The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044291	Escherichia coli strain P43A chromosome, complete genome	4740492	201906	288915	4740492	protease,terminase,integrase,tail,capsid,portal,head,tRNA,lysis,plate	Salmonella_phage(56.14%)	85	194870:194885	291486:291501
194870:194885	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
WP_000886683.1|201906_203199_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|203289_204633_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|204643_205255_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077038.1|205409_209399_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|209533_210028_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_157700549.1|210572_211538_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043577.1|211660_213427_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_004015322.1|213427_215149_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	1.8e-15
WP_001241678.1|215190_215895_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|216179_216398_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|217082_219359_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|219389_219710_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|220032_220257_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_032292156.1|220329_222276_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000746460.1|222272_223388_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001380339.1|223538_224495_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599802.1|224491_226150_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001298299.1|226574_227270_+	aquaporin Z	NA	NA	NA	NA	NA
WP_001338421.1|227764_228664_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_157700550.1|228807_230460_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178661.1|230471_231440_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815337.1|231572_233291_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	2.3e-31
WP_000566372.1|233327_234329_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_157700551.1|234339_235770_+	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_001338420.1|235868_236882_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001252135.1|236878_237709_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|237705_238029_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270734.1|238154_238670_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|238887_239616_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756569.1|239633_240365_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|240371_241088_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|241087_241756_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_157700552.1|242046_242778_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149740.1|242976_244104_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	6.0e-28
WP_000389260.1|244144_244633_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061665.1|244692_245538_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_001093854.1|245534_246488_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_157700553.1|246497_247631_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_157700554.1|249017_249485_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|249572_250475_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_001201560.1|251241_251529_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|251688_251946_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_000681108.1|251975_252353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024876.1|252622_254308_+	transporter	NA	NA	NA	NA	NA
WP_000972391.1|254543_254762_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001011780.1|254852_255953_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	85.5	3.4e-177
WP_000980384.1|255949_256435_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	1.8e-66
WP_000763311.1|259499_259619_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281016.1|259633_259936_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	90.0	8.2e-41
WP_038988793.1|259990_260506_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	1.6e-89
WP_097504869.1|260515_261688_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	6.0e-204
WP_000905032.1|261830_262397_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
WP_001145314.1|262427_262838_+	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	97.6	1.3e-65
WP_047083489.1|262858_263302_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	98.0	7.0e-81
WP_001030535.1|263273_263876_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.0	1.5e-97
WP_000104791.1|263875_265360_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	73.4	4.3e-199
WP_001086824.1|265356_265962_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	93.0	1.8e-111
WP_000268280.1|265954_266863_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	7.8e-143
WP_000177590.1|266849_267209_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_000993774.1|267205_267784_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	1.6e-93
WP_000829142.1|267852_268299_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	4.3e-62
WP_001039935.1|268291_268723_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	6.4e-71
WP_001080934.1|268818_269247_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.9	4.9e-47
WP_000727861.1|269243_269621_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.8	2.3e-16
WP_001442491.1|269622_270096_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
WP_000171568.1|270115_270331_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|270334_270538_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673524.1|270537_271002_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.4e-76
WP_021563628.1|271097_271748_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	1.5e-111
WP_000742510.1|271751_272810_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.8e-181
WP_000216250.1|272826_273660_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.7	1.5e-121
WP_001098431.1|273802_275569_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_000520366.1|275568_276612_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.0	5.9e-171
WP_000020981.1|279279_279750_-	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.2	8.4e-24
WP_001217575.1|280146_280380_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|280390_280579_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_053286744.1|280732_283147_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.6	0.0e+00
WP_023150402.1|283143_284001_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.8	1.7e-160
