The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046612	Klebsiella pneumoniae strain WCGKP294 chromosome, complete genome	5540574	658877	713903	5540574	portal,tRNA,head,plate,integrase,tail,lysis,capsid,terminase	Salmonella_phage(73.33%)	67	653667:653683	719123:719139
653667:653683	attL	CCGGTGCCGGTGGTGAA	NA	NA	NA	NA
WP_108569137.1|658877_662120_-	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.9	6.6e-35
WP_004900721.1|662124_662739_-	acid-sensing system DNA-binding response regulator EvgA	NA	NA	NA	NA	NA
WP_071531177.1|663091_663406_+	HdeB family protein	NA	NA	NA	NA	NA
WP_023159083.1|663474_663747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004174266.1|664367_665453_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	61.3	2.4e-122
WP_004174268.1|665452_665704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094641609.1|665706_666321_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	41.0	2.3e-37
WP_004174272.1|666421_666658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094641611.1|666692_667202_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	84.0	2.7e-76
WP_004174277.1|667209_667410_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	87.7	1.5e-27
WP_004174279.1|667373_667715_+	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	86.7	1.1e-49
WP_024623053.1|667782_668016_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	92.2	3.5e-31
WP_020324003.1|668015_668243_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	89.3	1.2e-33
WP_094641613.1|668239_669127_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	70.7	5.9e-111
WP_157190370.1|669107_671513_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	89.0	0.0e+00
WP_004144689.1|671699_671888_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	98.4	7.9e-26
WP_004185723.1|671901_672135_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	85.7	2.0e-31
WP_109026930.1|672210_672468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080864088.1|672496_672715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032413908.1|672733_673708_+	hypothetical protein	NA	A4PE73	Ralstonia_virus	42.5	4.7e-53
WP_032413905.1|673707_674046_+	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_157190371.1|674091_675123_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.5	3.9e-175
WP_004185719.1|675122_676886_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	93.0	0.0e+00
WP_065954042.1|677026_677860_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	76.5	8.0e-102
WP_157190372.1|677876_678941_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	94.3	9.6e-185
WP_071056821.1|678944_679595_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	87.0	4.3e-103
WP_065954043.1|679691_680156_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	86.4	1.3e-74
WP_002896155.1|680155_680359_+|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_064189013.1|680362_680578_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	87.3	1.5e-28
WP_065954044.1|680558_681068_+	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.8e-81
WP_157190373.1|681072_681456_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	44.5	1.6e-17
WP_020323995.1|681452_681881_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	79.4	7.3e-51
WP_071056830.1|681976_682408_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	3.4e-64
WP_047666939.1|682400_682847_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	73.6	2.3e-55
WP_004185696.1|682915_683488_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.8	1.2e-77
WP_004174325.1|683484_683847_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	9.9e-49
WP_065954047.1|683833_684742_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.6	2.9e-105
WP_077270109.1|684734_685424_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	60.5	5.8e-58
WP_157190374.1|685430_688028_+	hypothetical protein	NA	A0A248XD04	Klebsiella_phage	85.5	0.0e+00
WP_157190375.1|688032_689133_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	86.2	1.3e-176
WP_065954049.1|689159_690236_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	44.2	6.2e-30
WP_047666934.1|690374_691547_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.5e-210
WP_002896201.1|691556_692072_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_004144716.1|692124_692424_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	80.0	1.6e-33
WP_002896220.1|692438_692558_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_094641635.1|692550_695178_+|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	39.5	9.8e-122
WP_004185683.1|695174_695660_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	77.6	4.1e-58
WP_157190376.1|695656_696754_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	84.9	9.3e-175
WP_004174338.1|696824_697043_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_002917636.1|697378_697885_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_004174339.1|697984_699826_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_004149864.1|700044_701790_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
WP_157190377.1|701901_702117_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_004900709.1|702354_703368_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	1.4e-108
WP_032434617.1|703412_705020_-	allantoin permease	NA	NA	NA	NA	NA
WP_002916877.1|705173_705791_-	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_009484814.1|705799_706474_-	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_002916875.1|706475_706952_-	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_002916874.1|706961_708665_-	urease subunit alpha	NA	NA	NA	NA	NA
WP_002916872.1|708657_708978_-	urease subunit beta	NA	NA	NA	NA	NA
