The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP037881	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS009991 chromosome, complete genome	5036850	364824	376826	5036850	integrase	Enterobacteria_phage(33.33%)	14	353631:353644	372131:372144
353631:353644	attL	ACGCGCCAGCGGTT	NA	NA	NA	NA
WP_001043675.1|364824_365877_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
WP_001285275.1|366159_367263_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_000893231.1|367274_368525_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_001529718.1|368881_370096_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	9.7e-133
WP_000035054.1|370524_370728_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
WP_001529719.1|370727_371159_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.0	3.9e-28
WP_033567214.1|371171_372005_+	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	9.0e-21
WP_000476150.1|371997_372180_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
372131:372144	attR	AACCGCTGGCGCGT	NA	NA	NA	NA
WP_032150717.1|372173_373202_+	ash family protein	NA	Q8W643	Enterobacteria_phage	53.3	1.0e-13
WP_001065738.1|373194_373389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001024675.1|373385_373649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000181940.1|373645_373867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001529721.1|373859_374462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001529722.1|374474_376826_+	hypothetical protein	NA	A0A1W6JPG0	Morganella_phage	48.5	6.8e-74
>prophage 2
NZ_CP037881	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS009991 chromosome, complete genome	5036850	995399	1004131	5036850	transposase,protease	Dickeya_phage(14.29%)	7	NA	NA
WP_001201751.1|995399_996518_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|996514_998461_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|998590_998812_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|999135_999456_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|999486_1001763_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|1001954_1002413_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_085983316.1|1002875_1004131_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 3
NZ_CP037881	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS009991 chromosome, complete genome	5036850	1054194	1145111	5036850	tRNA,integrase,terminase,lysis,holin,protease,tail	Salmonella_phage(58.7%)	91	1057103:1057122	1120999:1121018
WP_001154025.1|1054194_1054998_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1054990_1056313_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1056293_1056998_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572724.1|1056997_1061464_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
1057103:1057122	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000925872.1|1061808_1063650_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1063909_1064458_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1064485_1065133_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1065194_1066385_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977713.1|1066569_1067661_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1068267_1069668_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1069868_1070330_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|1070646_1071861_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893207.1|1072105_1073542_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191399.1|1073619_1074822_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_020899445.1|1075016_1076309_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	4.5e-253
WP_000065276.1|1076353_1076602_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1076642_1076882_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_014344386.1|1076924_1078082_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_020899444.1|1078044_1081245_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	78.8	0.0e+00
WP_023139985.1|1081371_1081722_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	94.0	3.5e-59
WP_000917559.1|1081770_1081902_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	97.7	1.2e-17
WP_000981510.1|1082198_1082633_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	38.2	2.5e-14
WP_001555460.1|1082738_1082966_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	45.9	1.7e-14
WP_000426364.1|1083000_1083321_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	100.0	1.3e-52
WP_080071924.1|1083405_1084389_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	99.3	2.1e-162
WP_000800012.1|1084391_1085141_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_020899441.1|1085151_1085499_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	1.8e-52
WP_000065109.1|1085495_1085954_+	ead/Ea22-like family protein	NA	S4TNP2	Salmonella_phage	77.4	7.1e-44
WP_000850457.1|1085957_1086266_+	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	69.3	1.8e-30
WP_000208142.1|1086269_1086914_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	40.7	1.8e-29
WP_001536080.1|1086913_1087171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493384.1|1087225_1088203_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_022630855.1|1088214_1088811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000861985.1|1089402_1089636_+	DinI-like family protein	NA	A0A0M4REN2	Salmonella_phage	87.0	1.2e-31
WP_000763780.1|1089745_1089967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929788.1|1090051_1090654_+	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	99.0	7.5e-110
WP_001096542.1|1090862_1091474_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	98.0	2.7e-91
WP_000801757.1|1091470_1091611_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097242.1|1091607_1092297_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	50.6	1.1e-59
WP_001534733.1|1092491_1092617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1092752_1093202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076181665.1|1093562_1094249_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	99.1	3.9e-131
WP_001574216.1|1094524_1094854_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_077248249.1|1094837_1095290_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.7	2.7e-80
WP_024143045.1|1095307_1095754_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	90.4	1.2e-64
WP_000867564.1|1096222_1096768_+|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	61.3	4.5e-53
WP_020899435.1|1097888_1098221_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	4.4e-35
WP_000725267.1|1098320_1098818_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1098934_1099468_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1099557_1100253_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|1100262_1101000_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001576012.1|1100897_1101602_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_000033415.1|1101673_1105024_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	68.6	0.0e+00
WP_000178849.1|1105062_1105305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031247858.1|1105358_1107797_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.8	7.5e-92
