The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP037874	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014854 chromosome, complete genome	4817234	973944	982676	4817234	protease,transposase	Dickeya_phage(14.29%)	7	NA	NA
WP_001201751.1|973944_975063_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|975059_977006_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|977135_977357_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|977680_978001_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|978031_980308_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|980499_980958_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_085983316.1|981420_982676_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 2
NZ_CP037874	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014854 chromosome, complete genome	4817234	1032769	1131578	4817234	holin,protease,lysis,terminase,tail,portal,tRNA,integrase	Salmonella_phage(42.86%)	101	1035678:1035697	1107466:1107485
WP_001154025.1|1032769_1033573_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1033565_1034888_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1034868_1035573_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572724.1|1035572_1040039_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
1035678:1035697	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000925872.1|1040383_1042225_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1042484_1043033_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1043060_1043708_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1043769_1044960_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977713.1|1045144_1046236_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1046842_1048243_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1048443_1048905_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|1049221_1050436_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893207.1|1050680_1052117_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191399.1|1052194_1053397_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262306.1|1053591_1054884_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000065276.1|1054928_1055177_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1055217_1055457_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|1055499_1056657_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_000017133.1|1056619_1059505_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001668146.1|1059631_1059931_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000917564.1|1059952_1060111_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_014344008.1|1060103_1060364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|1060413_1060824_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|1060943_1061183_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|1061148_1061523_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1061607_1062591_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800013.1|1062593_1063343_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.2	1.1e-137
WP_000113629.1|1063353_1063701_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000065108.1|1063697_1064009_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_014343823.1|1064086_1064377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|1064668_1064902_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|1065013_1065235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929805.1|1065317_1065920_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_001096552.1|1066128_1066740_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001617856.1|1066736_1066883_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|1066872_1067670_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_010989004.1|1067736_1068054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|1068227_1068353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1068488_1068938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|1069298_1069985_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_001574216.1|1070260_1070590_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_077907023.1|1070573_1071026_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	3.9e-79
WP_001541990.1|1071043_1071523_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000371784.1|1071730_1072264_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989241.1|1072220_1074359_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000196190.1|1074355_1074562_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_077679777.1|1074588_1076106_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
WP_010989008.1|1076029_1078111_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001107908.1|1078201_1078525_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|1078517_1078817_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453194.1|1078797_1079364_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000196702.1|1079360_1079762_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000132756.1|1079773_1080523_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478859.1|1080568_1080967_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1080963_1081293_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_010989010.1|1081372_1084360_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_000978296.1|1084356_1084689_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_000725267.1|1084787_1085285_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1085401_1085935_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1086024_1086720_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|1086729_1087467_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_000246065.1|1087364_1088069_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000033415.1|1088140_1091491_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	68.6	0.0e+00
WP_000178849.1|1091529_1091772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157355897.1|1091825_1094264_+|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.6	3.7e-91
WP_000143167.1|1094263_1094845_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001526469.1|1095320_1096289_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	100.0	7.1e-195
