The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040717	Aeromonas veronii strain HX3 chromosome, complete genome	4604603	64416	114315	4604603	integrase,protease,holin,transposase	Escherichia_phage(42.86%)	48	63918:63933	108342:108357
63918:63933	attL	ATGCCGAAGGGATTGG	NA	NA	NA	NA
WP_005337529.1|64416_64899_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_005350885.1|65197_65569_+	DUF413 domain-containing protein	NA	NA	NA	NA	NA
WP_157160498.1|65568_66441_+	HTH-type transcriptional regulator HdfR	NA	NA	NA	NA	NA
WP_157162317.1|66678_67554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005350888.1|67699_68890_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_157160499.1|68996_69500_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_005350890.1|69493_70012_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_157160500.1|69955_72241_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_157160501.1|72345_74109_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.7	1.7e-56
WP_157160502.1|74108_75104_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_040067763.1|75227_75416_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_021229372.1|75412_76162_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005337448.1|76374_77019_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_157160503.1|77146_79000_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_031227442.1|79199_79754_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_157160504.1|80508_81717_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	46.0	1.6e-90
WP_042056289.1|81960_82170_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_157160505.1|82180_82594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157160506.1|82608_83148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157160507.1|83299_83560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157160508.1|83683_85948_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	33.6	4.9e-69
WP_069526656.1|86486_86816_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_069526655.1|86858_87245_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_157160509.1|87264_87966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069526653.1|87977_88598_-	phosphate propanoyltransferase	NA	NA	NA	NA	NA
WP_069526652.1|88594_89047_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_042080494.1|89059_90046_-|holin	choline TMA-lyase-activating enzyme	holin	NA	NA	NA	NA
WP_157160510.1|90120_93507_-|holin	choline trimethylamine-lyase	holin	NA	NA	NA	NA
WP_157160511.1|93532_94687_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_042056263.1|94702_94960_-	EutN/CcmL family microcompartment protein	NA	NA	NA	NA	NA
WP_157160512.1|94986_96573_-	acetaldehyde dehydrogenase (acetylating)	NA	NA	NA	NA	NA
WP_002442217.1|96626_96905_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_042080492.1|96919_97204_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_010634659.1|97220_97499_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_157160513.1|98204_98720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157160514.1|98719_99529_-	winged helix family transcriptional regulator	NA	NA	NA	NA	NA
WP_042056255.1|99550_100123_-	TetR/AcrR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	31.9	1.9e-09
WP_042056253.1|100803_101601_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	50.8	1.7e-61
WP_069526645.1|101854_102763_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	72.3	1.4e-107
WP_099368881.1|103856_104873_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
WP_157160515.1|105454_107233_+	L-fucose isomerase	NA	NA	NA	NA	NA
WP_157160516.1|107299_108748_+	L-fuculokinase	NA	NA	NA	NA	NA
108342:108357	attR	ATGCCGAAGGGATTGG	NA	NA	NA	NA
WP_157160517.1|108744_109587_+	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_157160518.1|109596_110025_+	L-fucose mutarotase	NA	NA	NA	NA	NA
WP_157160519.1|110133_111282_+	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_157162318.1|111546_112386_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_157160520.1|112489_113023_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_076611586.1|113226_114315_+|transposase	IS3-like element ISAs22 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP040717	Aeromonas veronii strain HX3 chromosome, complete genome	4604603	285809	326930	4604603	integrase,protease,tRNA,transposase	Bacillus_phage(25.0%)	31	285375:285405	312359:312389
