The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP037882	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014875 chromosome, complete genome	4996832	364827	376829	4996832	integrase	Enterobacteria_phage(33.33%)	14	353634:353647	372134:372147
353634:353647	attL	ACGCGCCAGCGGTT	NA	NA	NA	NA
WP_001043675.1|364827_365880_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
WP_001285275.1|366162_367266_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_000893231.1|367277_368528_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_001529718.1|368884_370099_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	9.7e-133
WP_000035054.1|370527_370731_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
WP_001529719.1|370730_371162_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.0	3.9e-28
WP_033567214.1|371174_372008_+	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	9.0e-21
WP_000476150.1|372000_372183_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
372134:372147	attR	AACCGCTGGCGCGT	NA	NA	NA	NA
WP_032150717.1|372176_373205_+	ash family protein	NA	Q8W643	Enterobacteria_phage	53.3	1.0e-13
WP_001065738.1|373197_373392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001024675.1|373388_373652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000181940.1|373648_373870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001529721.1|373862_374465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001529722.1|374477_376829_+	hypothetical protein	NA	A0A1W6JPG0	Morganella_phage	48.5	6.8e-74
>prophage 2
NZ_CP037882	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014875 chromosome, complete genome	4996832	995479	1004211	4996832	protease,transposase	Dickeya_phage(14.29%)	7	NA	NA
WP_001201751.1|995479_996598_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|996594_998541_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|998670_998892_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|999215_999536_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|999566_1001843_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|1002034_1002493_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_085983316.1|1002955_1004211_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 3
NZ_CP037882	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014875 chromosome, complete genome	4996832	1054274	1145191	4996832	protease,terminase,tRNA,tail,holin,lysis,integrase	Salmonella_phage(58.7%)	91	1057183:1057202	1121079:1121098
WP_001154025.1|1054274_1055078_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1055070_1056393_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1056373_1057078_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572724.1|1057077_1061544_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
1057183:1057202	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000925872.1|1061888_1063730_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1063989_1064538_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1064565_1065213_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1065274_1066465_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977713.1|1066649_1067741_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1068347_1069748_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1069948_1070410_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|1070726_1071941_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893207.1|1072185_1073622_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191399.1|1073699_1074902_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_020899445.1|1075096_1076389_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	4.5e-253
WP_000065276.1|1076433_1076682_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1076722_1076962_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_014344386.1|1077004_1078162_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_136614733.1|1078124_1081325_-	DNA breaking-rejoining protein	NA	S4TNL0	Salmonella_phage	78.6	0.0e+00
WP_023139985.1|1081451_1081802_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	94.0	3.5e-59
WP_000917559.1|1081850_1081982_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	97.7	1.2e-17
WP_000981510.1|1082278_1082713_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	38.2	2.5e-14
WP_001555460.1|1082818_1083046_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	45.9	1.7e-14
WP_000426364.1|1083080_1083401_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	100.0	1.3e-52
WP_000062943.1|1083485_1084469_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	99.3	2.1e-162
WP_000800012.1|1084471_1085221_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_020899441.1|1085231_1085579_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	1.8e-52
WP_000065109.1|1085575_1086034_+	ead/Ea22-like family protein	NA	S4TNP2	Salmonella_phage	77.4	7.1e-44
WP_000850457.1|1086037_1086346_+	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	69.3	1.8e-30
WP_000208142.1|1086349_1086994_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	40.7	1.8e-29
WP_001536080.1|1086993_1087251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493384.1|1087305_1088283_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_022630855.1|1088294_1088891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000861985.1|1089482_1089716_+	DinI-like family protein	NA	A0A0M4REN2	Salmonella_phage	87.0	1.2e-31
WP_000763780.1|1089825_1090047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929788.1|1090131_1090734_+	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	99.0	7.5e-110
WP_001096542.1|1090942_1091554_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	98.0	2.7e-91
WP_000801757.1|1091550_1091691_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097242.1|1091687_1092377_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	50.6	1.1e-59
WP_001534733.1|1092571_1092697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1092832_1093282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076181665.1|1093642_1094329_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	99.1	3.9e-131
WP_001574216.1|1094604_1094934_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_077907023.1|1094917_1095370_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	3.9e-79
WP_024143045.1|1095387_1095834_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	90.4	1.2e-64
WP_000867564.1|1096302_1096848_+|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	61.3	4.5e-53
WP_020899435.1|1097968_1098301_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	4.4e-35