WP_000334547.1|1096936_1097563_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_010989011.1|1097631_1097931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|1097915_1098602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1098872_1099064_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1099490_1102103_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1102310_1103321_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1103486_1104029_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1104025_1105135_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1105233_1107342_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1107354_1109262_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1107466:1107485	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000333152.1|1109276_1110530_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1110534_1112175_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1112171_1112735_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1112990_1113158_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1113257_1113776_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156453.1|1113844_1115605_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1115790_1116243_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1116314_1117367_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1117723_1118233_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1118449_1119055_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1119041_1121195_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1121213_1121660_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1121783_1123838_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1123873_1124332_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1124426_1125089_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000975203.1|1125259_1125676_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1125720_1126038_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1126095_1127307_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|1127521_1128070_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1128095_1128875_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|1128923_1129205_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1129201_1129531_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1129617_1130277_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|1130897_1131578_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 3
NZ_CP037874	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014854 chromosome, complete genome	4817234	1920397	1927206	4817234	integrase,tail	Salmonella_phage(33.33%)	11	1915260:1915282	1924975:1924997
1915260:1915282	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000275418.1|1920397_1921279_-|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_001521334.1|1921751_1921940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|1922004_1922172_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|1922428_1922962_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001013467.1|1923015_1923246_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|1923435_1923930_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001520095.1|1923989_1924844_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_000722368.1|1925217_1925571_-	YebY family protein	NA	NA	NA	NA	NA
1924975:1924997	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000979702.1|1925587_1926463_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|1926463_1926838_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|1926975_1927206_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 4
NZ_CP037874	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014854 chromosome, complete genome	4817234	2002656	2082000	4817234	capsid,head,holin,transposase,protease,plate,lysis,terminase,tail,portal,integrase	Salmonella_phage(85.07%)	103	2009194:2009209	2083623:2083638
WP_000502119.1|2002656_2003115_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000659236.1|2003295_2004501_-	lysine-N-methylase	NA	NA	NA	NA	NA
WP_000079805.1|2004579_2006067_-	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_000146802.1|2006323_2007727_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000287764.1|2007741_2008149_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000204899.1|2008148_2008517_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_000795487.1|2008588_2010073_+	alpha-amylase	NA	NA	NA	NA	NA
2009194:2009209	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
WP_000754695.1|2010112_2010538_-	lipoprotein	NA	NA	NA	NA	NA
WP_001535233.1|2010723_2011929_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790504.1|2011925_2012159_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000639596.1|2012423_2012810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000719036.1|2012929_2013244_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001276834.1|2013460_2015143_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067735.1|2015135_2016131_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000064163.1|2016123_2016831_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213257.1|2016830_2018201_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000046981.1|2018222_2018666_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000631669.1|2018662_2019880_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000132169.1|2019984_2020452_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000502811.1|2020456_2021461_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282115.1|2021457_2021871_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_000978276.1|2021870_2022248_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253410.1|2022247_2022985_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187355.1|2022994_2023264_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000616953.1|2023272_2024067_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103974.1|2024348_2024972_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524019.1|2025010_2025259_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844798.1|2025333_2025561_+	YodD family peroxide/acid resistance protein	NA	NA	NA	NA	NA
WP_000948794.1|2025870_2026686_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001119821.1|2026664_2028377_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
WP_001178599.1|2028541_2028787_-	YodC family protein	NA	NA	NA	NA	NA
WP_000929134.1|2028803_2029715_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212264.1|2029890_2030811_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785978.1|2030799_2031270_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001157322.1|2031250_2032681_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|2032754_2033450_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2033541_2033841_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|2034490_2035687_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|2035947_2036136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2036146_2036359_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2036813_2038082_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2038084_2038504_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2038630_2038792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526483.1|2039422_2039644_-	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_000492926.1|2039856_2040864_+	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_000760554.1|2041148_2041718_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	7.3e-107
WP_000554737.1|2041717_2043280_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	100.0	2.6e-287
WP_001207832.1|2043266_2043854_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_014343855.1|2043856_2044378_-|plate	baseplate J/gp47 family protein	plate	Q8HAB6	Salmonella_phage	100.0	2.9e-94
WP_014343856.1|2044412_2044958_-	phage protein	NA	Q8HAB7	Salmonella_phage	100.0	9.2e-99