285375:285405	attL	GAGGGTTCGAATCCCTCCCTCACCGCCAAAT	NA	NA	NA	NA
WP_123174175.1|285809_286760_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_157160599.1|287044_288181_+|integrase	tyrosine-type recombinase/integrase	integrase	I6PDJ1	Cronobacter_phage	31.3	2.3e-19
WP_099368881.1|288683_289700_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
WP_157160600.1|289735_290356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157160601.1|290346_292056_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_157160602.1|292211_293204_+	AAA family ATPase	NA	A0A2P1CFH0	Microbacterium_phage	23.8	8.3e-05
WP_157160603.1|294014_295139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157162328.1|296920_297397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099368881.1|297504_298521_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
WP_157160604.1|298562_303089_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_157160605.1|303085_304507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080630556.1|304611_305055_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_157160606.1|306185_307181_+	DUF4917 family protein	NA	NA	NA	NA	NA
WP_157160607.1|307322_308345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011899269.1|308960_309593_-	tetracycline resistance transcriptional repressor TetR(E)	NA	NA	NA	NA	NA
WP_011899270.1|309673_310891_+	tetracycline efflux MFS transporter Tet(E)	NA	NA	NA	NA	NA
WP_012564931.1|311278_312226_+|transposase	IS30-like element ISAeca1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	1.0e-44
WP_157160608.1|312680_313403_-	virulence factor	NA	NA	NA	NA	NA
312359:312389	attR	GAGGGTTCGAATCCCTCCCTCACCGCCAAAT	NA	NA	NA	NA
WP_157160609.1|313414_315964_-	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_005337116.1|316117_316300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157160610.1|316354_317680_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.9	3.0e-18
WP_157160611.1|317701_318412_-	two-component system response regulator RstA	NA	W8CYM9	Bacillus_phage	31.4	2.9e-28
WP_100646092.1|319256_320111_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	32.9	4.6e-28
WP_005300025.1|320227_320446_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	63.2	1.2e-17
WP_005337111.1|320675_320993_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	49.4	1.4e-14
WP_005337110.1|321052_323308_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.0	2.7e-168
WP_005300033.1|323376_323595_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_088869181.1|323663_324380_-	arginyltransferase	NA	NA	NA	NA	NA
WP_019445527.1|324376_325084_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_058059142.1|325103_325574_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_157160612.1|325682_326930_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.2	1.1e-14
>prophage 3
NZ_CP040717	Aeromonas veronii strain HX3 chromosome, complete genome	4604603	380393	439690	4604603	protease,transposase	Klosneuvirus(23.08%)	42	NA	NA
WP_157160634.1|380393_381422_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_157162329.1|382892_383006_-	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
WP_157160635.1|383021_383294_-	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
WP_157160636.1|383410_383596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157160637.1|384284_384578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012564931.1|384993_385941_+|transposase	IS30-like element ISAeca1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	1.0e-44
WP_157160638.1|388423_389251_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	42.6	9.6e-15
WP_157160639.1|389302_390067_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.8	1.9e-25
WP_157160640.1|390388_391759_+	protein kinase	NA	NA	NA	NA	NA
WP_157160641.1|392042_392690_+	thiopurine S-methyltransferase	NA	NA	NA	NA	NA
WP_157160642.1|393022_395809_-	insulinase family protein	NA	A0A1V0SJA4	Klosneuvirus	26.9	5.6e-91
WP_139444192.1|395971_396439_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_005336998.1|396572_396779_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_157160643.1|396943_397861_+	EamA family transporter	NA	NA	NA	NA	NA
WP_157160644.1|397964_399581_-	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_005336993.1|399963_400998_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	46.2	1.6e-75