WP_000143167.1|1107796_1108378_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001674638.1|1108853_1109822_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_000334547.1|1110469_1111096_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_031603423.1|1111164_1111464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|1111448_1112135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1112405_1112597_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1113023_1115636_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1115843_1116854_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1117019_1117562_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1117558_1118668_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1118766_1120875_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1120887_1122795_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1120999:1121018	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000333152.1|1122809_1124063_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1124067_1125708_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_033567177.1|1125704_1126268_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1126523_1126691_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1126790_1127309_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156454.1|1127377_1129138_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1129323_1129776_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1129847_1130900_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1131256_1131766_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1131982_1132588_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1132574_1134728_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1134746_1135193_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1135316_1137371_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1137406_1137865_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1137959_1138622_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000975203.1|1138792_1139209_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1139253_1139571_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1139628_1140840_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|1141054_1141603_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1141628_1142408_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|1142456_1142738_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1142734_1143064_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1143150_1143810_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|1144430_1145111_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 4
NZ_CP037881	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS009991 chromosome, complete genome	5036850	1932194	1939003	5036850	integrase,tail	Salmonella_phage(33.33%)	11	1927057:1927079	1936772:1936794
1927057:1927079	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000275418.1|1932194_1933076_-|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_001521334.1|1933548_1933737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|1933801_1933969_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|1934225_1934759_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001013467.1|1934812_1935043_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|1935232_1935727_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001520095.1|1935786_1936641_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_000722368.1|1937014_1937368_-	YebY family protein	NA	NA	NA	NA	NA
1936772:1936794	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000979702.1|1937384_1938260_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|1938260_1938635_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|1938772_1939003_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 5
NZ_CP037881	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS009991 chromosome, complete genome	5036850	2014453	2093734	5036850	capsid,integrase,terminase,holin,head,transposase,protease,tail,portal,plate	Salmonella_phage(76.81%)	105	2020991:2021006	2095357:2095372
WP_000502119.1|2014453_2014912_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000659236.1|2015092_2016298_-	lysine-N-methylase	NA	NA	NA	NA	NA
WP_000079806.1|2016376_2017864_-	flagellin FliC	NA	NA	NA	NA	NA
WP_000146802.1|2018120_2019524_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000287764.1|2019538_2019946_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000204899.1|2019945_2020314_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_022630963.1|2020385_2021870_+	alpha-amylase	NA	NA	NA	NA	NA
2020991:2021006	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
WP_000754695.1|2021909_2022335_-	lipoprotein	NA	NA	NA	NA	NA
WP_001535233.1|2022520_2023726_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790504.1|2023722_2023956_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000639596.1|2024220_2024607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000719036.1|2024726_2025041_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001276834.1|2025257_2026940_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067735.1|2026932_2027928_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000064163.1|2027920_2028628_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213257.1|2028627_2029998_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000046981.1|2030019_2030463_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000631669.1|2030459_2031677_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000132169.1|2031781_2032249_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000502811.1|2032253_2033258_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282115.1|2033254_2033668_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_000978276.1|2033667_2034045_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253410.1|2034044_2034782_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187355.1|2034791_2035061_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000616953.1|2035069_2035864_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103974.1|2036145_2036769_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524019.1|2036807_2037056_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844798.1|2037130_2037358_+	YodD family peroxide/acid resistance protein	NA	NA	NA	NA	NA
WP_000948794.1|2037667_2038483_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001119821.1|2038461_2040174_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
WP_001178599.1|2040338_2040584_-	YodC family protein	NA	NA	NA	NA	NA
WP_000929134.1|2040600_2041512_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212264.1|2041687_2042608_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785978.1|2042596_2043067_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001157322.1|2043047_2044478_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|2044551_2045247_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2045338_2045638_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|2046287_2047484_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|2047744_2047933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2047943_2048156_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2048610_2049879_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2049881_2050301_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2050427_2050589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093793.1|2051782_2051995_+	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