WP_000605050.1|2044929_2045343_-	hypothetical protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_001273649.1|2045347_2045881_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_001066635.1|2045880_2046939_-	hypothetical protein	NA	Q8HAC0	Salmonella_phage	99.7	6.6e-202
WP_000863818.1|2046935_2048276_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
WP_000785385.1|2048309_2050238_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.8	0.0e+00
WP_000588852.1|2050322_2050649_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|2050645_2051002_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007991.1|2051001_2052498_-|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	100.0	2.7e-278
WP_000497739.1|2052487_2052652_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_000779218.1|2052655_2053216_-	hypothetical protein	NA	Q8HAC7	Salmonella_phage	100.0	3.0e-105
WP_001135697.1|2053212_2053725_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
WP_000702408.1|2053696_2054101_-|head	phage head closure protein	head	Q8HAC9	Salmonella_phage	100.0	1.4e-72
WP_000927378.1|2054097_2054421_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000601353.1|2054423_2054624_-	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
WP_000257528.1|2054674_2055880_-|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	100.0	1.6e-223
WP_001193639.1|2055894_2056545_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000466254.1|2056522_2057764_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.8	2.0e-242
WP_000605609.1|2057763_2057946_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000088182.1|2057957_2059691_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	100.0	0.0e+00
WP_000929191.1|2059687_2060182_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_001135225.1|2060307_2060658_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	100.0	2.5e-65
WP_001292890.1|2060718_2061021_-	hypothetical protein	NA	Q8HA83	Salmonella_phage	100.0	3.6e-52
WP_000877027.1|2061240_2061660_-	KilA-N domain-containing protein	NA	Q8HA84	Salmonella_phage	100.0	4.8e-71
WP_001050825.1|2061872_2062358_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	100.0	5.9e-81
WP_001005901.1|2062354_2062969_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	100.0	9.3e-116
WP_001527046.1|2062971_2063316_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
WP_014343859.1|2063477_2063912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001527054.1|2063841_2064099_-	hypothetical protein	NA	Q8HA88	Salmonella_phage	100.0	5.2e-44
WP_000188927.1|2064231_2064855_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	100.0	9.1e-119
WP_080075788.1|2064865_2065855_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	96.4	2.3e-188
WP_001061457.1|2065862_2066723_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	100.0	2.9e-163
WP_001241579.1|2066739_2067129_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_000066908.1|2067125_2068019_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001684745.1|2068018_2068501_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000061500.1|2068502_2069321_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_000620702.1|2069317_2069542_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087402.1|2069538_2070696_-	peptidase	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000509731.1|2070692_2071247_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2071275_2071500_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020636.1|2071597_2072293_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_000997190.1|2073107_2073479_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_000080415.1|2073536_2074364_+	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	100.0	7.5e-153
WP_000008351.1|2074500_2075040_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000764235.1|2075110_2075341_+	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000071070.1|2075337_2075853_+	DUF262 domain-containing protein	NA	Q8HAA5	Salmonella_phage	100.0	7.4e-98
WP_000065095.1|2075849_2076467_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	100.0	2.6e-113
WP_000208068.1|2076463_2077297_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	100.0	4.7e-163
WP_001061334.1|2077300_2077870_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_000414876.1|2077894_2078137_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_000532847.1|2078138_2079128_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|2079419_2080217_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001738920.1|2080588_2080879_+	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_001219015.1|2081526_2082000_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
2083623:2083638	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 5
NZ_CP037874	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014854 chromosome, complete genome	4817234	2167994	2178500	4817234		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2167994_2169308_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2169334_2170414_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2170418_2171192_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2171188_2172181_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2172186_2172738_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2172738_2173617_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2173664_2174564_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2174563_2175649_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2176025_2176919_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|2177096_2178500_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 6
NZ_CP037874	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014854 chromosome, complete genome	4817234	2246807	2255978	4817234	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195332.1|2246807_2248841_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2249081_2249540_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|2249711_2250242_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2250298_2250766_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2250812_2251532_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2251528_2253214_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|2253436_2254168_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2254227_2254335_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2254315_2255047_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2255030_2255978_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 7
NZ_CP037874	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014854 chromosome, complete genome	4817234	2275385	2341780	4817234	holin,tail,lysis	Salmonella_phage(28.57%)	60	NA	NA
WP_000989296.1|2275385_2276081_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|2276234_2277119_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|2277295_2278015_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|2278011_2278257_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136409.1|2278461_2279703_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreT	NA	NA	NA	NA	NA