WP_000725267.1|1098400_1098898_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1099014_1099548_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1099637_1100333_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|1100342_1101080_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001576012.1|1100977_1101682_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_141035198.1|1101753_1105104_+	DUF1983 domain-containing protein	NA	A0A0K2FI38	Escherichia_phage	68.5	0.0e+00
WP_000178849.1|1105142_1105385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157355908.1|1105438_1107877_+|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.9	7.5e-92
WP_000143167.1|1107876_1108458_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001674638.1|1108933_1109902_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_000334547.1|1110549_1111176_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_031603423.1|1111244_1111544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|1111528_1112215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1112485_1112677_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1113103_1115716_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1115923_1116934_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1117099_1117642_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1117638_1118748_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1118846_1120955_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1120967_1122875_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1121079:1121098	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000333152.1|1122889_1124143_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1124147_1125788_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_033567177.1|1125784_1126348_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1126603_1126771_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1126870_1127389_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156454.1|1127457_1129218_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1129403_1129856_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1129927_1130980_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1131336_1131846_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1132062_1132668_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1132654_1134808_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1134826_1135273_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1135396_1137451_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1137486_1137945_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1138039_1138702_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000975203.1|1138872_1139289_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1139333_1139651_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1139708_1140920_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|1141134_1141683_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1141708_1142488_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|1142536_1142818_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1142814_1143144_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1143230_1143890_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|1144510_1145191_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 4
NZ_CP037882	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014875 chromosome, complete genome	4996832	1931898	1938707	4996832	tail,integrase	Salmonella_phage(33.33%)	11	1926761:1926783	1936476:1936498
1926761:1926783	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000275418.1|1931898_1932780_-|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_001521334.1|1933252_1933441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|1933505_1933673_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|1933929_1934463_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001013467.1|1934516_1934747_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|1934936_1935431_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001520095.1|1935490_1936345_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_000722368.1|1936718_1937072_-	YebY family protein	NA	NA	NA	NA	NA
1936476:1936498	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000979702.1|1937088_1937964_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|1937964_1938339_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|1938476_1938707_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 5
NZ_CP037882	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014875 chromosome, complete genome	4996832	2014157	2093438	4996832	protease,terminase,plate,head,capsid,tail,transposase,holin,portal,integrase	Salmonella_phage(75.36%)	105	2020695:2020710	2095061:2095076
WP_000502119.1|2014157_2014616_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000659236.1|2014796_2016002_-	lysine-N-methylase	NA	NA	NA	NA	NA
WP_000079806.1|2016080_2017568_-	flagellin FliC	NA	NA	NA	NA	NA
WP_000146802.1|2017824_2019228_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000287764.1|2019242_2019650_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000204899.1|2019649_2020018_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_022630963.1|2020089_2021574_+	alpha-amylase	NA	NA	NA	NA	NA
2020695:2020710	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
WP_000754695.1|2021613_2022039_-	lipoprotein	NA	NA	NA	NA	NA
WP_001535233.1|2022224_2023430_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790504.1|2023426_2023660_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000639596.1|2023924_2024311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000719036.1|2024430_2024745_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001276834.1|2024961_2026644_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067735.1|2026636_2027632_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000064163.1|2027624_2028332_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213257.1|2028331_2029702_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000046981.1|2029723_2030167_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000631669.1|2030163_2031381_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000132169.1|2031485_2031953_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000502811.1|2031957_2032962_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282115.1|2032958_2033372_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_000978276.1|2033371_2033749_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253410.1|2033748_2034486_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187355.1|2034495_2034765_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000616953.1|2034773_2035568_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103974.1|2035849_2036473_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524019.1|2036511_2036760_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844798.1|2036834_2037062_+	YodD family peroxide/acid resistance protein	NA	NA	NA	NA	NA