WP_000842532.1|2051991_2052405_+	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
WP_122815478.1|2052452_2052566_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	100.0	4.3e-11
WP_000836773.1|2052640_2052874_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
WP_022742744.1|2052987_2053593_-|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	100.0	2.7e-107
WP_000554735.1|2053562_2055125_-	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	98.5	1.7e-283
WP_001207832.1|2055111_2055699_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000785581.1|2055701_2056781_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.2	7.2e-204
WP_000605055.1|2056773_2057187_-	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	99.3	1.2e-74
WP_001273649.1|2057191_2057725_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_001066632.1|2057724_2058783_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	99.7	3.0e-202
WP_033567259.1|2058779_2060120_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.3	9.7e-251
WP_001033736.1|2060179_2060629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000785381.1|2060645_2062571_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	97.3	0.0e+00
WP_000588852.1|2062655_2062982_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515953.1|2062978_2063335_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	99.2	1.3e-61
WP_033567258.1|2063334_2064831_-|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	99.4	3.0e-277
WP_065305283.1|2064820_2064985_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	94.4	7.1e-23
WP_000779213.1|2065006_2065564_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	93.4	1.1e-96
WP_033567257.1|2065560_2066073_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	87.6	1.6e-81
WP_033567256.1|2066044_2066449_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	74.6	3.7e-52
WP_000927721.1|2066445_2066769_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	97.2	2.4e-54
WP_033572442.1|2066771_2066972_-	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	5.8e-27
WP_033572441.1|2067021_2068227_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	98.0	9.4e-221
WP_033567207.1|2068241_2068892_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	97.7	3.1e-117
WP_000466255.1|2068869_2070111_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_000605609.1|2070110_2070293_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_033567282.1|2070304_2072038_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.5	0.0e+00
WP_000929191.1|2072034_2072529_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_001135098.1|2072654_2073005_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_001379492.1|2073055_2073388_-	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001530346.1|2073850_2074243_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001624504.1|2074239_2074854_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_000422366.1|2074853_2075135_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001283169.1|2075121_2075508_-	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_001624505.1|2075653_2075911_-	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_020899401.1|2076061_2076814_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
WP_070793644.1|2076827_2077817_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	100.0	2.1e-194
WP_001061452.1|2077824_2078685_-	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	100.0	1.1e-162
WP_000779148.1|2078701_2079091_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	100.0	4.9e-70
WP_033567232.1|2079099_2079975_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	99.3	2.7e-169
WP_000054228.1|2079971_2080445_-	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	100.0	4.9e-56
WP_033567233.1|2080441_2081416_-	protein phage	NA	A0A1C9IHW0	Salmonella_phage	100.0	2.3e-169
WP_000620702.1|2081412_2081637_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087404.1|2081633_2082776_-	hypothetical protein	NA	A0A1C9IHV9	Salmonella_phage	100.0	1.5e-212
WP_000509731.1|2082772_2083327_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2083355_2083580_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020636.1|2083677_2084373_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001067432.1|2084578_2084917_+	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
WP_023891434.1|2084879_2085104_-	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	100.0	1.6e-33
WP_000997191.1|2085643_2086015_+	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	100.0	2.5e-63
WP_000080416.1|2086072_2086900_+	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	100.0	2.6e-153
WP_000008351.1|2087036_2087576_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000215886.1|2087646_2088180_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	100.0	2.5e-101
WP_000224241.1|2088181_2088439_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_020899398.1|2088449_2089031_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	100.0	4.7e-109
WP_001061334.1|2089034_2089604_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_000414876.1|2089628_2089871_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_000532847.1|2089872_2090862_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|2091153_2091951_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001738920.1|2092322_2092613_+	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_001219015.1|2093260_2093734_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
2095357:2095372	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 6
NZ_CP037881	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS009991 chromosome, complete genome	5036850	2181068	2190234	5036850		Enterobacteria_phage(42.86%)	9	NA	NA
WP_000565905.1|2181068_2182148_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2182152_2182926_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2182922_2183915_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2183920_2184472_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2184472_2185351_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2185398_2186298_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2186297_2187383_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2187759_2188653_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|2188830_2190234_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 7
NZ_CP037881	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS009991 chromosome, complete genome	5036850	2258542	2267713	5036850	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195332.1|2258542_2260576_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2260816_2261275_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|2261446_2261977_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2262033_2262501_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2262547_2263267_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2263263_2264949_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|2265171_2265903_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2265962_2266070_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2266050_2266782_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2266765_2267713_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