WP_157162330.1|401239_404716_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_005336991.1|404762_405338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005345085.1|405414_406650_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_157160645.1|406654_407446_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
WP_005336986.1|407445_408687_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_088869144.1|408775_409366_-	5'-deoxynucleotidase	NA	NA	NA	NA	NA
WP_005336982.1|409458_409893_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_005345092.1|410334_411645_+	trigger factor	NA	NA	NA	NA	NA
WP_085942156.1|411752_412355_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	60.9	2.9e-61
WP_005336977.1|412425_413700_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.5	2.5e-131
WP_005336976.1|413841_416196_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	53.5	6.1e-224
WP_005315375.1|416436_416709_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	61.8	5.0e-21
WP_139442734.1|416862_418773_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_005333398.1|419397_420033_-	sugar transferase	NA	NA	NA	NA	NA
WP_157160646.1|420029_421223_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_157160647.1|421254_422394_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_157160648.1|422596_423680_+|transposase	IS3-like element ISAs22 family transposase	transposase	NA	NA	NA	NA
WP_124929590.1|423750_425166_+	chain-length determining protein	NA	NA	NA	NA	NA
WP_157160649.1|426914_428294_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	31.7	5.7e-28
WP_157160650.1|428582_429134_+	cytochrome b	NA	NA	NA	NA	NA
WP_005360033.1|429577_431041_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.0	8.2e-94
WP_019445882.1|431125_432715_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_042081150.1|433094_433367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157160651.1|435633_436125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157160652.1|436140_437172_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_157160653.1|438528_439690_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	49.0	2.8e-76
>prophage 4
NZ_CP040717	Aeromonas veronii strain HX3 chromosome, complete genome	4604603	1015823	1089225	4604603	integrase,transposase	Bacillus_virus(25.0%)	57	1071409:1071439	1091314:1091344
WP_157160932.1|1015823_1017027_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	70.1	1.3e-113
WP_157162348.1|1017637_1018012_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	47.1	1.0e-08
WP_019446121.1|1017924_1018362_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005333618.1|1018871_1021154_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.8	1.8e-164
WP_005333620.1|1021200_1022049_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_157160933.1|1022430_1024191_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_157160934.1|1024384_1025818_-	family 1 glycosylhydrolase	NA	A0A0B5JD41	Pandoravirus	29.3	2.7e-49
WP_157160935.1|1025984_1026848_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157160936.1|1026884_1027634_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_157160937.1|1027810_1030075_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_157160938.1|1030352_1031261_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157160939.1|1031267_1032203_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_111900615.1|1032395_1033133_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_157160940.1|1033192_1034092_+	pirin family protein	NA	NA	NA	NA	NA
WP_157160941.1|1034088_1035357_+	MFS transporter	NA	NA	NA	NA	NA
WP_123172907.1|1035457_1036360_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157160942.1|1036484_1037375_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157160943.1|1037476_1038115_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_157160944.1|1038168_1038417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157160945.1|1038559_1039603_+	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_157160946.1|1039736_1040900_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_157160947.1|1041009_1042671_-	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	28.3	3.6e-45
WP_005333639.1|1042769_1043048_-	YfcL family protein	NA	NA	NA	NA	NA
WP_157160948.1|1043147_1044263_-	ATP-NAD kinase	NA	NA	NA	NA	NA
WP_005333641.1|1044383_1045121_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	52.5	8.5e-47
WP_005333642.1|1045215_1045704_-	OmpA family protein	NA	NA	NA	NA	NA
WP_157160949.1|1045739_1046969_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	32.3	8.4e-15