WP_000948794.1|2037371_2038187_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001119821.1|2038165_2039878_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
WP_001178599.1|2040042_2040288_-	YodC family protein	NA	NA	NA	NA	NA
WP_000929134.1|2040304_2041216_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212264.1|2041391_2042312_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785978.1|2042300_2042771_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001157322.1|2042751_2044182_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|2044255_2044951_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2045042_2045342_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|2045991_2047188_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|2047448_2047637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2047647_2047860_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2048314_2049583_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2049585_2050005_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2050131_2050293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093793.1|2051486_2051699_+	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
WP_000842532.1|2051695_2052109_+	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
WP_122815478.1|2052156_2052270_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	100.0	4.3e-11
WP_000836773.1|2052344_2052578_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
WP_022742744.1|2052691_2053297_-|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	100.0	2.7e-107
WP_000554735.1|2053266_2054829_-	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	98.5	1.7e-283
WP_001207832.1|2054815_2055403_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000785581.1|2055405_2056485_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.2	7.2e-204
WP_000605055.1|2056477_2056891_-	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	99.3	1.2e-74
WP_001273649.1|2056895_2057429_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_001066632.1|2057428_2058487_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	99.7	3.0e-202
WP_033567259.1|2058483_2059824_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.3	9.7e-251
WP_001033736.1|2059883_2060333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000785381.1|2060349_2062275_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	97.3	0.0e+00
WP_000588852.1|2062359_2062686_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515953.1|2062682_2063039_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	99.2	1.3e-61
WP_033567258.1|2063038_2064535_-|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	99.4	3.0e-277
WP_065305283.1|2064524_2064689_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	94.4	7.1e-23
WP_000779213.1|2064710_2065268_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	93.4	1.1e-96
WP_033567257.1|2065264_2065777_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	87.6	1.6e-81
WP_033567256.1|2065748_2066153_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	74.6	3.7e-52
WP_000927721.1|2066149_2066473_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	97.2	2.4e-54
WP_033572442.1|2066475_2066676_-	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	5.8e-27
WP_033572441.1|2066725_2067931_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	98.0	9.4e-221
WP_033567207.1|2067945_2068596_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	97.7	3.1e-117
WP_000466255.1|2068573_2069815_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_052895330.1|2069814_2069997_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	98.3	2.9e-25
WP_033567282.1|2070008_2071742_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.5	0.0e+00
WP_000929191.1|2071738_2072233_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_001135098.1|2072358_2072709_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_001379492.1|2072759_2073092_-	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001530346.1|2073554_2073947_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001624504.1|2073943_2074558_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_000422366.1|2074557_2074839_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001283169.1|2074825_2075212_-	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_001624505.1|2075357_2075615_-	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_020899401.1|2075765_2076518_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
WP_070793644.1|2076531_2077521_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	100.0	2.1e-194
WP_001061452.1|2077528_2078389_-	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	100.0	1.1e-162
WP_000779148.1|2078405_2078795_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	100.0	4.9e-70
WP_033567232.1|2078803_2079679_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	99.3	2.7e-169
WP_000054228.1|2079675_2080149_-	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	100.0	4.9e-56
WP_033567233.1|2080145_2081120_-	protein phage	NA	A0A1C9IHW0	Salmonella_phage	100.0	2.3e-169
WP_000620702.1|2081116_2081341_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087404.1|2081337_2082480_-	hypothetical protein	NA	A0A1C9IHV9	Salmonella_phage	100.0	1.5e-212
WP_000509731.1|2082476_2083031_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2083059_2083284_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020636.1|2083381_2084077_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001067432.1|2084282_2084621_+	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
WP_023891434.1|2084583_2084808_-	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	100.0	1.6e-33
WP_000997191.1|2085347_2085719_+	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	100.0	2.5e-63
WP_000080416.1|2085776_2086604_+	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	100.0	2.6e-153
WP_000008351.1|2086740_2087280_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000215886.1|2087350_2087884_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	100.0	2.5e-101