WP_000956095.1|2279696_2280932_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|2281006_2282017_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|2282032_2283553_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|2283686_2284685_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|2285183_2286206_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001526153.1|2286355_2287498_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|2287512_2288181_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|2288510_2289368_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|2289356_2289746_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000443208.1|2289750_2291118_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022915.1|2291334_2292222_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|2292254_2293577_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488255.1|2293620_2295612_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|2295956_2297426_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548308.1|2297615_2298479_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137961.1|2298599_2299649_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873909.1|2299727_2300585_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
WP_000854414.1|2300649_2302338_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|2302354_2303293_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|2303292_2304423_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|2304791_2305973_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213882.1|2306037_2306703_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|2306704_2306827_-	membrane protein	NA	NA	NA	NA	NA
WP_010989043.1|2307214_2307469_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|2307792_2308365_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169350.1|2308577_2309564_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|2309593_2310313_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|2310726_2311299_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957746.1|2311624_2313181_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561748.1|2313287_2315093_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501623.1|2315102_2316197_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137764.1|2316196_2317222_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000203622.1|2317223_2318813_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
WP_001094639.1|2318816_2319161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|2319551_2320742_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234836.1|2320769_2321465_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578121.1|2321616_2323377_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_000494192.1|2323501_2323786_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033440.1|2323894_2324515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|2324542_2325550_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|2325729_2325957_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|2325988_2327749_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|2328029_2328533_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_020843597.1|2328560_2328851_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000639473.1|2329198_2331028_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000022213.1|2331081_2331525_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|2331902_2332430_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|2332432_2333674_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2334266_2334596_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_001526364.1|2334892_2336224_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|2336252_2336621_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_116024798.1|2336635_2337625_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	96.7	1.3e-188
WP_001115840.1|2337953_2340320_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|2340488_2340692_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2340988_2341780_-|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 8
NZ_CP037874	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014854 chromosome, complete genome	4817234	2680662	2787832	4817234	capsid,head,holin,transposase,lysis,terminase,tail,portal,tRNA,integrase	Salmonella_phage(40.62%)	112	2705207:2705223	2795736:2795752
WP_000940032.1|2680662_2681394_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|2681512_2682316_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174944.1|2682460_2683339_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000985204.1|2683520_2684564_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|2684567_2685386_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|2685396_2686410_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111027.1|2686410_2687397_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|2687387_2688026_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982961.1|2688151_2689429_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|2689423_2690563_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|2690758_2692012_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883146.1|2692336_2693527_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|2693708_2695253_+	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000100008.1|2695613_2696945_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|2697027_2699172_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|2699227_2700688_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|2700736_2701075_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|2701151_2702489_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054236.1|2702485_2703250_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|2703251_2704682_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
2705207:2705223	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000970045.1|2705331_2709219_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
WP_001747289.1|2709240_2709474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734248.1|2709474_2711019_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134566.1|2711069_2711621_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|2711645_2712281_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|2712284_2713646_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|2713656_2714550_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|2714665_2715514_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684022.1|2715552_2716470_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276370.1|2716491_2717688_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|2717803_2718730_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|2718767_2719028_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_000986043.1|2719139_2719520_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|2719519_2720251_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399380.1|2720262_2720991_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|2721002_2721908_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|2721904_2722585_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|2722858_2723833_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|2723849_2725649_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_010989047.1|2726053_2727547_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_001542312.1|2728001_2728139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015589559.1|2728851_2729016_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015701342.1|2729595_2729661_-	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_001738443.1|2729723_2729936_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|2730042_2730270_+	PagK-like protein	NA	NA	NA	NA	NA
