The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046669	Lactobacillus plantarum strain 83-18 chromosome, complete genome	3081029	512517	567552	3081029	protease,terminase,capsid,integrase,tRNA,holin,tail,portal	Lactobacillus_phage(41.38%)	67	527116:527132	550831:550847
WP_157262252.1|512517_513210_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003643927.1|513398_514730_-	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	33.3	5.4e-68
WP_003640926.1|514805_515489_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_003640927.1|515497_515794_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011101073.1|515932_516469_+	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	46.4	1.1e-35
WP_003643928.1|517516_518896_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_046038334.1|518911_520075_+	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_003640932.1|520398_521889_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003644975.1|522166_523579_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.0	3.1e-45
WP_003640934.1|523580_523991_+	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_003643931.1|523980_524748_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_054396912.1|524749_525298_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_046038339.1|525804_526407_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003637768.1|526468_526618_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003640939.1|526629_526815_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_003643932.1|526919_527468_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
527116:527132	attL	CTGGTTACGTTTTGGTT	NA	NA	NA	NA
WP_046038342.1|527495_528383_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003640942.1|528484_528910_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_003640943.1|529010_529700_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_003643933.1|529898_530402_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_003637775.1|530463_530832_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_157262254.1|530983_532186_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A126GGK4	Streptococcus_phage	29.2	1.3e-36
WP_157262256.1|532407_533154_-	hypothetical protein	NA	A0A0R6PER3	Moraxella_phage	26.9	7.6e-11
WP_157262258.1|533158_534187_-	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	37.0	4.1e-55
WP_157262260.1|534186_535230_-	DNA (cytosine-5-)-methyltransferase	NA	A0A0R6PG08	Moraxella_phage	48.8	1.1e-84
WP_157262262.1|535392_536319_-	DUF5067 domain-containing protein	NA	NA	NA	NA	NA
WP_069302404.1|536370_536802_-	hypothetical protein	NA	O03904	Lactobacillus_phage	93.0	1.6e-74
WP_046039922.1|536810_537209_-	helix-turn-helix domain-containing protein	NA	O03970	Lactobacillus_phage	62.9	1.1e-40
WP_060417487.1|537630_537879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157262264.1|537908_538112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060417488.1|538189_538372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157262266.1|538432_538987_+	hypothetical protein	NA	O03909	Lactobacillus_phage	97.8	1.9e-96
WP_063488542.1|538992_539280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157262268.1|539348_539519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157262270.1|539659_539773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157262272.1|539793_540324_+	hypothetical protein	NA	E9LUU0	Lactobacillus_phage	59.1	2.0e-53
WP_157262274.1|540335_541301_+	hypothetical protein	NA	A6M982	Geobacillus_virus	54.5	2.0e-64
WP_157262276.1|541315_542260_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_063851487.1|542582_543464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063488409.1|543531_543765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157262278.1|543785_543947_+	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	79.6	4.1e-15
WP_016527195.1|543915_544188_+	hypothetical protein	NA	A0A2D2W301	Escherichia_phage	50.6	1.8e-18
WP_157262280.1|544411_544732_+	hypothetical protein	NA	A0A1J1J9Q7	Escherichia_phage	45.6	2.3e-17
WP_063486483.1|544789_545299_+	helix-turn-helix domain-containing protein	NA	A0A2H4IYT3	uncultured_Caudovirales_phage	36.8	4.5e-07
WP_157262282.1|545279_546605_+|terminase	PBSX family phage terminase large subunit	terminase	A0A1S5SA45	Streptococcus_phage	55.7	1.3e-138
WP_157262284.1|546607_548203_+|portal	phage portal protein	portal	B5LPR1	Bacillus_virus	37.8	1.7e-84
WP_157262286.1|548195_549281_+	hypothetical protein	NA	Q9T1B9	Listeria_phage	31.2	1.8e-37