WP_000224241.1|2087885_2088143_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_020899398.1|2088153_2088735_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	100.0	4.7e-109
WP_001061334.1|2088738_2089308_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_000414876.1|2089332_2089575_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_000532847.1|2089576_2090566_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|2090857_2091655_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001738920.1|2092026_2092317_+	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_001219015.1|2092964_2093438_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
2095061:2095076	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 6
NZ_CP037882	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014875 chromosome, complete genome	4996832	2179432	2189938	4996832		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2179432_2180746_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2180772_2181852_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2181856_2182630_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2182626_2183619_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2183624_2184176_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2184176_2185055_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2185102_2186002_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2186001_2187087_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2187463_2188357_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|2188534_2189938_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 7
NZ_CP037882	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014875 chromosome, complete genome	4996832	2258246	2267417	4996832	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195332.1|2258246_2260280_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2260520_2260979_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|2261150_2261681_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2261737_2262205_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2262251_2262971_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2262967_2264653_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|2264875_2265607_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2265666_2265774_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2265754_2266486_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2266469_2267417_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
NZ_CP037882	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014875 chromosome, complete genome	4996832	2286824	2353220	4996832	lysis,holin,tail	Salmonella_phage(28.57%)	60	NA	NA
WP_000989296.1|2286824_2287520_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|2287673_2288558_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|2288734_2289454_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|2289450_2289696_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136409.1|2289900_2291142_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreT	NA	NA	NA	NA	NA
WP_000956095.1|2291135_2292371_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|2292445_2293456_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|2293471_2294992_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|2295125_2296124_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|2296622_2297645_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001526153.1|2297794_2298937_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|2298951_2299620_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|2299949_2300807_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|2300795_2301185_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000443208.1|2301189_2302557_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022915.1|2302773_2303661_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|2303693_2305016_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488255.1|2305059_2307051_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|2307396_2308866_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548308.1|2309055_2309919_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137961.1|2310039_2311089_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873909.1|2311167_2312025_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
WP_000854414.1|2312089_2313778_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|2313794_2314733_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|2314732_2315863_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|2316231_2317413_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213882.1|2317477_2318143_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|2318144_2318267_-	membrane protein	NA	NA	NA	NA	NA
WP_010989043.1|2318654_2318909_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|2319232_2319805_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169350.1|2320017_2321004_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|2321033_2321753_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|2322166_2322739_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957746.1|2323064_2324621_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561748.1|2324727_2326533_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501623.1|2326542_2327637_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137764.1|2327636_2328662_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000203622.1|2328663_2330253_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
WP_001094639.1|2330256_2330601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|2330991_2332182_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234836.1|2332209_2332905_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578121.1|2333056_2334817_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_000494192.1|2334941_2335226_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033440.1|2335334_2335955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|2335982_2336990_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|2337169_2337397_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|2337428_2339189_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|2339469_2339973_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2340000_2340291_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000639473.1|2340638_2342468_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000022213.1|2342521_2342965_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|2343342_2343870_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|2343872_2345114_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2345706_2346036_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894640.1|2346332_2347664_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|2347692_2348061_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|2348075_2349065_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001115840.1|2349393_2351760_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|2351928_2352132_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2352428_2353220_-|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 9