NZ_CP037881	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS009991 chromosome, complete genome	5036850	2287120	2353516	5036850	holin,lysis,tail	Salmonella_phage(28.57%)	60	NA	NA
WP_000989296.1|2287120_2287816_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|2287969_2288854_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|2289030_2289750_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|2289746_2289992_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136409.1|2290196_2291438_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreT	NA	NA	NA	NA	NA
WP_000956095.1|2291431_2292667_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|2292741_2293752_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|2293767_2295288_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|2295421_2296420_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|2296918_2297941_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001526153.1|2298090_2299233_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|2299247_2299916_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|2300245_2301103_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|2301091_2301481_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000443208.1|2301485_2302853_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022915.1|2303069_2303957_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|2303989_2305312_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488255.1|2305355_2307347_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|2307692_2309162_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548308.1|2309351_2310215_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137961.1|2310335_2311385_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873909.1|2311463_2312321_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
WP_000854414.1|2312385_2314074_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|2314090_2315029_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|2315028_2316159_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|2316527_2317709_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213882.1|2317773_2318439_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|2318440_2318563_-	membrane protein	NA	NA	NA	NA	NA
WP_010989043.1|2318950_2319205_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|2319528_2320101_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169350.1|2320313_2321300_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|2321329_2322049_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|2322462_2323035_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957746.1|2323360_2324917_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561748.1|2325023_2326829_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501623.1|2326838_2327933_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137764.1|2327932_2328958_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000203622.1|2328959_2330549_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
WP_001094639.1|2330552_2330897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|2331287_2332478_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234836.1|2332505_2333201_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578121.1|2333352_2335113_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_000494192.1|2335237_2335522_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033440.1|2335630_2336251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|2336278_2337286_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|2337465_2337693_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|2337724_2339485_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|2339765_2340269_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2340296_2340587_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000639473.1|2340934_2342764_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000022213.1|2342817_2343261_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|2343638_2344166_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|2344168_2345410_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2346002_2346332_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894640.1|2346628_2347960_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|2347988_2348357_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|2348371_2349361_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001115840.1|2349689_2352056_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|2352224_2352428_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2352724_2353516_-|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 9
NZ_CP037881	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS009991 chromosome, complete genome	5036850	2693103	2798902	5036850	tRNA,capsid,integrase,terminase,lysis,holin,head,transposase,tail,portal	Salmonella_phage(39.06%)	111	2717648:2717664	2806806:2806822
WP_000940032.1|2693103_2693835_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|2693953_2694757_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174944.1|2694901_2695780_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000985204.1|2695961_2697005_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|2697008_2697827_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|2697837_2698851_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111027.1|2698851_2699838_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|2699828_2700467_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982961.1|2700592_2701870_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|2701864_2703004_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|2703199_2704453_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883146.1|2704777_2705968_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|2706149_2707694_+	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000100008.1|2708054_2709386_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|2709468_2711613_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|2711668_2713129_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|2713177_2713516_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|2713592_2714930_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054236.1|2714926_2715691_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|2715692_2717123_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
2717648:2717664	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000970045.1|2717772_2721660_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