WP_157262288.1|549344_549956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103851846.1|549969_550917_+|capsid	N4-gp56 family major capsid protein	capsid	A8ASJ6	Listeria_phage	59.5	3.9e-89
550831:550847	attR	AACCAAAACGTAACCAG	NA	NA	NA	NA
WP_126321051.1|551276_551681_+	hypothetical protein	NA	A5GYM1	Lactococcus_phage	27.5	2.0e-05
WP_050339426.1|551681_552071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046947889.1|552067_552469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157262290.1|552468_552894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064972010.1|552911_553520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126321052.1|553638_554157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157262292.1|554153_554795_+	hypothetical protein	NA	U3PFU8	Lactobacillus_phage	30.6	4.4e-07
WP_157262294.1|554810_560441_+|tail	phage tail tape measure protein	tail	A0A1S5SFC1	Streptococcus_phage	25.5	1.6e-23
WP_157262296.1|560441_561260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157262298.1|561271_562399_+	hypothetical protein	NA	O03938	Lactobacillus_phage	41.2	4.9e-70
WP_157262300.1|562391_562640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157262302.1|562614_562905_+	hypothetical protein	NA	O03939	Lactobacillus_phage	32.7	4.4e-07
WP_157262304.1|562904_565238_+	DUF2479 domain-containing protein	NA	O03968	Lactobacillus_phage	59.1	3.0e-66
WP_157262306.1|565253_565535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157262308.1|565527_565695_+	XkdX family protein	NA	NA	NA	NA	NA
WP_157262823.1|565763_566891_+	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	70.7	2.2e-46
WP_016511481.1|566891_567188_+	hypothetical protein	NA	A0A2K9VCD4	Lactobacillus_phage	75.5	7.6e-39
WP_157262310.1|567174_567552_+|holin	holin	holin	A0A2P0ZLG6	Lactobacillus_phage	81.2	3.7e-14
>prophage 2
NZ_CP046669	Lactobacillus plantarum strain 83-18 chromosome, complete genome	3081029	583601	592225	3081029		Streptococcus_phage(66.67%)	11	NA	NA
WP_003644909.1|583601_585299_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.0	3.9e-55
WP_003640956.1|585320_585629_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003637790.1|585644_586244_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_003640957.1|586258_586510_+	YaaL family protein	NA	NA	NA	NA	NA
WP_016510978.1|586907_587573_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.7	1.4e-53
WP_003640965.1|587569_587899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003640966.1|587915_588935_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.5	2.1e-32
WP_003640967.1|588959_589307_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	33.3	2.4e-12
WP_016510979.1|589405_590302_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.7	1.3e-81
WP_003640969.1|590305_591091_+	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_016510980.1|591229_592225_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	37.9	1.0e-50
>prophage 3
NZ_CP046669	Lactobacillus plantarum strain 83-18 chromosome, complete genome	3081029	1189231	1199533	3081029		Lactobacillus_phage(100.0%)	8	NA	NA
WP_070085445.1|1189231_1190470_+	hypothetical protein	NA	A0A2P0ZL72	Lactobacillus_phage	99.0	1.4e-219
WP_046038954.1|1190560_1191532_-	peptidase S41	NA	A0A2P0ZL68	Lactobacillus_phage	97.8	1.1e-179
WP_046038955.1|1191717_1192665_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	99.7	1.0e-177
WP_046038956.1|1193008_1193623_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	99.5	1.4e-111
WP_046038957.1|1193625_1196064_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.5	0.0e+00
WP_021356349.1|1196151_1196712_+	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	99.5	1.0e-100
WP_021356350.1|1196782_1197223_-	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	95.9	4.4e-75
WP_157262434.1|1197613_1199533_+	hypothetical protein	NA	A0A2P0ZL91	Lactobacillus_phage	72.2	1.7e-54
>prophage 4
NZ_CP046669	Lactobacillus plantarum strain 83-18 chromosome, complete genome	3081029	2047738	2126651	3081029	terminase,capsid,integrase,transposase,holin,tail,portal,head	Lactobacillus_phage(51.02%)	97	2112141:2112154	2126711:2126724
WP_060677159.1|2047738_2049469_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.4	7.6e-46
WP_015825756.1|2049691_2050084_-	YxeA family protein	NA	NA	NA	NA	NA
WP_070085270.1|2050306_2051158_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_157262582.1|2051680_2052835_-	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	38.6	4.4e-42