NZ_CP037882	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014875 chromosome, complete genome	4996832	2692921	2798701	4996832	protease,terminase,head,tRNA,capsid,tail,transposase,holin,lysis,portal,integrase	Salmonella_phage(39.06%)	110	2717466:2717482	2806605:2806621
WP_000940032.1|2692921_2693653_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|2693771_2694575_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174944.1|2694719_2695598_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000985204.1|2695779_2696823_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|2696826_2697645_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|2697655_2698669_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111027.1|2698669_2699656_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|2699646_2700285_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982961.1|2700410_2701688_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|2701682_2702822_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|2703017_2704271_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883146.1|2704595_2705786_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|2705967_2707512_+	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000100008.1|2707872_2709204_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|2709286_2711431_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|2711486_2712947_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|2712995_2713334_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|2713410_2714748_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054236.1|2714744_2715509_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|2715510_2716941_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
2717466:2717482	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000970045.1|2717590_2721478_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
WP_001747289.1|2721499_2721733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734248.1|2721733_2723278_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134566.1|2723328_2723880_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|2723904_2724540_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|2724543_2725905_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|2725915_2726809_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|2726924_2727773_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684027.1|2727811_2728729_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276365.1|2728750_2729947_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|2730062_2730989_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|2731026_2731287_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_000986043.1|2731398_2731779_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|2731778_2732510_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_033567169.1|2732521_2733250_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|2733261_2734167_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|2734163_2734844_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|2735117_2736092_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|2736108_2737908_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_010989047.1|2738312_2739806_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_001542312.1|2740266_2740404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015589559.1|2741116_2741281_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015701342.1|2741860_2741926_-	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_001738443.1|2741988_2742201_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_000143154.1|2742630_2743209_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|2743198_2744023_-|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_001144691.1|2744019_2746392_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000178853.1|2746445_2746688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514917.1|2746726_2750089_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000246126.1|2750150_2750798_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000662739.1|2750695_2751433_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|2751439_2752138_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|2752147_2752477_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372065.1|2752479_2755575_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	1.7e-274
WP_010989052.1|2755546_2755885_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2755881_2756277_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_077248250.1|2756327_2757074_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.5	1.9e-99
WP_000033885.1|2757081_2757483_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000817263.1|2757591_2758722_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000677089.1|2758770_2759349_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083294.1|2759376_2759760_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000201486.1|2759770_2760130_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000522566.1|2760187_2761216_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|2761270_2761618_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189503.1|2761630_2763127_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000831821.1|2763116_2764697_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|2764693_2764897_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623091.1|2764880_2766812_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_001102153.1|2766783_2767329_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669690.1|2767615_2768017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001533543.1|2768252_2768705_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_015701345.1|2768722_2769175_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	1.0e-79