WP_001747289.1|2721681_2721915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734248.1|2721915_2723460_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134566.1|2723510_2724062_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|2724086_2724722_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|2724725_2726087_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|2726097_2726991_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|2727106_2727955_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684027.1|2727993_2728911_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276365.1|2728932_2730129_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|2730244_2731171_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|2731208_2731469_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_000986043.1|2731580_2731961_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|2731960_2732692_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_033567169.1|2732703_2733432_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|2733443_2734349_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|2734345_2735026_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|2735299_2736274_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|2736290_2738090_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_010989047.1|2738494_2739988_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_001542312.1|2740466_2740604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015589559.1|2741316_2741481_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015701342.1|2742060_2742126_-	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_001738443.1|2742188_2742401_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|2742507_2742735_+	PagK-like protein	NA	NA	NA	NA	NA
WP_000143154.1|2742831_2743410_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|2743399_2744224_-|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_001144691.1|2744220_2746593_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000178853.1|2746646_2746889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514917.1|2746927_2750290_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000246126.1|2750351_2750999_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000662739.1|2750896_2751634_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|2751640_2752339_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|2752348_2752678_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372065.1|2752680_2755776_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	1.7e-274
WP_010989052.1|2755747_2756086_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2756082_2756478_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_077248250.1|2756528_2757275_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.5	1.9e-99
WP_000033885.1|2757282_2757684_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000817263.1|2757792_2758923_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000677089.1|2758971_2759550_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083294.1|2759577_2759961_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000201486.1|2759971_2760331_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000522566.1|2760388_2761417_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|2761471_2761819_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189503.1|2761831_2763328_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000831821.1|2763317_2764898_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|2764894_2765098_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623091.1|2765081_2767013_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_001102153.1|2766984_2767530_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669690.1|2767816_2768218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001533543.1|2768453_2768906_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000984584.1|2768923_2769376_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	7.9e-80
WP_077248428.1|2769359_2769689_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	99.1	2.9e-55
WP_047588307.1|2769964_2770651_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM2	Phage_Gifsy-1	99.1	1.4e-131
WP_000657897.1|2770865_2771054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|2771560_2772124_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_001097241.1|2772396_2773074_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000801757.1|2773070_2773211_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096550.1|2773207_2773819_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000929803.1|2774027_2774630_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	1.1e-108
WP_001574100.1|2774669_2774975_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
WP_001217666.1|2774964_2775204_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	1.1e-37
WP_000445792.1|2776068_2776542_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
WP_000065105.1|2776541_2777066_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
WP_000113623.1|2777062_2777410_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000800010.1|2777420_2778170_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_001540689.1|2778172_2779156_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001574095.1|2779240_2779615_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000869364.1|2779580_2779817_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_001009037.1|2779946_2780351_+	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	1.6e-71
WP_000917562.1|2780749_2780908_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001539619.1|2780929_2781280_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000017125.1|2781406_2784334_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_077248255.1|2784296_2785454_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_001237031.1|2785496_2785736_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001670787.1|2785776_2786061_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001007939.1|2786038_2787268_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_000589087.1|2787765_2788245_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|2788241_2789198_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168374.1|2789197_2789848_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|2789879_2790455_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|2790451_2790616_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000989177.1|2790879_2792502_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083343.1|2792486_2793224_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|2793354_2794689_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001526875.1|2794706_2795606_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188414.1|2795708_2796296_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|2796357_2796741_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|2797059_2797749_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|2797864_2798902_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
2806806:2806822	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 10
NZ_CP037881	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS009991 chromosome, complete genome	5036850	2818608	2924910	5036850	capsid,tRNA,integrase,terminase,holin,head,transposase,tail,portal,plate	Enterobacteria_phage(63.79%)	107	2814906:2814920	2925748:2925762
2814906:2814920	attL	CCGCCGGTGCCTTCC	NA	NA	NA	NA