WP_157262584.1|2052818_2052962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157262586.1|2053905_2054367_-	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	56.3	4.1e-39
WP_157262588.1|2054745_2055165_-	DUF1642 domain-containing protein	NA	A0A1S5RCV9	Lactobacillus_phage	44.1	3.0e-25
WP_157262590.1|2055157_2055496_-	hypothetical protein	NA	A0A2H4PBD2	Lactobacillus_phage	79.2	1.1e-28
WP_157262592.1|2055621_2056587_-	hypothetical protein	NA	A6M982	Geobacillus_virus	54.5	1.2e-64
WP_024002536.1|2056598_2057129_-	phage protein	NA	E9LUU0	Lactobacillus_phage	59.2	6.1e-55
WP_046811047.1|2057146_2057260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072557401.1|2057392_2057563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157262594.1|2057630_2058143_-	transcriptional regulator	NA	D6PST4	Lactobacillus_phage	44.7	1.6e-28
WP_157262596.1|2058209_2058515_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_033608054.1|2058693_2058948_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JFN1	uncultured_Caudovirales_phage	41.3	1.5e-06
WP_053267722.1|2060137_2060656_+	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	34.8	9.3e-16
WP_053267721.1|2060670_2061093_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_053267720.1|2061193_2061652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053267719.1|2061737_2062799_+	endonuclease	NA	A0A1S5SAB0	Streptococcus_phage	45.1	4.6e-86
WP_157262598.1|2062972_2063242_+	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_157262600.1|2063245_2064021_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	52.3	7.8e-27
WP_157262602.1|2064025_2064205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099739055.1|2064231_2064591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022638129.1|2064621_2064903_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_157262604.1|2065286_2066789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157262606.1|2066887_2068009_+|integrase	tyrosine-type recombinase/integrase	integrase	D6PSS4	Lactobacillus_phage	32.4	7.6e-47
WP_003642774.1|2068360_2068567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643340.1|2069285_2069486_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.4	1.4e-20
WP_157262608.1|2069608_2069986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157262610.1|2070159_2070429_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_157262612.1|2070521_2072063_-|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	25.5	6.3e-44
WP_157262614.1|2072059_2073160_-|portal	phage portal protein	portal	A0A2H4J9Q5	uncultured_Caudovirales_phage	34.9	1.0e-48
WP_079111826.1|2073160_2073361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157262616.1|2073314_2075018_-|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	40.5	1.2e-120
WP_157262618.1|2075014_2075488_-|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_157262620.1|2076102_2076492_-	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	45.6	1.5e-18
WP_157262622.1|2076484_2076823_-|head,tail	head-tail adaptor protein	head,tail	A0A2P0ZLF0	Lactobacillus_phage	34.7	3.9e-07
WP_157262624.1|2076809_2077001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157262626.1|2077000_2077357_-	pathogenicity island protein	NA	NA	NA	NA	NA
WP_157262628.1|2077618_2079193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157262630.1|2079192_2079996_-	DNA replication protein	NA	NA	NA	NA	NA
WP_157262632.1|2080009_2080240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021336917.1|2080359_2080467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016527234.1|2080509_2080689_-	helix-turn-helix domain-containing protein	NA	E9LUT5	Lactobacillus_phage	89.7	3.0e-22
WP_104795871.1|2080845_2081466_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_063493492.1|2081523_2082681_+|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	34.8	3.9e-54
WP_003642773.1|2083169_2083403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642772.1|2083427_2083700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642762.1|2085258_2086836_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_021356622.1|2086853_2088848_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	41.3	7.2e-32
WP_003646619.1|2089252_2089444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157262634.1|2090323_2090698_-|holin	holin	holin	A0A2K9VCG4	Lactobacillus_phage	78.8	1.3e-22
WP_016511481.1|2090684_2090981_-	hypothetical protein	NA	A0A2K9VCD4	Lactobacillus_phage	75.5	7.6e-39