WP_000143154.1|2730366_2730945_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|2730934_2731759_-|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_157355903.1|2731755_2734128_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000178853.1|2734181_2734424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157355904.1|2734462_2737825_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	79.6	0.0e+00
WP_000246126.1|2737886_2738534_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000662739.1|2738431_2739169_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|2739175_2739874_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|2739883_2740213_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372072.1|2740215_2743311_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_010989052.1|2743282_2743621_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2743617_2744013_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971954.1|2744063_2744810_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000033885.1|2744817_2745219_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000817263.1|2745327_2746458_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000677089.1|2746506_2747085_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083294.1|2747112_2747496_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000201486.1|2747506_2747866_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000522566.1|2747923_2748952_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|2749006_2749354_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189503.1|2749366_2750863_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000831821.1|2750852_2752433_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|2752429_2752633_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623091.1|2752616_2754548_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_001102153.1|2754519_2755065_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669690.1|2755351_2755753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001533543.1|2755988_2756441_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_077907023.1|2756458_2756911_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	3.9e-79
WP_001574216.1|2756894_2757224_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_047588307.1|2757499_2758186_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM2	Phage_Gifsy-1	99.1	1.4e-131
WP_000657897.1|2758400_2758589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|2759095_2759659_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_001097241.1|2759931_2760609_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000801757.1|2760605_2760746_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096550.1|2760742_2761354_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000929791.1|2761562_2762165_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_014343878.1|2762199_2762448_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|2762564_2762798_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_000704096.1|2763067_2764060_+	peptidase M85	NA	NA	NA	NA	NA
WP_000065102.1|2764086_2764605_-	ead/Ea22-like family protein	NA	S4TNP2	Salmonella_phage	89.8	1.4e-40
WP_000113618.1|2764601_2764949_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	96.5	2.7e-56
WP_000800012.1|2764959_2765709_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_001527034.1|2765711_2766800_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	88.5	1.4e-154
WP_010835408.1|2766884_2767259_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_001274939.1|2767218_2767461_-	hypothetical protein	NA	A0A0M4QX15	Salmonella_phage	67.9	5.6e-24
WP_014344514.1|2767533_2767947_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	78.0	1.5e-45
WP_000106861.1|2768089_2769199_+	AAA family ATPase	NA	E7C9Q8	Salmonella_phage	58.4	1.6e-118
WP_000917561.1|2769679_2769838_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	96.2	2.6e-22
WP_014344515.1|2769859_2770210_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	94.0	2.7e-59
WP_058801033.1|2770336_2773264_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	95.8	0.0e+00
WP_077905217.1|2773226_2774384_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	1.8e-216
WP_001237032.1|2774426_2774666_+	DUF4060 family protein	NA	H6WRW9	Salmonella_phage	97.5	2.2e-36
WP_014344516.1|2774706_2774991_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	87.2	1.1e-42
WP_001007935.1|2774968_2776198_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.1	6.4e-233
WP_000589087.1|2776695_2777175_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|2777171_2778128_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168374.1|2778127_2778778_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|2778809_2779385_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|2779381_2779546_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000989177.1|2779809_2781432_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083343.1|2781416_2782154_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|2782284_2783619_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001526875.1|2783636_2784536_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188414.1|2784638_2785226_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|2785287_2785671_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|2785989_2786679_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|2786794_2787832_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
2795736:2795752	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 9
NZ_CP037874	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014854 chromosome, complete genome	4817234	3305121	3343339	4817234	holin,head,capsid,lysis,plate,terminase,tail,portal,tRNA,integrase	Salmonella_phage(65.0%)	47	3300458:3300473	3345401:3345416
3300458:3300473	attL	ATGGCGGCGTAGCCAG	NA	NA	NA	NA
WP_001264394.1|3305121_3306135_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
WP_001144069.1|3306362_3306578_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918865.1|3306813_3308559_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001519776.1|3308708_3310556_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000237776.1|3310679_3311186_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000468307.1|3311544_3311763_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	98.6	9.5e-39
WP_000627823.1|3311829_3312999_-	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	97.7	5.0e-211
WP_000978858.1|3312995_3313481_-|tail	phage tail protein	tail	A0A0M4RCP0	Salmonella_phage	98.8	2.3e-85