WP_000215756.1|2818608_2819415_-	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	53.2	1.5e-65
WP_072032588.1|2819411_2819618_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001519189.1|2819748_2820045_-	zinc-ribbon domain and TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	67.2	9.0e-16
WP_000078916.1|2820181_2820322_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488105.1|2820512_2820773_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_032419529.1|2820815_2821925_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	3.1e-194
WP_000005390.1|2822082_2823267_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.7	1.5e-226
WP_000290447.1|2823266_2823779_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	9.2e-93
WP_000665308.1|2823833_2824199_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000763327.1|2824234_2824363_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_032419528.1|2824349_2827157_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	93.8	0.0e+00
WP_000979954.1|2827169_2827658_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.6e-86
WP_000905084.1|2827684_2828284_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	86.9	6.8e-87
WP_153260506.1|2828314_2829088_+|tail	phage tail protein	tail	A0A1C9II89	Salmonella_phage	61.7	7.2e-73
WP_022631136.1|2829090_2829624_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	80.3	5.7e-77
WP_010835343.1|2829628_2830246_-|tail	tail fiber assembly protein	tail	A0A1S6KZY8	Salmonella_phage	83.6	5.3e-95
WP_157355878.1|2830215_2831988_-|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	49.9	2.4e-124
WP_106668242.1|2831984_2832593_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	1.2e-86
WP_157355879.1|2832585_2833482_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.7	7.9e-156
WP_000213447.1|2833485_2833836_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001366983.1|2833832_2834414_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	99.0	8.6e-103
WP_000356339.1|2834410_2835046_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_157355880.1|2835038_2835506_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	1.0e-85
WP_000780535.1|2835643_2836051_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	7.2e-64
WP_000072328.1|2836047_2836440_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	1.3e-70
WP_000104350.1|2836436_2836760_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864901.1|2836762_2836963_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_063611130.1|2836962_2837457_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	94.5	1.2e-84
WP_157355881.1|2837558_2838359_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	86.8	1.9e-121
WP_001055125.1|2838404_2839457_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	93.7	2.7e-187
WP_157355882.1|2839480_2840317_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	97.8	2.8e-147
WP_001763303.1|2840471_2842223_+|terminase	ATPase subunit of terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.9	0.0e+00
WP_000087822.1|2842222_2843269_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.6e-206
WP_000970615.1|2843771_2845976_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_000248600.1|2845972_2847055_-	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	29.5	8.4e-19
WP_000211288.1|2847433_2847745_-	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	94.2	7.2e-48
WP_001673486.1|2847749_2848709_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	1.1e-179
WP_157355883.1|2848785_2851611_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	86.6	0.0e+00
WP_021549223.1|2851607_2851997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022631069.1|2852069_2852300_-	hypothetical protein	NA	A0A0A7NV48	Enterobacteria_phage	88.2	1.0e-27
WP_072644302.1|2852625_2852925_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	90.8	2.1e-41
WP_000153674.1|2852921_2853167_-	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	98.8	3.3e-40
WP_024232567.1|2853163_2853367_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	88.1	1.0e-26
WP_000021661.1|2853453_2853567_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	1.6e-10
WP_000514277.1|2853563_2853806_-	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_024232568.1|2853817_2854105_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	1.0e-32
WP_024232569.1|2854115_2854457_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	5.1e-55
WP_001001394.1|2854475_2854802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032152547.1|2854897_2855200_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	52.0	2.3e-19
WP_072644303.1|2855266_2856256_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	53.2	7.5e-99
WP_010989056.1|2856423_2856471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200080.1|2856570_2857731_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000210995.1|2857691_2858600_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225191.1|2858657_2859779_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|2859788_2860859_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212379.1|2861298_2861817_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030985.1|2861809_2863030_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_000065257.1|2863186_2863534_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469804.1|2863574_2864342_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|2864386_2864935_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|2864953_2865202_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|2865515_2866877_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|2867042_2867834_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127172650.1|2867853_2869140_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001287923.1|2869260_2869866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|2869900_2870491_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059155.1|2870613_2871492_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|2871577_2873239_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|2873387_2873726_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|2873891_2874182_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|2874171_2874648_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|2874797_2875280_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237668.1|2875893_2887368_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_000533858.1|2887432_2888842_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196159.1|2888838_2891019_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_010989057.1|2891026_2892190_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_001542208.1|2892790_2893855_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	62.5	1.6e-118
WP_001542209.1|2893868_2894036_+	hypothetical protein	NA	A0A1B5FPC6	Escherichia_phage	61.9	1.1e-07
WP_010989063.1|2894082_2894676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000248794.1|2895065_2896259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001161781.1|2896593_2897421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000701821.1|2897871_2898087_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001520307.1|2898122_2900192_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.1	1.7e-73