WP_000752613.1|283997_284225_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244165.1|284224_284458_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
WP_000963472.1|284525_284867_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.3e-55
WP_023150404.1|284830_285031_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	3.5e-32
WP_032236495.1|285038_285548_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	7.5e-87
WP_000188448.1|285580_285802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001372563.1|287862_288915_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.4e-106
291486:291501	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 2
NZ_CP044291	Escherichia coli strain P43A chromosome, complete genome	4740492	1969400	1976215	4740492		Enterobacteria_phage(100.0%)	9	NA	NA
WP_031614182.1|1969400_1971734_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
WP_000856729.1|1971748_1972069_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_031614183.1|1972204_1972660_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	100.0	7.2e-65
WP_157700658.1|1972652_1972940_-	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	97.9	2.5e-47
WP_031614184.1|1972932_1973523_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	99.3	1.3e-69
WP_001149160.1|1973519_1973786_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283042.1|1974337_1975072_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	5.2e-129
WP_000638636.1|1975068_1975569_+	transactivation protein	NA	NA	NA	NA	NA
WP_000446146.1|1975642_1976215_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	5.0e-95
>prophage 3
NZ_CP044291	Escherichia coli strain P43A chromosome, complete genome	4740492	2977282	2990464	4740492		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|2977282_2978044_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|2978037_2978664_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272590.1|2978803_2979943_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|2980005_2980998_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104459.1|2981090_2982455_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136925.1|2982543_2983320_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|2983324_2983963_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|2983959_2985222_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847971.1|2985218_2986127_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	5.1e-118
WP_001295181.1|2986322_2987090_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_121835604.1|2987140_2987797_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	5.6e-50
WP_001272907.1|2987902_2990464_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	2.3e-30
>prophage 4
NZ_CP044291	Escherichia coli strain P43A chromosome, complete genome	4740492	3071086	3080559	4740492	integrase	Enterobacteria_phage(85.71%)	9	3073884:3073898	3090123:3090137
WP_137444060.1|3071086_3073420_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.4	0.0e+00
WP_021563885.1|3073434_3073755_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002444348.1|3073751_3073979_-	hypothetical protein	NA	NA	NA	NA	NA
3073884:3073898	attL	GTCCTGCACCTGCAT	NA	NA	NA	NA
WP_034920516.1|3073975_3074527_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	71.3	7.2e-35
WP_000556587.1|3074523_3074790_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_002444335.1|3075330_3076068_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	64.9	1.5e-80
WP_000984205.1|3076064_3076310_+	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	77.8	1.6e-31
WP_021536578.1|3076326_3076893_+	hypothetical protein	NA	Q7M2A1	Enterobacteria_phage	62.2	2.2e-55
WP_085437551.1|3079368_3080559_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.9	3.7e-108
3090123:3090137	attR	ATGCAGGTGCAGGAC	NA	NA	NA	NA
>prophage 5
NZ_CP044291	Escherichia coli strain P43A chromosome, complete genome	4740492	3598412	3607849	4740492		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569357.1|3598412_3599339_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	5.7e-08
WP_000783120.1|3599343_3600075_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|3600055_3600163_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|3600222_3600954_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|3601175_3602861_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|3602857_3603577_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_157700728.1|3603623_3604091_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	98.7	1.8e-79
WP_001373589.1|3604129_3604591_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
WP_001423058.1|3604715_3606716_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_157700729.1|3606712_3607849_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	5.5e-162
>prophage 6
NZ_CP044291	Escherichia coli strain P43A chromosome, complete genome	4740492	3852844	3917865	4740492	transposase,tRNA,integrase	Escherichia_phage(19.05%)	54	3880809:3880839	3922120:3922150
WP_001025322.1|3852844_3854578_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
WP_001295504.1|3854793_3855360_+	VOC family protein	NA	NA	NA	NA	NA
WP_157700742.1|3855373_3856120_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214290.1|3856505_3857606_+	cytochrome c	NA	NA	NA	NA	NA
WP_000176782.1|3857630_3860060_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	NA	NA	NA	NA
WP_000564725.1|3860224_3861196_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019590.1|3861192_3861936_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	3.5e-24
WP_000252980.1|3861976_3862372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000639274.1|3862424_3863243_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000891621.1|3863239_3863806_-	hydrolase	NA	NA	NA	NA	NA
WP_001258678.1|3864115_3865888_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001300367.1|3866005_3866458_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907248.1|3866486_3867227_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001295503.1|3867261_3867783_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024932.1|3867784_3868387_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_157700743.1|3868453_3868690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|3868658_3869270_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|3869278_3870289_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571479.1|3870435_3871221_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|3871217_3871973_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001342995.1|3872051_3872984_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_157700744.1|3872999_3874322_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_000448381.1|3874441_3875413_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_157700745.1|3876995_3878504_-	hypothetical protein	NA	NA	NA	NA	NA
