binding protein 1	NA	NA	NA	NA	NA
WP_000464491.1|3908845_3909514_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001691.1|3909513_3910230_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756569.1|3910236_3910968_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|3910985_3911714_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270734.1|3911931_3912447_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|3912572_3912896_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255167.1|3912892_3913723_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001338420.1|3913719_3914733_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001136554.1|3914831_3916262_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566372.1|3916272_3917274_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815362.1|3917310_3919029_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
WP_000178677.1|3919161_3920130_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458809.1|3920141_3921794_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491142.1|3921937_3922837_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_001298299.1|3923327_3924023_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599806.1|3924448_3926107_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001355621.1|3926103_3927060_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000746460.1|3927210_3928326_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_072777989.1|3928322_3930269_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_001351689.1|3930341_3930566_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|3930888_3931209_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934034.1|3931239_3933516_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.1e-166
WP_001040187.1|3934535_3934754_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241677.1|3935038_3935743_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202201.1|3935784_3937506_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	1.4e-15
WP_001043621.1|3937506_3939273_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_000537418.1|3939395_3940361_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_000228473.1|3940905_3941400_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077052.1|3941534_3945563_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|3945717_3946329_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067755.1|3946339_3947683_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
3955940:3955955	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 307
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3951610	3952228	4544936		Escherichia_phage(100.0%)	1	NA	NA
WP_000213098.1|3951610_3952228_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 308
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3958536	3961751	4544936		Tetraselmis_virus(100.0%)	2	NA	NA
WP_000111043.1|3958536_3959277_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|3959468_3961751_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
>prophage 309
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3965817	3966906	4544936		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057138.1|3965817_3966906_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 310
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3971992	3976534	4544936		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|3971992_3972277_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_072778082.1|3972484_3974749_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|3974785_3976534_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
>prophage 311
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	3991238	4002207	4544936	tRNA	Rhodobacter_phage(20.0%)	8	NA	NA
WP_001295932.1|3991238_3991787_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109486.1|3991813_3992461_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462687.1|3992682_3993873_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_157716970.1|3994057_3995146_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000117881.1|3995747_3997148_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001307697.1|3997316_3998519_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193841.1|3998784_4001397_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_001090506.1|4001439_4002207_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
>prophage 312
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4018117	4020025	4544936		Tupanvirus(100.0%)	1	NA	NA
WP_000053099.1|4018117_4020025_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.9e-54
>prophage 313
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4032624	4034679	4544936		Bacillus_phage(100.0%)	1	NA	NA
WP_001295354.1|4032624_4034679_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
>prophage 314
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4038912	4039572	4544936	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|4038912_4039572_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 315
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4059621	4071936	4544936		Morganella_phage(20.0%)	13	NA	NA
WP_000066490.1|4059621_4059834_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|4059844_4060033_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001309400.1|4060007_4060238_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|4060227_4060401_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_072778961.1|4060449_4061523_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_072778962.1|4061594_4064339_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.2	2.7e-37
WP_001264933.1|4064421_4065450_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120125.1|4065422_4066115_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230242.1|4066244_4067417_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001062092.1|4067416_4069963_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.3	2.0e-71
WP_000209894.1|4069959_4070559_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024560.1|4070710_4071016_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420646.1|4071015_4071936_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	5.5e-11
>prophage 316
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4077097	4079371	4544936		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001273658.1|4077097_4077271_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_072778902.1|4077527_4078856_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.9	1.8e-233