WP_001520831.1|2900612_2901896_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_010989064.1|2901940_2902759_+	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_010989065.1|2902912_2903269_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000749979.1|2903363_2903648_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.7	5.4e-18
WP_000480483.1|2903760_2904282_+	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000973738.1|2904278_2904653_+	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_001098984.1|2904649_2905630_+	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_001033832.1|2905640_2906654_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000889012.1|2906948_2908151_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000776032.1|2908224_2908860_-	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_031603456.1|2908883_2909447_-	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_000811366.1|2909446_2910289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000819716.1|2910418_2911960_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000021514.1|2912182_2913862_+	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|2914912_2915617_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|2916201_2917062_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001387387.1|2917211_2917613_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|2917659_2918364_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000480968.1|2918424_2919261_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|2919260_2920064_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_001043265.1|2920124_2920940_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000240536.1|2921247_2922099_-	replication protein	NA	NA	NA	NA	NA
WP_001067855.1|2922854_2923559_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000935452.1|2923605_2924910_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
2925748:2925762	attR	GGAAGGCACCGGCGG	NA	NA	NA	NA
>prophage 11
NZ_CP037881	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS009991 chromosome, complete genome	5036850	3399048	3440578	5036850	tRNA,capsid,integrase,terminase,holin,head,tail,portal	Cronobacter_phage(67.57%)	46	3394385:3394400	3437800:3437815
3394385:3394400	attL	ATGGCGGCGTAGCCAG	NA	NA	NA	NA
WP_001264394.1|3399048_3400062_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
WP_001144069.1|3400289_3400505_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918865.1|3400740_3402486_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001519776.1|3402635_3404483_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000237776.1|3404606_3405113_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000340945.1|3405436_3405739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001680744.1|3407107_3408808_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.4	9.9e-224
WP_000200789.1|3408810_3409356_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_000267957.1|3409327_3410053_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	53.5	3.7e-63
WP_000861353.1|3410042_3410597_-|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	89.0	2.7e-90
WP_000084307.1|3410609_3412844_-|tail	tail protein	tail	Q8HAB4	Salmonella_phage	73.7	7.2e-182
WP_001001828.1|3412853_3413441_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	3.8e-90
WP_000136921.1|3413433_3414618_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	6.7e-179
WP_001002797.1|3414614_3414944_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000811094.1|3414940_3416911_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.8	3.2e-274
WP_000411339.1|3417098_3417356_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_000376373.1|3417502_3417835_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	1.5e-35
WP_000175560.1|3417834_3418176_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_001154425.1|3418172_3418466_-|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000166743.1|3418475_3418931_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_000220203.1|3418927_3420055_-	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
WP_000560080.1|3420051_3420759_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.1	1.3e-100
WP_000084218.1|3420755_3421262_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.1	1.2e-63
WP_000447487.1|3421258_3421747_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	2.3e-64
WP_001218537.1|3421807_3422509_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
WP_000550495.1|3422512_3423535_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.5	3.9e-159
WP_000018800.1|3423596_3424400_-|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.0	2.0e-78
WP_001151939.1|3424560_3426336_+	hypothetical protein	NA	F1BUM5	Cronobacter_phage	83.1	9.8e-291
WP_000038213.1|3426332_3427394_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	76.8	6.7e-162
WP_001552031.1|3427390_3427714_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000353141.1|3427687_3427894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000170874.1|3428013_3430035_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.5	7.9e-297
WP_000279404.1|3430031_3430892_-	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	82.0	1.1e-130
WP_000551169.1|3430882_3431116_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000022786.1|3431183_3431585_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000996837.1|3431584_3432010_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
WP_000643375.1|3431999_3432227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460878.1|3432236_3432740_-	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_001247711.1|3432770_3432992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514631.1|3433135_3433717_+	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	37.2	1.2e-27
WP_000568372.1|3433733_3434300_+	hypothetical protein	NA	Q4ZA70	Staphylococcus_virus	32.8	1.3e-18
WP_001145219.1|3434303_3435341_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	63.9	1.5e-121
WP_000627044.1|3435330_3437112_+	ATP-binding protein	NA	X2KLG0	Campylobacter_phage	23.2	6.4e-08
WP_000213760.1|3437369_3438137_-	siderophore-interacting protein	NA	NA	NA	NA	NA
3437800:3437815	attR	CTGGCTACGCCGCCAT	NA	NA	NA	NA
WP_000983441.1|3438368_3439016_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000478472.1|3439012_3440578_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.0e-12
>prophage 12
NZ_CP037881	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS009991 chromosome, complete genome	5036850	4475948	4496368	5036850	plate,tail	Burkholderia_phage(45.0%)	26	NA	NA