WP_001574216.1|2769158_2769488_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001110783.1|2769763_2770450_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_000657897.1|2770664_2770853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|2771359_2771923_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_001097241.1|2772195_2772873_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000801757.1|2772869_2773010_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_033572459.1|2773006_2773618_-	protein ninG	NA	A0A0M4RU10	Salmonella_phage	98.5	1.2e-91
WP_000929803.1|2773826_2774429_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	1.1e-108
WP_001574100.1|2774468_2774774_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
WP_001217666.1|2774763_2775003_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	1.1e-37
WP_000445792.1|2775867_2776341_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
WP_000065105.1|2776340_2776865_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
WP_000113623.1|2776861_2777209_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000800010.1|2777219_2777969_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_080071924.1|2777971_2778955_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	99.3	2.1e-162
WP_001574095.1|2779039_2779414_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000869364.1|2779379_2779616_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_001009037.1|2779745_2780150_+	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	1.6e-71
WP_000917562.1|2780548_2780707_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001539619.1|2780728_2781079_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000017125.1|2781205_2784133_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_077248255.1|2784095_2785253_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_001237031.1|2785295_2785535_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001670787.1|2785575_2785860_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001007939.1|2785837_2787067_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_000589087.1|2787564_2788044_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|2788040_2788997_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168374.1|2788996_2789647_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|2789678_2790254_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|2790250_2790415_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000989177.1|2790678_2792301_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083343.1|2792285_2793023_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|2793153_2794488_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001526875.1|2794505_2795405_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188414.1|2795507_2796095_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|2796156_2796540_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|2796858_2797548_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|2797663_2798701_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
2806605:2806621	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 10
NZ_CP037882	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014875 chromosome, complete genome	4996832	2825510	2886211	4996832	tRNA,transposase,integrase	Escherichia_phage(50.0%)	48	2840730:2840744	2887800:2887814
WP_000469804.1|2825510_2826278_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|2826322_2826871_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|2826889_2827138_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|2827451_2828813_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|2828978_2829770_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127172650.1|2829789_2831076_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001287923.1|2831196_2831802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|2831836_2832427_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059155.1|2832549_2833428_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|2833513_2835175_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|2835323_2835662_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|2835827_2836118_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|2836107_2836584_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|2836733_2837216_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237668.1|2837829_2849304_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
2840730:2840744	attL	CGCGCGTGTCGAAGT	NA	NA	NA	NA
WP_000533858.1|2849368_2850778_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196159.1|2850774_2852955_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_010989057.1|2852962_2854126_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_001542208.1|2854726_2855791_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	62.5	1.6e-118
WP_001542209.1|2855804_2855972_+	hypothetical protein	NA	A0A1B5FPC6	Escherichia_phage	61.9	1.1e-07
WP_010989063.1|2856018_2856612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000248794.1|2857001_2858195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001161781.1|2858529_2859357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000701821.1|2859807_2860023_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001520307.1|2860058_2862128_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.1	1.7e-73
WP_001520831.1|2862548_2863832_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_010989064.1|2863876_2864695_+	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_010989065.1|2864848_2865205_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000749979.1|2865299_2865584_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.7	5.4e-18
WP_000480483.1|2865696_2866218_+	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000973738.1|2866214_2866589_+	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_001098984.1|2866585_2867566_+	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_001033832.1|2867576_2868590_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000889012.1|2868884_2870087_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000776032.1|2870160_2870796_-	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_031603456.1|2870819_2871383_-	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_000811366.1|2871382_2872225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000819716.1|2872354_2873896_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000021514.1|2874118_2875798_+	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|2876848_2877553_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001387387.1|2878512_2878914_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|2878960_2879665_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000480968.1|2879725_2880562_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|2880561_2881365_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_001043265.1|2881425_2882241_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000240536.1|2882548_2883400_-	replication protein	NA	NA	NA	NA	NA