WP_001028083.1|4078876_4079371_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
>prophage 317
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4094004	4095069	4544936		Cronobacter_phage(100.0%)	1	NA	NA
WP_000258765.1|4094004_4095069_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	1.1e-90
>prophage 318
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4100191	4101025	4544936		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|4100191_4101025_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 319
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4105149	4105683	4544936		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|4105149_4105683_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 320
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4114991	4115912	4544936		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|4114991_4115912_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 321
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4120568	4120814	4544936		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|4120568_4120814_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 322
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4136697	4137639	4544936		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001295441.1|4136697_4137639_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 323
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4149996	4151178	4544936		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|4149996_4150731_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|4150941_4151178_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 324
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4154450	4156093	4544936		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257000.1|4154450_4155092_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_001267956.1|4155088_4156093_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	31.8	6.4e-05
>prophage 325
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4168361	4168619	4544936		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|4168361_4168619_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 326
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4175907	4179648	4544936		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033694.1|4175907_4176609_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-35
WP_001251348.1|4176608_4177853_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291270.1|4177881_4178793_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952737.1|4178808_4179648_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.7e-23
>prophage 327
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4182905	4184883	4544936		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000799401.1|4182905_4183763_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|4183746_4184883_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
>prophage 328
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4189895	4191266	4544936		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_157716975.1|4189895_4191266_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	9.4e-108
>prophage 329
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4194402	4198114	4544936		Phage_21(50.0%)	3	NA	NA
WP_000444488.1|4194402_4195653_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	3.2e-22
WP_000373101.1|4196757_4197162_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_072778167.1|4197382_4198114_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
>prophage 330
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4214797	4216485	4544936		Morganella_phage(50.0%)	2	NA	NA
WP_000897378.1|4214797_4215217_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000457616.1|4215216_4216485_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
>prophage 331
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4243930	4246682	4544936		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033352.1|4243930_4245610_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_001298109.1|4245734_4246682_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 332
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4249818	4256620	4544936		Pseudomonas_phage(33.33%)	9	NA	NA
WP_000804726.1|4249818_4250901_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456454.1|4250900_4251734_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200373.1|4251730_4252123_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257044.1|4252126_4252936_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|4252971_4253826_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_000170951.1|4253972_4254080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000170963.1|4254507_4254615_-	small toxic polypeptide LdrB	NA	NA	NA	NA	NA
WP_001295620.1|4255019_4256120_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_001146444.1|4256389_4256620_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
>prophage 333
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4268652	4279367	4544936		Escherichia_phage(25.0%)	10	NA	NA
WP_000702660.1|4268652_4270191_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000571699.1|4270187_4270898_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|4270897_4271575_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555849.1|4273005_4273848_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001362540.1|4273897_4274356_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001295622.1|4274468_4275374_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193447.1|4275465_4276479_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|4276680_4277589_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|4277732_4278146_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068089.1|4278749_4279367_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.7e-53
>prophage 334
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4287557	4289572	4544936		Planktothrix_phage(50.0%)	2	NA	NA
WP_000110945.1|4287557_4288571_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|4288567_4289572_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 335
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4301232	4304190	4544936		Acinetobacter_phage(100.0%)	2	NA	NA
WP_104774074.1|4301232_4302591_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000763511.1|4302594_4304190_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
>prophage 336
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4311159	4316451	4544936	protease	Chrysochromulina_ericina_virus(33.33%)	4	NA	NA