WP_005333646.1|1046965_1047523_-	YfiR family protein	NA	NA	NA	NA	NA
WP_005333656.1|1047712_1049260_-	transcriptional regulator TyrR	NA	NA	NA	NA	NA
WP_005352635.1|1049558_1049897_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_157160950.1|1049960_1050755_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_157160951.1|1050908_1052339_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_157160952.1|1052368_1053196_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005346227.1|1053231_1054200_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_157160953.1|1054196_1055210_-	ATP-binding cassette domain-containing protein	NA	Q6GZ03	Mycoplasma_phage	38.5	6.0e-27
WP_115521822.1|1055353_1056499_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005346246.1|1056696_1057620_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157160954.1|1057810_1058842_-	TIGR01620 family protein	NA	NA	NA	NA	NA
WP_157160955.1|1058893_1060315_-	YcjX family protein	NA	NA	NA	NA	NA
WP_157160956.1|1060474_1060894_-	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_042022412.1|1060875_1061112_-	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_042022411.1|1061115_1061802_-	phage shock protein PspA	NA	NA	NA	NA	NA
WP_157160957.1|1061998_1063027_+	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_085942140.1|1063165_1064731_+	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
WP_005333676.1|1064733_1065693_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005333677.1|1065728_1066622_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005333679.1|1066621_1067620_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	27.7	7.3e-09
WP_005333681.1|1067654_1068440_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.8	4.8e-16
WP_058058711.1|1068545_1070459_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.2	1.3e-115
WP_005352677.1|1070624_1071227_-	recombination protein RecR	NA	NA	NA	NA	NA
1071409:1071439	attL	ATTTGGCGGTGAGGGAGGGATTCGAACCCTC	NA	NA	NA	NA
WP_157160958.1|1073253_1075218_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	35.6	8.1e-20
WP_026141181.1|1077515_1078496_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.0e-186
WP_081250366.1|1079933_1082090_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	37.6	6.8e-20
WP_157160959.1|1082412_1083426_-	AAA family ATPase	NA	A0A2P1CFH0	Microbacterium_phage	22.5	3.8e-05
WP_157160634.1|1084423_1085452_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_157160960.1|1086916_1087879_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_081250368.1|1088016_1089225_-|integrase	site-specific integrase	integrase	A0A2H4JGM5	uncultured_Caudovirales_phage	32.4	1.3e-36
1091314:1091344	attR	ATTTGGCGGTGAGGGAGGGATTCGAACCCTC	NA	NA	NA	NA
>prophage 5
NZ_CP040717	Aeromonas veronii strain HX3 chromosome, complete genome	4604603	2544555	2555204	4604603		Bacillus_phage(16.67%)	8	NA	NA
WP_019446511.1|2544555_2545224_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.3	6.7e-27
WP_157161538.1|2545220_2546450_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005340088.1|2546602_2547499_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.3	7.9e-39
WP_157162404.1|2547730_2551426_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	80.3	9.5e-22
WP_021231596.1|2551642_2552920_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	39.8	7.1e-41
WP_005340085.1|2553426_2553603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042081371.1|2553756_2554254_-	GNAT family N-acetyltransferase	NA	G9BWD5	Planktothrix_phage	27.7	3.7e-06
WP_005357745.1|2554382_2555204_-	HDOD domain-containing protein	NA	A0A1C3NFB0	Phage_NCTB	24.0	4.6e-09
>prophage 6
NZ_CP040717	Aeromonas veronii strain HX3 chromosome, complete genome	4604603	3313428	3367512	4604603	capsid,bacteriocin,integrase,protease,transposase	Enterobacteria_phage(12.5%)	55	3339571:3339586	3356862:3356877
WP_157161803.1|3313428_3314649_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	45.5	2.4e-91
WP_157161804.1|3314874_3315084_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_157161805.1|3315096_3315615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157161806.1|3316032_3316200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157161807.1|3316196_3316355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088869463.1|3316351_3316612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157161808.1|3316755_3317112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157162423.1|3317111_3319931_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.0	9.7e-67