WP_157262830.1|2090981_2092112_-	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	71.9	3.0e-35
WP_157262636.1|2092141_2092306_-	hypothetical protein	NA	A0A2D1GPM8	Lactobacillus_phage	74.4	1.8e-05
WP_157262638.1|2092373_2094917_-	DUF2479 domain-containing protein	NA	O03968	Lactobacillus_phage	56.7	2.3e-59
WP_157262640.1|2094932_2095169_-	hypothetical protein	NA	A0A291I9J9	Lactobacillus_phage	40.6	1.4e-06
WP_157262642.1|2095196_2095325_-	XkdX family protein	NA	NA	NA	NA	NA
WP_157262644.1|2095337_2095730_-	DUF2977 domain-containing protein	NA	NA	NA	NA	NA
WP_157262646.1|2095729_2096467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157262648.1|2096472_2097087_-	DUF2479 domain-containing protein	NA	A0A1J0MFQ3	Staphylococcus_phage	49.3	1.0e-45
WP_157262650.1|2097101_2098094_-	SGNH/GDSL hydrolase family protein	NA	I6TFU2	Staphylococcus_virus	37.8	4.2e-41
WP_157262652.1|2098098_2099973_-	endolysin	NA	A0A1X9IGI5	Lactococcus_phage	34.4	3.4e-52
WP_157262654.1|2099972_2100710_-|tail	phage tail protein	tail	A0A1S5SA63	Streptococcus_phage	37.4	2.2e-42
WP_157262656.1|2100703_2104714_-	tape measure protein	NA	E9LUR1	Lactobacillus_phage	44.0	2.6e-81
WP_057717834.1|2104713_2104950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157262658.1|2105042_2105531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157262660.1|2105548_2106109_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_157262662.1|2106120_2106507_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_157262664.1|2106508_2107063_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_157262666.1|2107052_2107376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157262668.1|2107380_2107746_-	hypothetical protein	NA	A0A1W6JNH7	Staphylococcus_phage	39.6	4.0e-05
WP_157262670.1|2107760_2108819_-|capsid	phage capsid protein	capsid	A0A0S0N2Q7	Pseudomonas_phage	31.2	9.0e-34
WP_157262672.1|2108835_2109483_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_157262674.1|2109589_2110534_-|head	phage head morphogenesis protein	head	NA	NA	NA	NA
WP_157262676.1|2110536_2112177_-|portal	phage portal protein	portal	D2IZF6	Enterococcus_phage	31.7	2.2e-63
2112141:2112154	attL	CAAAACGTTGTTTT	NA	NA	NA	NA
WP_157262678.1|2112166_2113465_-|terminase	PBSX family phage terminase large subunit	terminase	B7T0C6	Staphylococcus_virus	49.9	1.4e-113
WP_157262679.1|2113668_2114208_-|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	37.0	6.2e-15
WP_157262280.1|2114265_2114586_-	hypothetical protein	NA	A0A1J1J9Q7	Escherichia_phage	45.6	2.3e-17
WP_016527195.1|2114809_2115082_-	hypothetical protein	NA	A0A2D2W301	Escherichia_phage	50.6	1.8e-18
WP_157262278.1|2115050_2115212_-	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	79.6	4.1e-15
WP_063488409.1|2115232_2115466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063851487.1|2115533_2116415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157262680.1|2116737_2117637_-	DUF4373 domain-containing protein	NA	A0A0P0HRQ2	Lactobacillus_phage	43.4	7.1e-56
WP_157262681.1|2117719_2118580_-	hypothetical protein	NA	A0A0P0IZH9	Lactobacillus_phage	50.0	6.6e-75
WP_157262682.1|2118503_2119391_-	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	48.1	2.0e-63
WP_157262683.1|2119387_2119774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157262684.1|2119906_2120077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157262685.1|2120134_2120380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157262686.1|2120392_2120908_-	transcriptional regulator	NA	D6PST4	Lactobacillus_phage	37.4	1.2e-23
WP_157262687.1|2121154_2121385_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016511202.1|2121557_2121920_+	helix-turn-helix domain-containing protein	NA	A0A0U4KKM4	Exiguobacterium_phage	32.0	2.6e-09
WP_003644968.1|2121931_2122345_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M4RD70	Bacillus_phage	31.3	3.4e-05
WP_157262688.1|2122371_2122707_+	hypothetical protein	NA	A0A1B0Y4P2	Lactobacillus_phage	53.9	4.9e-26
WP_157262689.1|2122950_2123661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157262690.1|2123858_2124665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157262691.1|2125325_2126651_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	42.0	2.7e-88
2126711:2126724	attR	AAAACAACGTTTTG	NA	NA	NA	NA
>prophage 5
NZ_CP046669	Lactobacillus plantarum strain 83-18 chromosome, complete genome	3081029	2307835	2316349	3081029		Synechococcus_phage(33.33%)	9	NA	NA
WP_046040135.1|2307835_2308414_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	2.1e-21