WP_002916871.1|708987_709290_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_004174349.1|709299_710124_-	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_004144529.1|710113_710260_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
WP_032434618.1|710521_711139_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_004150923.1|711246_711630_+	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_004144532.1|711828_712650_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_002916864.1|712661_713903_-|tRNA	multifunctional CCA tRNA nucleotidyl transferase/2'3'-cyclic phosphodiesterase/2'nucleotidase/phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	50.1	5.2e-89
719123:719139	attR	CCGGTGCCGGTGGTGAA	NA	NA	NA	NA
>prophage 2
NZ_CP046612	Klebsiella pneumoniae strain WCGKP294 chromosome, complete genome	5540574	1241541	1291189	5540574	portal,tRNA,head,plate,integrase,tail,lysis,capsid,terminase,transposase	Salmonella_phage(78.57%)	60	1246754:1246800	1279815:1279861
WP_077254121.1|1241541_1242396_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	55.8	5.2e-80
WP_019705923.1|1242392_1242677_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_063719795.1|1242830_1245338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032434751.1|1245366_1246560_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	47.6	1.0e-102
1246754:1246800	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_157190382.1|1246917_1247943_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S6L016	Salmonella_phage	94.7	4.4e-195
WP_157190383.1|1247944_1248577_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	91.9	6.2e-107
WP_032436472.1|1248696_1248939_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	2.3e-38
WP_157190384.1|1248971_1249481_+	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	86.4	1.3e-78
WP_032444702.1|1249488_1249689_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	87.7	1.2e-27
WP_004174279.1|1249652_1249994_+	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	86.7	1.1e-49
WP_032414758.1|1250061_1250295_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	93.5	1.6e-31
WP_032414750.1|1250294_1250522_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	88.0	1.2e-33
WP_115698549.1|1250518_1251406_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	70.4	2.9e-110
WP_157190385.1|1251386_1253792_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	88.7	0.0e+00
WP_004185723.1|1254179_1254413_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	85.7	2.0e-31
WP_109026930.1|1254488_1254746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080864088.1|1254774_1254993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032413908.1|1255011_1255986_+	hypothetical protein	NA	A4PE73	Ralstonia_virus	42.5	4.7e-53
WP_032413905.1|1255985_1256324_+	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_157190371.1|1256368_1257400_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.5	3.9e-175
WP_004185719.1|1257399_1259163_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	93.0	0.0e+00
WP_065954042.1|1259303_1260137_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	76.5	8.0e-102
WP_157190372.1|1260153_1261218_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	94.3	9.6e-185
WP_065954043.1|1261967_1262432_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	86.4	1.3e-74
WP_002896155.1|1262431_1262635_+|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_064189013.1|1262638_1262854_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	87.3	1.5e-28
WP_065954044.1|1262834_1263344_+	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.8e-81
WP_065954045.1|1263348_1263732_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	44.5	1.2e-17
WP_020323995.1|1263728_1264157_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	79.4	7.3e-51
WP_071056830.1|1264252_1264684_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	3.4e-64
WP_047666939.1|1264676_1265123_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	73.6	2.3e-55
WP_004185696.1|1265191_1265764_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.8	1.2e-77
WP_004174325.1|1265760_1266123_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	9.9e-49
WP_065954047.1|1266109_1267018_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.6	2.9e-105
WP_077270109.1|1267010_1267700_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	60.5	5.8e-58
WP_157190374.1|1267706_1270304_+	hypothetical protein	NA	A0A248XD04	Klebsiella_phage	85.5	0.0e+00
WP_157190386.1|1270308_1271409_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	86.2	7.6e-177
WP_065954049.1|1271435_1272512_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	44.2	6.2e-30
WP_040025408.1|1272650_1273823_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.5e-210
WP_002896201.1|1273832_1274348_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_004144716.1|1274400_1274700_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	80.0	1.6e-33
WP_002896220.1|1274714_1274834_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_157190387.1|1274826_1277454_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.5	9.5e-125
WP_004185683.1|1277450_1277936_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	77.6	4.1e-58
WP_157190388.1|1277932_1279030_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	84.2	1.0e-173
WP_022631378.1|1279096_1279315_+	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	72.2	1.1e-26