WP_088869465.1|3321375_3321615_+|bacteriocin	bacteriocin	bacteriocin	A0A1I9KFI4	Aeromonas_phage	60.0	7.2e-16
WP_157161809.1|3322797_3323421_-	peptidase	NA	NA	NA	NA	NA
WP_157161810.1|3324086_3325124_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_110303977.1|3325347_3326259_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_042053465.1|3326518_3327985_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_012564931.1|3328386_3329334_+|transposase	IS30-like element ISAeca1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	1.0e-44
WP_081394768.1|3329511_3330390_-	EamA family transporter	NA	NA	NA	NA	NA
WP_157161811.1|3330423_3331344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157161812.1|3331464_3332520_-	porin	NA	NA	NA	NA	NA
WP_005336386.1|3332741_3333752_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_005336384.1|3333886_3334138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100646922.1|3334208_3335372_-	heme biosynthesis protein HemY	NA	NA	NA	NA	NA
WP_076495577.1|3335382_3336432_-	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
WP_157161813.1|3336428_3337163_-	uroporphyrinogen III synthase	NA	NA	NA	NA	NA
WP_157162424.1|3337159_3338089_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_157161814.1|3338412_3340932_+	class I adenylate cyclase	NA	NA	NA	NA	NA
3339571:3339586	attL	CTGCTGGAAGCCCTGA	NA	NA	NA	NA
WP_157161815.1|3340998_3341652_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_069554181.1|3341648_3341963_-	iron donor protein CyaY	NA	NA	NA	NA	NA
WP_019444858.1|3342036_3342213_+	lipoprotein	NA	NA	NA	NA	NA
WP_075115816.1|3342245_3343496_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_005336371.1|3343660_3344491_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_085942101.1|3344613_3345264_+	DUF484 family protein	NA	NA	NA	NA	NA
WP_157161816.1|3345256_3346234_+	tyrosine recombinase XerC	NA	A0A142F2H8	Mycobacterium_phage	33.3	3.9e-15
WP_157161817.1|3346266_3346977_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_157161818.1|3347053_3347452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157161819.1|3347497_3349024_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_040069030.1|3349169_3349553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157161820.1|3349565_3350348_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_031227939.1|3350744_3351290_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_157161821.1|3351498_3352794_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_157161822.1|3353042_3353729_-	KilA-N domain-containing protein	NA	NA	NA	NA	NA
WP_157161823.1|3353933_3355697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157161824.1|3355809_3356280_-	ribonuclease HI	NA	A0A2I7RL06	Vibrio_phage	36.3	2.7e-14
WP_157161825.1|3356276_3356477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157161826.1|3356473_3356689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157161827.1|3356745_3357249_-	hypothetical protein	NA	NA	NA	NA	NA
3356862:3356877	attR	TCAGGGCTTCCAGCAG	NA	NA	NA	NA
WP_157161828.1|3357365_3357950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157161829.1|3357949_3358168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157161830.1|3358373_3359459_-|capsid	capsid protein	capsid	A0A076YM75	Mesorhizobium_phage	30.8	1.7e-27
WP_157161831.1|3360046_3360283_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_114522673.1|3362303_3362873_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	40.7	2.7e-32
WP_024944628.1|3362886_3363099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157161832.1|3363293_3363980_-	antirestriction protein ArdA	NA	NA	NA	NA	NA
WP_005343746.1|3364402_3365032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157161833.1|3365329_3365539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157161834.1|3365535_3366090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058057516.1|3366168_3367512_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 7
NZ_CP040717	Aeromonas veronii strain HX3 chromosome, complete genome	4604603	3578195	3584505	4604603		Bacillus_thuringiensis_phage(100.0%)	6	NA	NA
WP_157161904.1|3578195_3580262_+	GNAT family N-acetyltransferase	NA	Q56AQ2	Bacillus_thuringiensis_phage	92.7	2.3e-97
WP_157161905.1|3580248_3580968_-	SDR family NAD(P)-dependent oxidoreductase	NA	Q56AQ6	Bacillus_thuringiensis_phage	96.7	7.1e-131