WP_001067855.1|2884155_2884860_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000935452.1|2884906_2886211_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
2887800:2887814	attR	CGCGCGTGTCGAAGT	NA	NA	NA	NA
>prophage 11
NZ_CP037882	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014875 chromosome, complete genome	4996832	3359952	3401482	4996832	terminase,head,tRNA,capsid,tail,holin,portal,integrase	Cronobacter_phage(67.57%)	46	3355289:3355304	3398704:3398719
3355289:3355304	attL	ATGGCGGCGTAGCCAG	NA	NA	NA	NA
WP_001264394.1|3359952_3360966_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
WP_001144069.1|3361193_3361409_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918865.1|3361644_3363390_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001519776.1|3363539_3365387_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000237776.1|3365510_3366017_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000340945.1|3366340_3366643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001680744.1|3368011_3369712_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.4	9.9e-224
WP_000200789.1|3369714_3370260_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_000267957.1|3370231_3370957_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	53.5	3.7e-63
WP_000861353.1|3370946_3371501_-|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	89.0	2.7e-90
WP_000084307.1|3371513_3373748_-|tail	tail protein	tail	Q8HAB4	Salmonella_phage	73.7	7.2e-182
WP_001001828.1|3373757_3374345_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	3.8e-90
WP_000136921.1|3374337_3375522_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	6.7e-179
WP_001002797.1|3375518_3375848_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000811094.1|3375844_3377815_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.8	3.2e-274
WP_000411339.1|3378002_3378260_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_000376373.1|3378406_3378739_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	1.5e-35
WP_000175560.1|3378738_3379080_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_001154425.1|3379076_3379370_-|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000166743.1|3379379_3379835_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_000220203.1|3379831_3380959_-	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
WP_000560080.1|3380955_3381663_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.1	1.3e-100
WP_000084218.1|3381659_3382166_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.1	1.2e-63
WP_000447487.1|3382162_3382651_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	2.3e-64
WP_001218537.1|3382711_3383413_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
WP_000550495.1|3383416_3384439_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.5	3.9e-159
WP_000018800.1|3384500_3385304_-|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.0	2.0e-78
WP_001151939.1|3385464_3387240_+	hypothetical protein	NA	F1BUM5	Cronobacter_phage	83.1	9.8e-291
WP_000038213.1|3387236_3388298_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	76.8	6.7e-162
WP_001552031.1|3388294_3388618_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000353141.1|3388591_3388798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000170874.1|3388917_3390939_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.5	7.9e-297
WP_000279404.1|3390935_3391796_-	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	82.0	1.1e-130
WP_000551169.1|3391786_3392020_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000022786.1|3392087_3392489_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000996837.1|3392488_3392914_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
WP_000643375.1|3392903_3393131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460878.1|3393140_3393644_-	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_001247711.1|3393674_3393896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514631.1|3394039_3394621_+	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	37.2	1.2e-27
WP_000568372.1|3394637_3395204_+	hypothetical protein	NA	Q4ZA70	Staphylococcus_virus	32.8	1.3e-18
WP_001145219.1|3395207_3396245_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	63.9	1.5e-121
WP_000627044.1|3396234_3398016_+	ATP-binding protein	NA	X2KLG0	Campylobacter_phage	23.2	6.4e-08
WP_000213760.1|3398273_3399041_-	siderophore-interacting protein	NA	NA	NA	NA	NA
3398704:3398719	attR	CTGGCTACGCCGCCAT	NA	NA	NA	NA
WP_000983441.1|3399272_3399920_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_052895313.1|3399916_3401482_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.0e-12
>prophage 12
NZ_CP037882	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014875 chromosome, complete genome	4996832	4435930	4456350	4996832	plate,tail	Burkholderia_phage(45.0%)	26	NA	NA
WP_000587738.1|4435930_4436659_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|4436855_4437146_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|4437394_4437850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|4437846_4438452_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|4438456_4440202_-|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|4440204_4440837_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|4440829_4441945_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4441935_4442295_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|4442458_4444006_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|4444005_4444935_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|4444931_4445294_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4445621_4446344_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4446353_4447397_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4447384_4447594_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|4447593_4448547_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262499.1|4448546_4450901_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_001185654.1|4450997_4451126_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4451085_4451403_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4451454_4451979_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|4451978_4453406_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4453395_4453593_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4453589_4454045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|4454204_4454519_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|4454531_4455137_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|4455139_4455427_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4456002_4456350_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 13