WP_157190389.1|1279342_1279720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|1280323_1280806_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1279815:1279861	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_015875096.1|1280916_1281393_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_004145682.1|1281382_1281673_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1281739_1282081_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_004174799.1|1282228_1283890_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1283976_1284855_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|1284979_1285570_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|1285689_1286976_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1286995_1287787_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1287950_1289315_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1289574_1289823_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1289841_1290390_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|1290421_1291189_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP046612	Klebsiella pneumoniae strain WCGKP294 chromosome, complete genome	5540574	1329615	1374895	5540574	terminase,integrase,tail,coat	Enterobacteria_phage(20.93%)	54	1328333:1328346	1334813:1334826
1328333:1328346	attL	CAGCGCCAGCATGG	NA	NA	NA	NA
WP_088912436.1|1329615_1330845_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	96.1	3.0e-238
WP_023301228.1|1330822_1331098_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	72.7	9.2e-31
WP_157190390.1|1331136_1331376_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	70.5	9.4e-24
WP_088912437.1|1331383_1331692_-	hypothetical protein	NA	I6PD68	Cronobacter_phage	56.9	4.2e-24
WP_157190391.1|1331688_1332387_-	morphogenetic protein	NA	H2BDG4	Pseudomonas_virus	49.1	1.9e-48
WP_023286270.1|1332421_1333510_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	56.2	3.7e-107
WP_157190392.1|1333522_1336618_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	58.8	5.6e-302
1334813:1334826	attR	CCATGCTGGCGCTG	NA	NA	NA	NA
WP_023282477.1|1336755_1336911_-	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	71.2	2.0e-14
WP_004179600.1|1336919_1337111_-	YebW family protein	NA	NA	NA	NA	NA
WP_157190484.1|1337217_1337316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043875424.1|1337503_1337917_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023341332.1|1338028_1338259_+	hypothetical protein	NA	H6WRX5	Salmonella_phage	45.3	2.1e-12
WP_064145493.1|1338261_1338798_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	67.8	7.0e-59
WP_125337258.1|1338809_1339070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117114257.1|1339144_1340062_+	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	65.8	1.1e-99
WP_065519994.1|1340058_1340802_+	Replication protein P	NA	A0A0K2FIT1	Enterobacteria_phage	59.8	3.1e-73
WP_016946299.1|1340794_1341130_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	4.4e-11
WP_157190393.1|1341122_1341908_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.7	1.1e-65
WP_020804603.1|1341904_1342108_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	84.8	3.8e-26
WP_020804604.1|1342100_1342355_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	50.6	1.4e-09
WP_023286281.1|1342351_1342573_+	hypothetical protein	NA	A9YWV3	Burkholderia_phage	49.4	2.2e-11
WP_157190394.1|1343306_1343531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157190395.1|1343586_1344030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157190396.1|1344102_1344360_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	75.3	1.7e-26
WP_004184503.1|1344940_1345174_+	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	68.8	2.9e-25
WP_087812871.1|1345584_1346184_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	79.4	1.3e-90
WP_157190397.1|1346392_1346689_+	DUF1364 family protein	NA	A0A0U2KD41	Escherichia_phage	71.9	2.1e-36
WP_023282412.1|1346685_1347042_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	64.1	1.5e-41
WP_023287514.1|1347157_1347979_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	67.5	1.1e-98
WP_004146526.1|1348725_1348974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004146527.1|1348976_1349507_+	lysozyme	NA	G9L6J6	Escherichia_phage	79.7	5.4e-80
WP_112162547.1|1349503_1349893_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	50.0	3.1e-24
WP_073545918.1|1350375_1350612_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	62.8	3.8e-17
WP_157190398.1|1350862_1351861_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	3.7e-37
WP_114268018.1|1351838_1353143_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.8	5.7e-147
WP_157190399.1|1353147_1354572_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	71.1	9.8e-193
WP_064179049.1|1354555_1355668_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	53.4	2.4e-109
WP_043906932.1|1355844_1356084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048271641.1|1356202_1356967_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	62.2	1.3e-79
WP_157190400.1|1357054_1358191_+|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	74.3	2.2e-155
WP_095348077.1|1358240_1358552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048271645.1|1358555_1358966_+	hypothetical protein	NA	A0A0H5AUF0	Pseudomonas_phage	38.2	6.6e-09
WP_129485871.1|1358967_1359351_+	glutamate 5-kinase	NA	A0A0S2SYG4	Pseudomonas_phage	44.4	6.0e-20
WP_086624782.1|1359352_1359904_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	41.5	1.7e-28
WP_044245111.1|1359900_1360299_+	electron transfer flavoprotein subunit beta	NA	A0A059VK45	Pseudomonas_phage	33.6	1.3e-12
WP_029602985.1|1360322_1361495_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.3	3.2e-24
WP_023341360.1|1361549_1362032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123235785.1|1362169_1362367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157190401.1|1362896_1366538_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	29.2	5.2e-81
WP_029602980.1|1366537_1367002_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	68.4	3.9e-58
WP_080835620.1|1367182_1367665_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	95.6	8.2e-83
WP_004190616.1|1367674_1368055_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	77.0	1.5e-55