WP_157161906.1|3581169_3582186_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	99.4	5.0e-191
WP_157161907.1|3582361_3582841_+	hypothetical protein	NA	Q56AR5	Bacillus_thuringiensis_phage	97.4	1.1e-36
WP_157161908.1|3582858_3583473_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	97.1	8.7e-114
WP_157161909.1|3583557_3584505_-	hypothetical protein	NA	Q56AS0	Bacillus_thuringiensis_phage	100.0	2.8e-18
>prophage 8
NZ_CP040717	Aeromonas veronii strain HX3 chromosome, complete genome	4604603	3904118	3913337	4604603		Staphylococcus_phage(50.0%)	8	NA	NA
WP_157162049.1|3904118_3906944_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	30.9	4.7e-45
WP_100646668.1|3906996_3907281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005338884.1|3907605_3908859_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.2	3.9e-100
WP_005338880.1|3909009_3909459_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_157162050.1|3909658_3910768_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	34.7	4.0e-48
WP_047438140.1|3910823_3911477_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	37.8	1.2e-20
WP_005358461.1|3911626_3912736_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.2	2.7e-65
WP_005338866.1|3912866_3913337_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.3	5.1e-29
>prophage 9
NZ_CP040717	Aeromonas veronii strain HX3 chromosome, complete genome	4604603	4359969	4408048	4604603	integrase,transposase	Escherichia_phage(15.38%)	27	4353259:4353318	4408029:4408375
4353259:4353318	attL	CTCGCGAATTCAACTTCGAAGTGCAATTCCCGATTAAAAATCAGGCTGCTTTCAGAAGTT	NA	NA	NA	NA
WP_024941042.1|4359969_4360941_+|integrase	integron integrase	integrase	NA	NA	NA	NA
WP_024941043.1|4361237_4362218_+|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	97.5	9.8e-184
WP_024941045.1|4362926_4365986_-	DEAD/DEAH box helicase	NA	S4W0U8	Pandoravirus	37.2	1.9e-07
WP_024941046.1|4365986_4368047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024941047.1|4368043_4368811_-	OmpA family protein	NA	NA	NA	NA	NA
WP_024941048.1|4368810_4370871_-	anti-phage defense ZorAB system ZorA	NA	NA	NA	NA	NA
WP_024941049.1|4371044_4371758_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_024941050.1|4371757_4374889_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	28.1	1.4e-53
WP_024941051.1|4374963_4376028_-	macro domain-containing protein	NA	A0A2I7QNM6	Vibrio_phage	40.5	2.2e-24
WP_157162233.1|4376896_4378192_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	31.9	5.9e-43
WP_157162234.1|4378191_4380639_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	36.9	5.8e-76
WP_043852095.1|4380824_4381271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024941055.1|4381417_4381606_-	DUF3283 family protein	NA	NA	NA	NA	NA
WP_024941056.1|4381722_4382166_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	49.6	3.3e-30
WP_024941057.1|4382146_4383406_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	52.5	1.6e-117
WP_041204583.1|4384230_4385589_-|integrase	site-specific integrase	integrase	B7SYF8	Stenotrophomonas_phage	25.0	2.5e-12
WP_157162235.1|4385834_4387031_-	ROK family protein	NA	NA	NA	NA	NA
WP_157162236.1|4387150_4390429_+	DUF5107 domain-containing protein	NA	NA	NA	NA	NA
WP_120415720.1|4390510_4391962_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_157162237.1|4391958_4392816_+	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_157162238.1|4392911_4397078_-	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_100653330.1|4397609_4398821_-	EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_012564931.1|4403316_4404264_-|transposase	IS30-like element ISAeca1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	1.0e-44
WP_099368881.1|4404746_4405763_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
WP_157162239.1|4405767_4406544_-	hypothetical protein	NA	A0A0H3UZD5	Geobacillus_virus	30.0	2.6e-14
WP_157162240.1|4406676_4407033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012564931.1|4407100_4408048_+|transposase	IS30-like element ISAeca1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	1.0e-44
4408029:4408375	attR	AACTTCTGAAAGCAGCCTGATTTTTAATCGGGAATTGCACTTCGAAGTTGAATTCGCGAGTACATTGCTTCGCAATTTCCCTGTTTGGCTGCTTTGCGTAACCACATAATGGCTTGCTGAATATTCTTTGCTACTCCACGTCCCTTCATATAGCACTCGCAAAGCGAGAGTTGGGCATCGGCATTCCCTTGTTCGGCTGCTTGGTGGAAGCCAGCTGCGGCTTTGCGGTACAAGTCGTTAGCTTTGGTTTTATCTTCTTGCACACCGCAGAAGCCAACGGAGTGAAAAAAAGCGAGTTTATACATTGCATCGGGATTGCCTAGTTCAGCGGCTTTGCGATACAAAAT	NA	NA	NA	NA