WP_000587738.1|4475948_4476677_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|4476873_4477164_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|4477412_4477868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|4477864_4478470_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|4478474_4480220_-|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|4480222_4480855_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|4480847_4481963_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4481953_4482313_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|4482476_4484024_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|4484023_4484953_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|4484949_4485312_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4485639_4486362_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4486371_4487415_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4487402_4487612_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|4487611_4488565_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262499.1|4488564_4490919_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_001185654.1|4491015_4491144_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4491103_4491421_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4491472_4491997_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|4491996_4493424_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4493413_4493611_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4493607_4494063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|4494222_4494537_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|4494549_4495155_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|4495157_4495445_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4496020_4496368_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 13
NZ_CP037881	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS009991 chromosome, complete genome	5036850	4522817	4563633	5036850	capsid,tRNA,integrase,terminase,holin,head,protease,tail,portal,plate	Shigella_phage(44.83%)	60	4561128:4561142	4564534:4564548
WP_000549966.1|4522817_4523252_+	hypothetical protein	NA	A0A0S2SYH1	Pseudomonas_phage	51.0	5.2e-36
WP_001093909.1|4523278_4523551_-	hypothetical protein	NA	S5MQM5	Escherichia_phage	86.7	5.9e-38
WP_001061343.1|4523587_4524160_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	96.8	3.7e-106
WP_000206745.1|4524159_4524969_-	hypothetical protein	NA	Q8HAA7	Salmonella_phage	61.8	3.3e-76
WP_001565177.1|4524968_4525331_-	phage protein	NA	U5P092	Shigella_phage	97.5	1.5e-65
WP_000008210.1|4525321_4525858_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	99.4	9.7e-101
WP_033567165.1|4525985_4526810_-	DUF2303 family protein	NA	U5P439	Shigella_phage	98.9	1.1e-148
WP_001323604.1|4526875_4527256_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	1.3e-62
WP_001514782.1|4527838_4528114_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	97.8	7.0e-47
WP_001369946.1|4528122_4528326_-	ClpX C4-type zinc finger	NA	A0A1C9IHZ4	Salmonella_phage	68.3	8.9e-15
WP_000848748.1|4528497_4529172_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649477.1|4529262_4529463_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000515829.1|4529506_4530064_+	protein YmfL	NA	S5FXP0	Shigella_phage	96.2	1.1e-96
WP_001250269.1|4530239_4530419_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104942.1|4530408_4531350_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.3	1.7e-140
WP_086936917.1|4531346_4531841_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	97.5	4.7e-86
WP_001433188.1|4531840_4532494_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	5.6e-127
WP_000210170.1|4532490_4532817_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_001398927.1|4532813_4533203_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A291AX14	Escherichia_phage	100.0	5.4e-69
WP_001061444.1|4533222_4534032_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_033567167.1|4534039_4535029_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	2.1e-194
WP_048306282.1|4535042_4535795_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	99.6	9.0e-145
WP_001624505.1|4535945_4536203_+	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_001283169.1|4536348_4536735_+	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_000422366.1|4536721_4537003_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001624504.1|4537002_4537617_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_001530346.1|4537613_4538006_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001379492.1|4538468_4538801_+	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001135098.1|4538851_4539202_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_048306293.1|4539327_4539813_+|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	98.8	6.1e-86
WP_000088161.1|4539826_4541560_+|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	100.0	0.0e+00
WP_000605606.1|4541571_4541754_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_001514795.1|4541753_4542995_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	5.0e-241
WP_021578635.1|4542972_4543623_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.1	3.6e-118
WP_021567480.1|4543637_4544843_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.5	3.5e-223
WP_021577001.1|4544892_4545120_+	hypothetical protein	NA	S5FNU1	Shigella_phage	94.9	2.2e-22
WP_000927719.1|4545094_4545418_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000702388.1|4545414_4545825_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	97.8	5.9e-74
WP_022630978.1|4545799_4546306_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	5.0e-91
WP_000779279.1|4546302_4546863_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	2.3e-105
WP_000497751.1|4546871_4547042_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_022630977.1|4547025_4548522_+|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	99.0	7.7e-273
WP_000090998.1|4548521_4548878_+	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_000661047.1|4548877_4549147_+|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_023200330.1|4549288_4551121_+|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.2	4.7e-304
WP_001439754.1|4551202_4551715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000219913.1|4551805_4553134_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	99.3	8.4e-247
WP_000999499.1|4553130_4554210_+|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.7	5.3e-207
WP_022630975.1|4554209_4554758_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	1.9e-96
WP_000424732.1|4554757_4555183_+	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_022630974.1|4555169_4556228_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.6	5.2e-199
WP_000383548.1|4556218_4556803_+	YmfQ family protein	NA	O22003	Shigella_phage	100.0	1.1e-113
WP_023200332.1|4556806_4558339_+	hypothetical protein	NA	A0A1B0VFW4	Salmonella_phage	97.9	1.6e-241
WP_006678265.1|4558308_4558926_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	100.0	5.7e-113
WP_001747940.1|4558929_4559337_-|tail	tail assembly chaperone	tail	A0A1B0V844	Salmonella_phage	100.0	4.9e-73
WP_006678262.1|4559338_4560067_-	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	100.0	2.8e-143
WP_000639149.1|4560392_4560956_+	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	79.1	3.4e-80
WP_033567204.1|4561099_4561348_-	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	98.8	2.0e-37
4561128:4561142	attL	TCCCAGGTATCTTTC	NA	NA	NA	NA
WP_000332264.1|4561409_4562507_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	100.0	4.3e-212
WP_022630972.1|4562595_4563633_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
4564534:4564548	attR	TCCCAGGTATCTTTC	NA	NA	NA	NA