WP_047643491.1|3313495_3315940_-|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	90.9	0.0e+00
WP_085984508.1|3315932_3316088_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
WP_001029727.1|3316084_3316420_-|tail	phage tail assembly protein	tail	A0A0M4S5P8	Salmonella_phage	100.0	1.8e-52
WP_001207675.1|3316482_3317001_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	100.0	6.5e-94
WP_001279031.1|3317016_3318204_-|tail	phage tail sheath protein	tail	A0A0M4RTH5	Salmonella_phage	99.5	4.5e-223
WP_000143184.1|3318338_3318908_-|tail	tail fiber assembly protein	tail	A0A0M4QWM3	Salmonella_phage	98.4	2.0e-104
WP_047643490.1|3318907_3320650_-|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	99.0	2.9e-271
WP_001000070.1|3320660_3321191_-|tail	phage tail protein I	tail	A0A0M4R4W9	Salmonella_phage	100.0	1.9e-104
WP_000246674.1|3321183_3322092_-|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	98.7	1.7e-158
WP_000127150.1|3322098_3322446_-|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	98.3	2.1e-56
WP_001094749.1|3322442_3323084_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	98.6	9.1e-114
WP_001293096.1|3323152_3323602_-	phage virion morphogenesis protein	NA	S4TP59	Salmonella_phage	99.3	4.2e-73
WP_001169074.1|3323594_3324062_-|tail	phage tail protein	tail	S4TTA5	Salmonella_phage	100.0	1.1e-84
WP_001115178.1|3324024_3324183_-	hypothetical protein	NA	Q6K1H9	Salmonella_virus	100.0	3.4e-22
WP_047643489.1|3324169_3324583_-|lysis	LysB family phage lysis regulatory protein	lysis	S4TRW3	Salmonella_phage	99.3	9.9e-45
WP_001144116.1|3324579_3325077_-	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	99.4	1.2e-92
WP_000134659.1|3325063_3325360_-|holin	holin	holin	S4TP56	Salmonella_phage	100.0	4.4e-47
WP_000870102.1|3325363_3325567_-|tail	tail protein X	tail	S4TTA0	Salmonella_phage	97.0	8.8e-31
WP_052032250.1|3325566_3326073_-|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	99.4	1.7e-91
WP_000203473.1|3326165_3326915_-|terminase	terminase endonuclease subunit	terminase	O80305	Escherichia_phage	97.6	5.8e-120
WP_001247243.1|3326918_3327986_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	99.7	1.2e-198
WP_047643488.1|3328062_3328917_-|capsid	capsid scaffolding protein	capsid	A0A0M3UL81	Salmonella_phage	99.6	2.9e-147
WP_047643487.1|3329082_3330852_+|terminase	terminase ATPase subunit family protein	terminase	S4TT96	Salmonella_phage	99.8	0.0e+00
WP_000517957.1|3330851_3331898_+|portal	phage portal protein	portal	S4TNX7	Salmonella_phage	99.4	7.5e-190
WP_000338485.1|3331975_3332980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000143453.1|3333363_3335301_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000909816.1|3335287_3335788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021278.1|3335781_3336348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373437.1|3336681_3336900_-	hypothetical protein	NA	A0A218M4I0	Erwinia_phage	75.9	3.6e-14
WP_157355907.1|3337009_3339262_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	93.8	0.0e+00
WP_153259982.1|3339260_3339854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000752604.1|3339875_3340100_-	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	100.0	6.5e-35
WP_001246237.1|3340099_3340327_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	100.0	6.8e-32
WP_000085639.1|3340396_3340597_-	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	98.5	2.3e-31
WP_000920168.1|3340583_3340811_-	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	97.3	2.1e-36
WP_023972637.1|3340818_3341328_-	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	97.6	1.4e-88
WP_023972638.1|3341348_3341624_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	89.4	4.5e-38
WP_047643486.1|3341756_3342332_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	65.4	5.2e-68
WP_023972640.1|3342331_3343339_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	98.5	3.1e-193
3345401:3345416	attR	CTGGCTACGCCGCCAT	NA	NA	NA	NA
>prophage 10
NZ_CP037874	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014854 chromosome, complete genome	4817234	4378888	4399308	4817234	tail,plate	Burkholderia_phage(45.0%)	26	NA	NA
WP_000587738.1|4378888_4379617_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|4379813_4380104_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|4380352_4380808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|4380804_4381410_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|4381414_4383160_-|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|4383162_4383795_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|4383787_4384903_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4384893_4385253_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|4385416_4386964_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|4386963_4387893_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|4387889_4388252_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4388579_4389302_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4389311_4390355_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4390342_4390552_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|4390551_4391505_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262500.1|4391504_4393859_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	6.9e-66
WP_001185654.1|4393955_4394084_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4394043_4394361_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4394412_4394937_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|4394936_4396364_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4396353_4396551_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4396547_4397003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|4397162_4397477_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270440.1|4397489_4398095_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.4	1.2e-59
WP_001226442.1|4398097_4398385_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4398960_4399308_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 1
NZ_CP037873	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014854 plasmid pPNCS014854_S1, complete sequence	93844	35239	44535	93844	transposase	Escherichia_phage(28.57%)	11	NA	NA
WP_001541564.1|35239_35656_+	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
WP_001527010.1|35839_36175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001541562.1|36231_36798_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000728917.1|36829_37771_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
WP_000427676.1|38185_39391_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_001541561.1|39387_40365_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.2	5.2e-84
WP_000457541.1|40446_41721_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.0e-156
WP_000925627.1|41720_42143_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
WP_000490265.1|42653_43124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000369839.1|43116_43473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000088645.1|43854_44535_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