WP_157190402.1|1368051_1371114_+	kinase	NA	A0A286S259	Klebsiella_phage	94.3	0.0e+00
WP_157190403.1|1373797_1374895_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	87.1	3.6e-179
>prophage 4
NZ_CP046612	Klebsiella pneumoniae strain WCGKP294 chromosome, complete genome	5540574	1564656	1662581	5540574	portal,protease,tRNA,head,plate,capsid,integrase,tail,holin,terminase	Salmonella_phage(16.67%)	100	1599865:1599889	1639827:1639851
WP_025368032.1|1564656_1566006_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_025368033.1|1566002_1566692_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_032434868.1|1566691_1568368_+	OmpA family protein	NA	NA	NA	NA	NA
WP_108569126.1|1568370_1568862_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_107318634.1|1569092_1569257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032434870.1|1569282_1571640_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_071994657.1|1571649_1572192_+	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
WP_032425140.1|1572265_1572736_+	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
WP_077254137.1|1573078_1575481_+	glycoside hydrolase family 104 protein	NA	NA	NA	NA	NA
WP_032434872.1|1575477_1575921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071886200.1|1576081_1576462_+	DUF4087 domain-containing protein	NA	NA	NA	NA	NA
WP_123618670.1|1576933_1577362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025368039.1|1577578_1577878_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_032435675.1|1577940_1578204_+	PAAR domain-containing protein	NA	R9U4D0	Rhizobium_phage	50.0	1.2e-06
WP_032425487.1|1578206_1579415_+	membrane protein	NA	NA	NA	NA	NA
WP_032434874.1|1579407_1582779_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_153582916.1|1582781_1582931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032434876.1|1583271_1584879_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_025368043.1|1584912_1586682_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_032425136.1|1586645_1587728_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_032425135.1|1587763_1588288_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_077267874.1|1588292_1590614_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.0	2.7e-14
WP_050484908.1|1590610_1591114_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	40.0	1.5e-18
WP_023317120.1|1591107_1591452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086472102.1|1591484_1592222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049107563.1|1592464_1592947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032434878.1|1594830_1595715_+	glycine zipper family protein	NA	NA	NA	NA	NA
WP_050598595.1|1595704_1596262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071838925.1|1596769_1597168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123618669.1|1597956_1598406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050598596.1|1598402_1598936_+	hypothetical protein	NA	NA	NA	NA	NA
1599865:1599889	attL	TTATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
WP_032432293.1|1600083_1601253_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	85.8	9.5e-202
WP_072200997.1|1601262_1601745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077253737.1|1601809_1601995_-	hypothetical protein	NA	G3CFG7	Escherichia_phage	61.1	2.0e-13
WP_032432295.1|1602002_1602668_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	66.7	5.1e-51
WP_048267938.1|1602668_1602923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157190485.1|1602915_1603140_-	hypothetical protein	NA	S4TVX5	Salmonella_phage	53.8	1.3e-14
WP_048267937.1|1603454_1604315_-	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	53.4	2.8e-73
WP_048333912.1|1604396_1605209_-	DUF2303 family protein	NA	NA	NA	NA	NA
WP_004104278.1|1605252_1605612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004104276.1|1606533_1607244_-	LexA family transcriptional regulator	NA	K7P8B2	Enterobacteria_phage	67.5	4.0e-86
WP_004104275.1|1607351_1607546_+	hypothetical protein	NA	K7PLQ6	Enterobacteria_phage	79.4	3.6e-21
WP_032420709.1|1607623_1608139_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	64.0	3.0e-59
WP_025711394.1|1608177_1608456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064365512.1|1608617_1608893_+	hypothetical protein	NA	A0A1P8VVT6	Streptococcus_phage	42.3	8.7e-05
WP_032432308.1|1608885_1610415_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	67.1	2.3e-203
WP_038806620.1|1610411_1611383_+	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	61.6	3.9e-108
WP_050484678.1|1611352_1611997_+	NinG family protein	NA	A0A1W6JNX3	Morganella_phage	54.3	1.9e-39
WP_113851553.1|1611993_1612635_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	69.4	5.8e-84
WP_085808060.1|1612631_1613210_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.1	1.6e-48
WP_113851554.1|1613361_1613601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294159.1|1613760_1614147_+	membrane protein	NA	A0A192Y8P2	Salmonella_phage	90.6	1.6e-57
WP_000243811.1|1614133_1614415_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	48.4	4.8e-19
WP_157190408.1|1614414_1615044_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	89.9	7.6e-105
WP_032434896.1|1615051_1615327_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	66.3	1.9e-23
WP_040221880.1|1615830_1616031_+	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	75.0	2.6e-19
WP_116973094.1|1616428_1616674_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	64.2	1.2e-18
WP_116973095.1|1616735_1617086_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	80.7	1.3e-50
WP_004884285.1|1617449_1617944_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	92.0	1.2e-81
WP_004899643.1|1617940_1619671_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	83.2	4.6e-301