WP_000559286.1|4311159_4311918_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	4.4e-06
WP_000422045.1|4312137_4313187_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|4313222_4313474_-	YciN family protein	NA	NA	NA	NA	NA
WP_001297122.1|4313853_4316451_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
>prophage 337
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4321375	4321966	4544936		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|4321375_4321966_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 338
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4329783	4335440	4544936		Lactococcus_phage(50.0%)	5	NA	NA
WP_000484984.1|4329783_4331718_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
WP_072778368.1|4331785_4332913_-	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|4333056_4333845_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000565727.1|4334212_4334566_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000573407.1|4334633_4335440_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 339
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4348355	4349621	4544936		Klosneuvirus(100.0%)	1	NA	NA
WP_072778370.1|4348355_4349621_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	5.9e-24
>prophage 340
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4370292	4370808	4544936		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945011.1|4370292_4370808_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
>prophage 341
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4377134	4395436	4544936	integrase,tRNA	Escherichia_phage(55.56%)	22	4379699:4379712	4394087:4394100
WP_000628058.1|4377134_4378367_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|4378621_4379605_+	zinc transporter ZntB	NA	NA	NA	NA	NA
4379699:4379712	attL	TTGCAGGTGAATGC	NA	NA	NA	NA
WP_000123779.1|4380082_4381456_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	8.6e-53
WP_001157406.1|4381584_4382520_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|4382571_4383807_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|4383808_4384024_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|4384102_4384312_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|4384304_4384499_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_157716978.1|4384555_4385365_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	70.7	1.7e-104
WP_024232464.1|4385357_4387958_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	3.9e-248
WP_000632297.1|4388059_4388335_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|4388409_4388580_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|4388579_4388801_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_072778877.1|4389242_4389731_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|4389727_4389883_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000233809.1|4389893_4390028_-	phage protein	NA	NA	NA	NA	NA
WP_000362155.1|4390282_4390702_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391949.1|4390802_4391084_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000693836.1|4391067_4391493_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262352.1|4391564_4392635_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	64.6	4.7e-62
WP_001151151.1|4392675_4393098_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_001676522.1|4393438_4395436_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.2	3.3e-21
4394087:4394100	attR	TTGCAGGTGAATGC	NA	NA	NA	NA
>prophage 342
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4402644	4410612	4544936	tail,lysis	Enterobacteria_phage(75.0%)	10	NA	NA
WP_000839565.1|4402644_4402860_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001135310.1|4402859_4403357_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
WP_001228688.1|4403573_4403759_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
WP_000259492.1|4404034_4405411_+	potassium transporter TrkG	NA	NA	NA	NA	NA
WP_157716979.1|4405548_4406151_+	chromosome partitioning protein ParB	NA	A0A2I7RQE2	Vibrio_phage	54.6	3.9e-34
WP_001351719.1|4406150_4406726_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.2	1.2e-101
WP_000078178.1|4406823_4407414_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_001157925.1|4408464_4408638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300461.1|4408903_4409338_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|4409478_4410612_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 343
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4415573	4416563	4544936		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762236.1|4415573_4416563_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
>prophage 344
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4453605	4457508	4544936		Klosneuvirus(100.0%)	1	NA	NA
WP_000139565.1|4453605_4457508_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 345
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4461445	4462394	4544936		Escherichia_phage(50.0%)	2	NA	NA
WP_000428998.1|4461445_4461976_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731833.1|4462220_4462394_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
>prophage 346
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4474118	4484292	4544936	transposase	Escherichia_phage(20.0%)	10	NA	NA
WP_001468680.1|4474118_4475327_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	4.6e-207
WP_071597387.1|4475366_4476581_-	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000429133.1|4476633_4477170_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001301045.1|4477242_4479204_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.3	2.7e-23
WP_000494244.1|4479295_4479526_-	YncJ family protein	NA	NA	NA	NA	NA
WP_000813794.1|4479747_4479924_+	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_001270286.1|4479969_4480386_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000760585.1|4480464_4481871_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_072778914.1|4482115_4483261_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000220399.1|4483278_4484292_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	55.4	1.1e-25
>prophage 347
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4491423	4493526	4544936		Salmonella_phage(100.0%)	1	NA	NA
WP_157716982.1|4491423_4493526_-	TonB-dependent siderophore receptor	NA	A0A1B0VCF0	Salmonella_phage	65.3	5.3e-134
>prophage 348
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4504456	4506001	4544936		Escherichia_phage(100.0%)	1	NA	NA
WP_000702535.1|4504456_4506001_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 349