3880809:3880839	attL	CCGCAGAATTCGGAAAAAATCGTACGCTAAG	NA	NA	NA	NA
WP_124053510.1|3881432_3882290_-	TEM family class A beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	1.5e-159
WP_157700818.1|3882472_3883018_-	helix-turn-helix domain-containing protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.8e-90
WP_074150773.1|3883800_3884145_+	resolvase	NA	A0A219YB42	Aeromonas_phage	44.6	9.8e-14
WP_001516695.1|3884463_3885120_-	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_001617865.1|3890892_3891768_+	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
WP_012579081.1|3891847_3892771_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
WP_001067858.1|3894633_3895338_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000557454.1|3896048_3896909_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_000587837.1|3896921_3897464_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|3897945_3898137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001330846.1|3898142_3898388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|3899601_3900306_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001277456.1|3901484_3901847_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|3901843_3902080_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000204520.1|3902076_3902784_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000935452.1|3902822_3904127_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_157700746.1|3904204_3904435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018329.1|3904956_3905772_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|3905922_3906627_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_094310984.1|3907142_3908372_+	macrolide efflux MFS transporter Mef(B)	NA	A0A1B0RXG2	Streptococcus_phage	38.8	6.1e-74
WP_054377175.1|3908517_3909381_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001354008.1|3909418_3909664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|3910132_3910924_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	NA	NA	NA	NA
WP_000800531.1|3912103_3912436_-	quaternary ammonium compound efflux SMR transporter QacL	NA	E5E3Y9	Acinetobacter_phage	35.3	2.0e-08
WP_001206316.1|3912605_3913397_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000095725.1|3913489_3914749_-	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001206356.1|3915010_3915802_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|3915807_3916098_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|3916209_3916707_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845039.1|3916851_3917865_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
3922120:3922150	attR	CTTAGCGTACGATTTTTTCCGAATTCTGCGG	NA	NA	NA	NA
>prophage 7
NZ_CP044291	Escherichia coli strain P43A chromosome, complete genome	4740492	4220524	4253308	4740492	tail,transposase,lysis	Enterobacteria_phage(32.14%)	45	NA	NA
WP_000598292.1|4220524_4220851_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|4221056_4222271_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836067.1|4222282_4223302_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001360138.1|4223359_4223470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157700767.1|4223497_4224769_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.2	1.0e-153
WP_001296941.1|4224803_4225040_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048342.1|4225127_4227599_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083297.1|4227691_4227883_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854559.1|4227879_4228068_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001329848.1|4228467_4228632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157700768.1|4228615_4228855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|4229014_4229170_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000448564.1|4229336_4229744_-	helix-turn-helix domain-containing protein	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000920568.1|4229827_4230058_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000705358.1|4230041_4230563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157700769.1|4230543_4231509_+	hypothetical protein	NA	U5P0A0	Shigella_phage	59.6	2.5e-54
WP_097463003.1|4231549_4231972_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.3	9.7e-64
WP_157700770.1|4231968_4232268_+	class I SAM-dependent methyltransferase	NA	I6S1S6	Salmonella_phage	76.7	3.3e-34
WP_000955178.1|4233631_4233814_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
WP_000589005.1|4233991_4235305_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001301033.1|4235741_4236074_-	protein FlxA	NA	NA	NA	NA	NA
WP_001326990.1|4236276_4236582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|4236606_4236846_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|4236845_4237133_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|4237204_4237360_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|4237576_4237828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|4237894_4238173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265198.1|4238174_4239224_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_001047135.1|4239237_4239990_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|4240267_4240357_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|4240411_4240624_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|4240924_4241140_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|4241889_4242105_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189916.1|4242109_4242421_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_096177086.1|4242946_4243444_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	30.1	9.8e-07
WP_000066495.1|4243801_4244014_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|4244024_4244213_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|4244215_4244281_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|4244360_4244516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001368374.1|4245485_4245719_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_072172656.1|4246107_4246242_+	hypothetical protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.5e-18
WP_001233090.1|4247982_4248582_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_157700771.1|4248646_4252045_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_000885614.1|4252044_4252620_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	5.5e-102
WP_000086522.1|4252717_4253308_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