WP_004899640.1|1619865_1621095_+|portal	phage portal protein	portal	U5P411	Shigella_phage	81.5	1.7e-201
WP_004884313.1|1621081_1621735_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	87.4	2.1e-105
WP_040186336.1|1621749_1622958_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	84.2	1.7e-193
WP_023302596.1|1622996_1623200_+	hypothetical protein	NA	M1FN89	Enterobacteria_phage	42.4	2.3e-07
WP_021313626.1|1623196_1623517_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	43.1	4.8e-15
WP_032442226.1|1623525_1623864_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	72.3	1.6e-40
WP_019705270.1|1623860_1624310_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	6.7e-63
WP_016530186.1|1624306_1624654_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
WP_023313062.1|1624710_1625415_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.9	5.5e-80
WP_021313622.1|1625445_1625850_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	57.7	8.5e-33
WP_004177139.1|1625852_1626158_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
WP_016530182.1|1626231_1626465_+	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
WP_157190409.1|1626525_1629915_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.4	8.9e-301
WP_004884312.1|1629935_1630409_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.7	1.1e-55
WP_004864228.1|1630395_1630872_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	65.8	4.8e-51
WP_040181864.1|1630884_1631265_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	81.0	2.5e-58
WP_157190410.1|1631261_1634339_+	kinase	NA	A0A286S259	Klebsiella_phage	62.3	0.0e+00
WP_157190411.1|1637023_1638118_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	86.8	2.4e-178
WP_157190412.1|1638152_1639241_-	acyltransferase family protein	NA	C6ZR20	Salmonella_phage	27.2	5.3e-05
WP_004149224.1|1639939_1640869_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	81.4	6.7e-134
1639827:1639851	attR	TTATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
WP_002913362.1|1641158_1641920_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_004149222.1|1641981_1643310_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_002913359.1|1643677_1643962_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_032434923.1|1644121_1645432_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_032434925.1|1645431_1647576_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_002913355.1|1647785_1648271_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_002913348.1|1648291_1648843_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_002913346.1|1649010_1649943_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_002913342.1|1649984_1651070_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	4.5e-89
WP_004174960.1|1651072_1651897_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_002913340.1|1651896_1652706_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_002913339.1|1652705_1653254_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_002913338.1|1653285_1653567_+	YfcL family protein	NA	NA	NA	NA	NA
WP_032435686.1|1653628_1655617_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_002913291.1|1655775_1656996_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_004149211.1|1657205_1658381_+	MFS transporter	NA	NA	NA	NA	NA
WP_023282884.1|1658467_1659445_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_002913228.1|1659555_1660692_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.8	1.6e-20
WP_002913227.1|1660755_1661769_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_015958766.1|1661768_1662581_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP046612	Klebsiella pneumoniae strain WCGKP294 chromosome, complete genome	5540574	1861503	1868408	5540574	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004180551.1|1861503_1862367_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004899467.1|1862377_1863151_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_002912636.1|1863391_1864285_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1864530_1865892_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|1866210_1866933_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_032434977.1|1866929_1868408_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 6
NZ_CP046612	Klebsiella pneumoniae strain WCGKP294 chromosome, complete genome	5540574	2139466	2211253	5540574	coat,head,plate,integrase,terminase	Salmonella_phage(20.0%)	82	2137231:2137249	2155497:2155515
2137231:2137249	attL	CGCCAGCGTCCTGGCGGCG	NA	NA	NA	NA
WP_004175494.1|2139466_2140762_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	9.6e-62
WP_032435061.1|2140776_2141583_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_048289163.1|2141823_2143086_-|integrase	site-specific integrase	integrase	A0A286S1S8	Klebsiella_phage	94.3	7.3e-232
WP_019725112.1|2143133_2143376_-	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	81.3	2.0e-29
WP_025269983.1|2143594_2143786_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	62.7	6.0e-13
WP_157190419.1|2143782_2144505_-	hypothetical protein	NA	R9VWB9	Serratia_phage	65.7	1.7e-87
WP_049195669.1|2144501_2144726_-	hypothetical protein	NA	G8C7U9	Escherichia_phage	71.8	1.0e-19
WP_049195670.1|2144722_2144995_-	hypothetical protein	NA	Q716F1	Shigella_phage	63.5	1.4e-23
WP_157190420.1|2145208_2146285_-	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	69.7	3.9e-149
WP_157190421.1|2146281_2146938_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	86.6	1.5e-111
WP_004178787.1|2146934_2147363_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	81.0	7.5e-64
WP_101968260.1|2147359_2148040_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	92.0	1.9e-122
WP_157190422.1|2148036_2148882_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	58.8	2.6e-68