NZ_CP037882	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014875 chromosome, complete genome	4996832	4482799	4526663	4996832	protease,terminase,plate,head,tRNA,capsid,tail,holin,portal,integrase	Shigella_phage(44.07%)	63	4473371:4473386	4534496:4534511
4473371:4473386	attL	GGCAGTTTTTGTCGCT	NA	NA	NA	NA
WP_000549966.1|4482799_4483234_+	hypothetical protein	NA	A0A0S2SYH1	Pseudomonas_phage	51.0	5.2e-36
WP_001093909.1|4483260_4483533_-	hypothetical protein	NA	S5MQM5	Escherichia_phage	86.7	5.9e-38
WP_001061343.1|4483569_4484142_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	96.8	3.7e-106
WP_000206745.1|4484141_4484951_-	hypothetical protein	NA	Q8HAA7	Salmonella_phage	61.8	3.3e-76
WP_001565177.1|4484950_4485313_-	phage protein	NA	U5P092	Shigella_phage	97.5	1.5e-65
WP_000008210.1|4485303_4485840_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	99.4	9.7e-101
WP_033567165.1|4485967_4486792_-	DUF2303 family protein	NA	U5P439	Shigella_phage	98.9	1.1e-148
WP_001323604.1|4486857_4487238_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	1.3e-62
WP_001514782.1|4487820_4488096_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	97.8	7.0e-47
WP_001369946.1|4488104_4488308_-	ClpX C4-type zinc finger	NA	A0A1C9IHZ4	Salmonella_phage	68.3	8.9e-15
WP_000848748.1|4488479_4489154_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649477.1|4489244_4489445_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000515829.1|4489488_4490046_+	protein YmfL	NA	S5FXP0	Shigella_phage	96.2	1.1e-96
WP_001250269.1|4490221_4490401_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104942.1|4490390_4491332_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.3	1.7e-140
WP_086936917.1|4491328_4491823_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	97.5	4.7e-86
WP_001433188.1|4491822_4492476_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	5.6e-127
WP_000210170.1|4492472_4492799_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_001398927.1|4492795_4493185_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A291AX14	Escherichia_phage	100.0	5.4e-69
WP_001061444.1|4493204_4494014_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_033567167.1|4494021_4495011_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	2.1e-194
WP_048306282.1|4495024_4495777_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	99.6	9.0e-145
WP_001624505.1|4495927_4496185_+	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_001283169.1|4496330_4496717_+	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_000422366.1|4496703_4496985_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001624504.1|4496984_4497599_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_001530346.1|4497595_4497988_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001379492.1|4498450_4498783_+	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001135098.1|4498833_4499184_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_048306293.1|4499309_4499795_+|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	98.8	6.1e-86
WP_000088161.1|4499808_4501542_+|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	100.0	0.0e+00
WP_000605606.1|4501553_4501736_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_001514795.1|4501735_4502977_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	5.0e-241
WP_021578635.1|4502954_4503605_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.1	3.6e-118
WP_021567480.1|4503619_4504825_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.5	3.5e-223
WP_021577001.1|4504874_4505102_+	hypothetical protein	NA	S5FNU1	Shigella_phage	94.9	2.2e-22
WP_000927719.1|4505076_4505400_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000702388.1|4505396_4505807_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	97.8	5.9e-74
WP_022630978.1|4505781_4506288_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	5.0e-91
WP_000779279.1|4506284_4506845_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	2.3e-105
WP_000497751.1|4506853_4507024_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_022630977.1|4507007_4508504_+|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	99.0	7.7e-273
WP_000090998.1|4508503_4508860_+	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_000661047.1|4508859_4509129_+|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_023200330.1|4509270_4511103_+|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.2	4.7e-304
WP_001439754.1|4511184_4511697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000219913.1|4511787_4513116_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	99.3	8.4e-247
WP_000999499.1|4513112_4514192_+|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.7	5.3e-207
WP_022630975.1|4514191_4514740_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	1.9e-96
WP_000424732.1|4514739_4515165_+	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_022630974.1|4515151_4516210_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.6	5.2e-199
WP_000383548.1|4516200_4516785_+	YmfQ family protein	NA	O22003	Shigella_phage	100.0	1.1e-113
WP_023200332.1|4516788_4518321_+	hypothetical protein	NA	A0A1B0VFW4	Salmonella_phage	97.9	1.6e-241
WP_006678265.1|4518290_4518908_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	100.0	5.7e-113
WP_001747940.1|4518911_4519319_-|tail	tail assembly chaperone	tail	A0A1B0V844	Salmonella_phage	100.0	4.9e-73
WP_006678262.1|4519320_4520049_-	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	100.0	2.8e-143
WP_000639149.1|4520374_4520938_+	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	79.1	3.4e-80
WP_033567204.1|4521081_4521330_-	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	98.8	2.0e-37
WP_000332264.1|4521391_4522489_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	100.0	4.3e-212
WP_022630972.1|4522577_4523615_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891414.1|4523782_4524025_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235551.1|4524199_4525183_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918353.1|4525247_4526663_+	replicative DNA helicase DnaB	NA	A0A1B0VG30	Salmonella_phage	78.4	7.0e-199
4534496:4534511	attR	AGCGACAAAAACTGCC	NA	NA	NA	NA