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4519398	4520839	4544936		Escherichia_phage(50.0%)	2	NA	NA
WP_000781370.1|4519398_4519683_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000642433.1|4519828_4520839_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
>prophage 350
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4524112	4526018	4544936		Planktothrix_phage(100.0%)	2	NA	NA
WP_072778754.1|4524112_4525039_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.2	3.5e-13
WP_000193547.1|4525031_4526018_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	1.4e-17
>prophage 351
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4530334	4532734	4544936		Klosneuvirus(100.0%)	1	NA	NA
WP_001360132.1|4530334_4532734_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
>prophage 352
NZ_CP044293	Escherichia coli strain P276M chromosome, complete genome	4544936	4539144	4541940	4544936		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_014639909.1|4539144_4541940_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	23.8	4.4e-19
>prophage 1
NZ_CP044294	Escherichia coli strain P276M plasmid p276M-CTX-M-55, complete sequence	97529	2874	16505	97529		Escherichia_phage(61.54%)	13	NA	NA
WP_072672438.1|2874_3606_+	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	95.5	2.6e-104
WP_072842208.1|3645_4068_+	ppfA	NA	Q71TL5	Escherichia_phage	96.4	3.0e-57
WP_072842210.1|4243_4636_+	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	96.9	1.4e-69
WP_001113742.1|4971_5856_+	RepB family plasmid replication initiator protein	NA	A0A077SLP3	Escherichia_phage	100.0	2.1e-161
WP_032247076.1|6148_6958_+	GIY-YIG nuclease family protein	NA	A0A077SK46	Escherichia_phage	98.1	3.2e-156
WP_001285362.1|7126_8323_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
WP_000038866.1|8339_9341_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
WP_032203566.1|11331_12921_+	hypothetical protein	NA	A0A1B0V7E4	Salmonella_phage	98.1	1.9e-301
WP_001514461.1|12930_13746_+	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	98.9	2.4e-111
WP_157717007.1|13781_14363_+	hypothetical protein	NA	Q71TM4	Escherichia_phage	96.4	6.8e-100
WP_157717008.1|14374_14521_+	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	100.0	1.5e-19
WP_001339188.1|14629_14884_+	hypothetical protein	NA	Q71TM5	Escherichia_phage	98.8	5.9e-40
WP_001352007.1|16349_16505_-	type I toxin-antitoxin system toxin HokD	NA	A0A1I9LJU7	Stx_converting_phage	90.2	4.0e-15
>prophage 2
NZ_CP044294	Escherichia coli strain P276M plasmid p276M-CTX-M-55, complete sequence	97529	33900	66405	97529	integrase,transposase	Escherichia_phage(63.16%)	32	30389:30403	73948:73962
30389:30403	attL	TCCTGTCGATTAAAA	NA	NA	NA	NA
WP_023352064.1|33900_34341_+	hypothetical protein	NA	Q71TR9	Escherichia_phage	99.3	3.8e-79
WP_000747846.1|34337_34586_+	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_069067573.1|36317_36770_-	hypothetical protein	NA	A0A1B0VAG4	Salmonella_phage	55.7	3.6e-48
WP_157717009.1|36958_37297_-	recombination enhancement function domain protein	NA	Q71TG3	Escherichia_phage	96.4	1.8e-60
WP_001067855.1|38977_39682_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001011939.1|39825_40467_-	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
WP_001067858.1|40562_41267_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_015387340.1|41455_42331_+	class A extended-spectrum beta-lactamase CTX-M-55	NA	A0A1B0VBP7	Salmonella_phage	82.1	2.4e-125
WP_001393253.1|42377_42710_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_064186845.1|46971_47628_+	quinolone resistance pentapeptide repeat protein QnrS13	NA	NA	NA	NA	NA
WP_001493761.1|47725_49117_-|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
WP_001493762.1|49153_49726_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_012477564.1|49862_50453_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_000844627.1|50570_50813_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_021536379.1|50844_51522_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804063.1|51600_52800_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_001255015.1|53066_53372_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214121.1|53399_54614_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.3	8.0e-18
WP_001447541.1|54830_55715_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001120888.1|55745_57239_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000743213.1|57449_57674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001446887.1|57670_58408_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001044210.1|58893_59034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|59039_59744_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_077625588.1|59714_60059_+	hypothetical protein	NA	A0A1B0VAH3	Salmonella_phage	100.0	2.4e-36
WP_038989442.1|60658_60970_-	hypothetical protein	NA	Q5XLQ4	Enterobacteria_phage	93.2	2.8e-44
WP_029393497.1|61020_62052_-|integrase	tyrosine-type recombinase/integrase	integrase	Q71TG5	Escherichia_phage	99.4	8.4e-194
WP_042630942.1|62059_62281_-	hypothetical protein	NA	Q5QBN7	Enterobacteria_phage	98.6	5.8e-36
WP_000019448.1|62917_63898_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
WP_097475741.1|64085_64295_+	c1 repressor inactivator	NA	A0A077SK26	Escherichia_phage	98.6	5.3e-31
WP_000611664.1|64405_65257_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	100.0	1.2e-158
WP_097475740.1|65289_66405_-	phage antirepressor Ant	NA	A0A077SLR9	Escherichia_phage	92.5	1.4e-189
73948:73962	attR	TCCTGTCGATTAAAA	NA	NA	NA	NA
>prophage 3
NZ_CP044294	Escherichia coli strain P276M plasmid p276M-CTX-M-55, complete sequence	97529	75517	86147	97529		Escherichia_phage(66.67%)	9	NA	NA
WP_097475762.1|75517_76024_-	3'-phosphatase	NA	A0A1B0VAK0	Salmonella_phage	98.8	1.2e-92
WP_032259544.1|76096_76456_-	hypothetical protein	NA	Q1MVG4	Enterobacteria_phage	100.0	6.3e-64
WP_157717010.1|76478_77339_-	hypothetical protein	NA	A0A077SL55	Escherichia_phage	99.3	2.5e-151
WP_001354545.1|78338_79016_-	calcineurin phosphoesterase	NA	A0A077SLQ6	Escherichia_phage	100.0	7.6e-135
WP_032306837.1|79638_80265_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.5	1.1e-79
WP_033550846.1|80267_81095_+	hypothetical protein	NA	A0A077SK59	Escherichia_phage	37.9	2.7e-17
WP_042004625.1|81133_83557_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	45.5	1.2e-198
WP_042004624.1|83639_84287_+	hypothetical protein	NA	A0A077SLS7	Escherichia_phage	34.6	3.1e-13
WP_032306836.1|84479_86147_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.0	6.0e-40