WP_076996993.1|2148897_2149182_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	78.7	2.5e-39
WP_004151303.1|2149270_2149465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064146419.1|2149892_2150093_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	73.4	7.6e-19
WP_064146421.1|2150138_2150975_-	hypothetical protein	NA	A0A0R6PIN1	Moraxella_phage	29.5	4.6e-25
WP_004197930.1|2150937_2151117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024622727.1|2151238_2151928_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	70.6	1.0e-86
WP_004178811.1|2152032_2152266_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	70.4	3.0e-22
WP_004141720.1|2152305_2152626_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	68.9	3.8e-36
WP_115723346.1|2152712_2153510_+	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	72.8	4.6e-91
WP_032428219.1|2153569_2154535_+	replication protein	NA	K7PGZ0	Enterobacteria_phage	79.3	1.8e-65
WP_019704107.1|2154531_2155269_+	Replication protein 14	NA	A0A0K2FIT1	Enterobacteria_phage	55.6	3.1e-65
WP_004218528.1|2155265_2155568_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
2155497:2155515	attR	CGCCAGCGTCCTGGCGGCG	NA	NA	NA	NA
WP_157190423.1|2155564_2156125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147016091.1|2156121_2156328_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	95.6	4.0e-31
WP_157190424.1|2156324_2156897_+	ead/Ea22-like family protein	NA	NA	NA	NA	NA
WP_032428632.1|2157069_2157357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085858706.1|2157356_2157614_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	75.3	1.1e-25
WP_074385044.1|2157623_2158112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016831925.1|2158201_2158798_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	54.3	2.1e-56
WP_032413853.1|2158803_2158974_+	NinE family protein	NA	G8C7V4	Escherichia_phage	71.4	2.8e-14
WP_104447027.1|2158966_2159605_+	hypothetical protein	NA	H6WRY9	Salmonella_phage	68.9	9.2e-74
WP_157190425.1|2159601_2160243_+	HNH endonuclease	NA	A0A2I7QND8	Vibrio_phage	45.5	1.0e-40
WP_157190426.1|2160239_2160383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117099949.1|2160379_2161069_+	antiterminator	NA	I6PDF8	Cronobacter_phage	56.7	1.2e-63
WP_004146347.1|2162734_2163049_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	6.3e-44
WP_040181191.1|2163051_2163555_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	78.4	5.0e-75
WP_114466339.1|2163551_2163902_+	hypothetical protein	NA	H2EQH5	Salmonella_phage	39.8	9.3e-12
WP_009483899.1|2164383_2164899_+	hypothetical protein	NA	A0A0H5AUE2	Pseudomonas_phage	61.9	1.5e-50
WP_032431561.1|2164898_2166371_+|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.7	5.9e-249
WP_157190427.1|2166383_2167853_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.8	3.7e-150
WP_157190428.1|2167779_2168787_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	68.5	3.8e-114
WP_029503697.1|2168881_2169085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157190429.1|2169182_2170568_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	64.5	9.0e-167
WP_004178846.1|2170571_2171003_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.1	1.4e-41
WP_157190430.1|2171014_2172112_+|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	73.3	1.2e-150
WP_157190431.1|2172121_2172397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157190432.1|2172399_2172783_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	77.2	6.1e-49
WP_132468086.1|2172948_2173266_+	hypothetical protein	NA	G8GWD9	Rhodobacter_phage	61.4	7.3e-32
WP_055323024.1|2173276_2173639_+	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	49.2	2.5e-20
WP_032431569.1|2173641_2174010_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	83.6	1.0e-48
WP_157190433.1|2174006_2174390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004191525.1|2175280_2175994_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	54.6	9.6e-64
WP_004191522.1|2176209_2176740_+	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	85.7	7.6e-82
WP_029503690.1|2176784_2177069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004191520.1|2177158_2177737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004191518.1|2177772_2178102_+	hypothetical protein	NA	A0A222YZ97	Escherichia_phage	53.3	3.2e-22
WP_040027506.1|2178144_2180751_+	tape measure protein	NA	A0A1B1W284	Salmonella_phage	38.9	1.1e-91
WP_157190434.1|2181328_2181742_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.0	3.1e-22
WP_157190435.1|2182121_2183129_+	hypothetical protein	NA	R9TR21	Aeromonas_phage	49.8	1.7e-61
WP_157190436.1|2183257_2183587_+	hypothetical protein	NA	R9TR21	Aeromonas_phage	53.6	2.2e-15
WP_157190437.1|2183688_2183997_+	hypothetical protein	NA	F1C5A7	Cronobacter_phage	54.4	3.7e-12
WP_157190438.1|2186789_2187329_+	hypothetical protein	NA	A0A248XD04	Klebsiella_phage	91.1	5.0e-89
WP_119918696.1|2187334_2188429_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	86.3	1.2e-177
WP_002910657.1|2189816_2190299_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_002910654.1|2190489_2191188_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_004899028.1|2191213_2191798_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910650.1|2191867_2192197_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_032435063.1|2192764_2194105_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_032435065.1|2194101_2194755_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_032435067.1|2194758_2196456_+	OmpA family protein	NA	NA	NA	NA	NA
WP_032435069.1|2196914_2199542_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	31.8	4.1e-19
WP_071994648.1|2199544_2201572_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JIA8	uncultured_Caudovirales_phage	30.2	2.7e-71