WP_046040137.1|2308406_2309432_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.0	1.6e-59
WP_003642591.1|2309428_2310883_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	2.5e-50
WP_003645864.1|2310867_2313087_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.3	4.5e-144
WP_011101895.1|2313079_2313760_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_070084868.1|2313759_2314014_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003642587.1|2314015_2314747_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	1.6e-37
WP_015380738.1|2314749_2315880_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003642585.1|2315863_2316349_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
>prophage 6
NZ_CP046669	Lactobacillus plantarum strain 83-18 chromosome, complete genome	3081029	2638928	2661229	3081029	integrase,transposase	unidentified_phage(28.57%)	21	2632924:2632938	2669305:2669319
2632924:2632938	attL	TTTTAAAAATAAAAA	NA	NA	NA	NA
WP_157262762.1|2638928_2639703_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	52.3	5.1e-26
WP_060677396.1|2640845_2641283_-	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_046040563.1|2641583_2642198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046040565.1|2642703_2643468_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_046040567.1|2643649_2643895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046040569.1|2643928_2644666_-	class I SAM-dependent methyltransferase	NA	A0A097BYE1	Leuconostoc_phage	37.2	2.0e-40
WP_046040571.1|2644931_2645135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080487839.1|2645763_2646798_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.1	2.0e-41
WP_016265827.1|2647688_2648351_-	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_016265828.1|2648353_2649373_-	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_071542840.1|2649442_2651695_-	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_157262763.1|2651715_2653080_-	MFS transporter	NA	NA	NA	NA	NA
WP_157262833.1|2653203_2654157_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_072567003.1|2654561_2655596_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.4	5.2e-42
WP_157262764.1|2655901_2656970_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.7	3.4e-28
WP_072566980.1|2657111_2657354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072566979.1|2657478_2658609_-|integrase	site-specific integrase	integrase	A0A0M9JJ77	Lactobacillus_phage	25.7	2.2e-30
WP_072566978.1|2658601_2659231_-	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_072566977.1|2659373_2659634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070083754.1|2659640_2659925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072566976.1|2660095_2661229_-|integrase	site-specific integrase	integrase	B3GVW7	Streptococcus_phage	26.1	7.7e-23
2669305:2669319	attR	TTTTAAAAATAAAAA	NA	NA	NA	NA
>prophage 1
NZ_CP046661	Lactobacillus plantarum strain 83-18 plasmid p83-18.1, complete sequence	67195	38093	66232	67195	transposase,integrase	Staphylococcus_phage(23.08%)	26	39958:40017	65917:66230
WP_157262055.1|38093_39023_-|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	33.0	1.7e-23
39958:40017	attL	GAATGACCGTTGTTTCTAAATTATCACTGTGCCGACCGTAGGCTGGCAAGGTATGATTTT	NA	NA	NA	NA
WP_157262056.1|40383_40986_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	41.9	2.8e-32
WP_157262057.1|41126_42302_-|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	29.2	1.8e-27
WP_041153623.1|42389_42932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041153624.1|43002_43242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041153625.1|43799_44375_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157262058.1|44539_46384_+	DHA2 family efflux MFS transporter permease subunit	NA	A0A0M3UL24	Mycobacterium_phage	29.0	9.2e-34
WP_157262059.1|46555_47611_+	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_041153628.1|47825_48530_+	class I SAM-dependent methyltransferase	NA	A0A097BYE1	Leuconostoc_phage	42.5	2.4e-38
WP_080315022.1|48538_49057_-|integrase	tyrosine-type recombinase/integrase	integrase	W8CYP1	Bacillus_phage	35.0	1.3e-17
WP_041153629.1|49094_49472_+	TOMM precursor leader peptide-binding protein	NA	NA	NA	NA	NA
WP_041153637.1|49552_50848_+	MFS transporter	NA	NA	NA	NA	NA
WP_041153630.1|50973_51270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157262060.1|52097_53027_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.4	1.8e-25