WP_153517862.1|2201586_2202483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032435072.1|2202975_2203383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004899008.1|2203408_2203666_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_032435074.1|2203670_2204882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032435076.1|2205346_2208310_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_032435080.1|2208443_2210207_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004184605.1|2210206_2211253_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 7
NZ_CP046612	Klebsiella pneumoniae strain WCGKP294 chromosome, complete genome	5540574	2784487	2790093	5540574	coat	Enterobacteria_phage(83.33%)	6	NA	NA
WP_017898686.1|2784487_2784715_+|coat	major coat protein	coat	D0U160	Enterobacteria_phage	58.7	3.2e-13
WP_157190445.1|2784788_2786075_+	attachment protein	NA	A7BJW8	Enterobacteria_phage	59.2	1.7e-103
WP_157190446.1|2786077_2786419_+|coat	phage coat protein	coat	A7BJW9	Enterobacteria_phage	58.0	4.1e-28
WP_074676257.1|2786418_2787483_+	assembly protein	NA	A7BJY0	Enterobacteria_phage	65.8	5.5e-132
WP_126676310.1|2787463_2788750_+	general secretion pathway protein GspD	NA	J7HXF0	Enterobacteria_phage	53.8	9.1e-121
WP_032435326.1|2789319_2790093_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.6	1.2e-22
>prophage 8
NZ_CP046612	Klebsiella pneumoniae strain WCGKP294 chromosome, complete genome	5540574	2891495	2902382	5540574		Escherichia_phage(87.5%)	9	NA	NA
WP_020805006.1|2891495_2894603_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004176258.1|2894657_2895923_+	MFS transporter	NA	NA	NA	NA	NA
WP_020805010.1|2895953_2897042_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	1.8e-210
WP_004176262.1|2897128_2897389_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_004179754.1|2897686_2898547_+	class A beta-lactamase SHV-28	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
WP_002210513.1|2898567_2899329_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|2899589_2900492_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004190239.1|2900503_2901769_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	3.9e-233
WP_002210516.1|2901761_2902382_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 9
NZ_CP046612	Klebsiella pneumoniae strain WCGKP294 chromosome, complete genome	5540574	3276376	3364827	5540574	portal,tRNA,protease,head,integrase,tail,holin,capsid,terminase	Salmonella_phage(22.41%)	99	3303191:3303205	3362638:3362652
WP_023316736.1|3276376_3276877_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|3276993_3277440_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901073.1|3277423_3278215_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004148041.1|3278316_3279501_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140471.1|3279532_3280225_-	CTP synthase	NA	NA	NA	NA	NA
WP_004176547.1|3280370_3280880_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004150779.1|3280866_3281223_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004176548.1|3281212_3281452_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004176549.1|3281752_3282766_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
WP_004150782.1|3282823_3282925_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004213093.1|3282924_3282999_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|3283116_3283242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|3283301_3283565_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_157190451.1|3283695_3284334_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|3284423_3285338_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150784.1|3285999_3287043_-	type II asparaginase	NA	NA	NA	NA	NA
WP_032435408.1|3287345_3288554_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_032435409.1|3288627_3290412_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004140497.1|3291428_3292937_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_032435410.1|3293247_3293934_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_153233540.1|3294384_3294573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|3294551_3295184_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140506.1|3295750_3295948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140509.1|3296063_3297074_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004140511.1|3297070_3298477_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004140512.1|3298532_3299420_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140514.1|3299436_3299943_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004148027.1|3299969_3300464_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150795.1|3300554_3300740_-	general stress protein	NA	NA	NA	NA	NA
WP_004176552.1|3301361_3302555_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_050598602.1|3302667_3302847_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
3303191:3303205	attL	TGGCTGGCGTTCTTT	NA	NA	NA	NA
WP_032435412.1|3303344_3303668_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004150798.1|3303660_3304053_+	amino acid-binding protein	NA	NA	NA	NA	NA
WP_032435413.1|3304049_3304763_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004892953.1|3305035_3305188_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_023284988.1|3305366_3305738_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.9	8.3e-27
WP_004194318.1|3306011_3307496_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.1	1.1e-29
WP_001333465.1|3308502_3308925_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	2.8e-26
WP_115657879.1|3309870_3310965_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	86.5	4.0e-178
WP_104459845.1|3313648_3316726_-	kinase	NA	A0A286S259	Klebsiella_phage	62.2	0.0e+00
WP_040181864.1|3316722_3317103_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	81.0	2.5e-58