WP_033615077.1|53083_53575_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_041142903.1|53602_54451_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	39.2	6.2e-09
WP_152614128.1|54927_55440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052470497.1|55522_56716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041153598.1|56921_57782_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012391064.1|57783_58647_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	5.7e-18
WP_041153599.1|58695_59280_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	35.0	8.5e-18
WP_041153600.1|59321_59963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157262061.1|60552_61935_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.0	2.7e-30
WP_157262062.1|62040_63405_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.0	2.0e-09
WP_035454452.1|63536_63923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003561746.1|65056_66232_-|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	29.2	1.8e-27
65917:66230	attR	GAATGACCGTTGTTTCTAAATTATCACTGTGCCGACCGTAGGCTGGCAAGGTATGATTTTCAAACCGGCCATTGCGATCTCGAGGAATGGTTAAGTTAAGTTGGCCGTACTTCGTATCAAACGAGCGCTCATAACTGCCGTTGCGGTTATTACCAGTGTTAATCCCAGCGTATGAGTAGCGTTCGTAACCCAAAAACTCTGCCAATTCGGTTTGAAGCAGCTGGTTAATCGCAATTTCGAGGTGGTGACGAAAAACTTCGTCCAAATCTTGCTTTTGGGCTAGTGCAGCGATAATTTCTGTGGTAAGTTCATTC	NA	NA	NA	NA
>prophage 1
NZ_CP046662	Lactobacillus plantarum strain 83-18 plasmid p83-18.2, complete sequence	62644	0	28542	62644	holin,transposase,protease	Lactobacillus_phage(28.57%)	27	NA	NA
WP_157262063.1|0_924_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	40.9	6.0e-50
WP_157262064.1|1589_2606_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_157262065.1|2639_3356_-	acyltransferase	NA	NA	NA	NA	NA
WP_157262066.1|3375_4338_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_157262067.1|4356_5796_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_157262068.1|5795_6782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157262069.1|6878_8060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157262102.1|8077_8578_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_157262070.1|8595_9045_-	UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase	NA	NA	NA	NA	NA
WP_157262103.1|9245_10304_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	35.3	3.8e-40
WP_157262071.1|10433_11276_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.6	3.1e-154
WP_002816285.1|11329_11581_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
WP_157262072.1|11826_12597_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_157262073.1|12608_13337_+	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_157262074.1|14683_15088_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_157262075.1|16166_17087_+|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.2	9.2e-51
WP_157262076.1|17447_19568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016526775.1|19663_19978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157262077.1|20044_21829_-	AAA domain-containing protein	NA	A0A223W0B1	Agrobacterium_phage	33.5	8.8e-82
WP_157262078.1|21831_22437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157262079.1|22439_22634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157262080.1|22630_23596_-	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_157262081.1|23671_24280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128537224.1|24332_24635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157262082.1|24792_26955_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	47.3	9.9e-104
WP_006293514.1|27521_27626_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_128703948.1|27906_28542_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 1
NZ_CP046664	Lactobacillus plantarum strain 83-18 plasmid p83-18.4, complete sequence	41742	8586	16077	41742	transposase	Staphylococcus_phage(16.67%)	6	NA	NA
WP_003582114.1|8586_8910_-	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	42.7	5.2e-17
WP_003582117.1|9032_9629_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	37.4	3.5e-27
WP_157262115.1|9807_12801_+|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	38.7	5.1e-207
WP_157262116.1|13290_13878_+	recombinase family protein	NA	M4QQC6	Vibrio_phage	42.8	1.0e-18
WP_020923860.1|14185_15136_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	54.6	9.4e-99
WP_010623241.1|15150_16077_-	ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4P8A9	Corynebacterium_phage	32.1	5.9e-37