WP_104459844.1|3317115_3317592_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	65.2	1.1e-50
WP_104459843.1|3317578_3318052_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	61.4	1.6e-54
WP_104459842.1|3318072_3321654_-|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	59.5	1.7e-246
WP_004177136.1|3321716_3322238_-	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	45.2	1.7e-09
WP_023302602.1|3322312_3322618_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
WP_064164389.1|3322620_3323025_-|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	50.4	6.3e-28
WP_060853953.1|3323055_3323508_-	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	70.5	4.7e-56
WP_072274543.1|3323567_3323915_-	DUF3168 domain-containing protein	NA	K7PM93	Enterobacterial_phage	56.6	8.3e-29
WP_064164390.1|3323911_3324361_-	hypothetical protein	NA	Q9MCS9	Enterobacteria_phage	79.9	2.2e-61
WP_060853955.1|3324357_3324696_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	63.4	4.0e-36
WP_060853956.1|3324708_3325035_-|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TSQ3	Salmonella_phage	60.2	1.5e-27
WP_104459840.1|3325031_3326252_-|portal	phage portal protein	portal	S4TNN1	Salmonella_phage	56.5	2.5e-59
WP_048290411.1|3326248_3327598_-|portal	phage portal protein	portal	S4TTG7	Salmonella_phage	75.9	9.3e-201
WP_060853946.1|3327803_3329738_-|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	93.5	0.0e+00
WP_064164394.1|3329796_3331455_-|terminase	terminase large subunit	terminase	Q3HQS7	Burkholderia_phage	70.4	1.3e-236
WP_104459839.1|3331458_3331968_-|terminase	terminase small subunit	terminase	S4TNN3	Salmonella_phage	68.0	1.6e-52
WP_048290404.1|3332147_3332516_-	HNH endonuclease	NA	S4TTG9	Salmonella_phage	79.8	1.8e-50
WP_088661504.1|3332508_3333096_-	hypothetical protein	NA	S4TR53	Salmonella_phage	65.3	2.6e-75
WP_088661503.1|3333256_3334714_-	glycosyltransferase	NA	K7PKP3	Enterobacterial_phage	87.2	1.8e-258
WP_104459838.1|3334717_3335059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064081467.1|3335175_3335376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104459837.1|3335374_3336034_+	DUF4145 domain-containing protein	NA	V5URE2	Shigella_phage	47.7	1.8e-56
WP_017880217.1|3336096_3336342_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	54.3	1.8e-14
WP_104459836.1|3336803_3337079_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	37.1	1.3e-05
WP_088661499.1|3337081_3337711_-	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	79.2	1.3e-91
WP_008806056.1|3337710_3337992_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	73.1	1.3e-32
WP_141437253.1|3337978_3338374_-	hypothetical protein	NA	G8C7V8	Escherichia_phage	72.3	3.2e-45
WP_117255262.1|3339138_3339294_-	DUF3927 domain-containing protein	NA	A0A0A0YRI9	Escherichia_phage	70.8	1.9e-09
WP_032695796.1|3339290_3339716_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	83.7	7.2e-59
WP_088661496.1|3340201_3341251_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	76.7	8.1e-168
WP_020805698.1|3341400_3341592_-	hypothetical protein	NA	Q8SBE3	Shigella_phage	81.0	1.6e-21
WP_060598778.1|3341801_3342632_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	46.9	2.2e-59
WP_115657882.1|3342650_3343637_-	DUF968 domain-containing protein	NA	Q8SBE5	Shigella_phage	49.2	4.0e-92
WP_050418595.1|3343718_3344540_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	65.4	4.0e-90
WP_023343179.1|3344629_3345028_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	70.6	3.6e-44
WP_104459834.1|3345024_3345501_-|protease	SOS-response repressor and protease LexA	protease	U5P451	Shigella_phage	60.3	4.2e-15
WP_104459833.1|3345497_3347468_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	56.4	3.9e-208
WP_104459832.1|3347460_3348843_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	48.4	6.8e-106
WP_088661490.1|3348830_3349289_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_048290376.1|3349285_3350197_-	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	74.5	2.6e-53
WP_023322342.1|3350186_3350366_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	67.3	5.6e-13
WP_064081445.1|3350538_3351090_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	69.4	3.8e-68
WP_023343174.1|3351134_3351335_-	hypothetical protein	NA	U5P445	Shigella_phage	80.0	4.3e-22
WP_032429029.1|3351422_3352082_+	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	87.2	1.2e-113
WP_060853925.1|3352400_3352859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094326300.1|3353784_3354156_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	80.5	8.3e-51
WP_104459831.1|3354208_3355039_+	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	81.7	4.6e-126
WP_104459848.1|3355174_3355702_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	70.3	3.5e-63
WP_048290365.1|3355701_3355902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048290363.1|3355894_3356680_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.5	1.6e-64
WP_157190452.1|3357272_3357935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025714619.1|3359047_3359266_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	53.4	3.5e-09
WP_000089156.1|3359566_3359803_+	excisionase	NA	NA	NA	NA	NA
WP_048290353.1|3359792_3360935_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	82.5	6.9e-173
WP_004150800.1|3361047_3362298_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_004150801.1|3362538_3363189_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
3362638:3362652	attR	AAAGAACGCCAGCCA	NA	NA	NA	NA
WP_004150802.1|3363205_3363664_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150803.1|3363720_3364827_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP046612	Klebsiella pneumoniae strain WCGKP294 chromosome, complete genome	5540574	3627268	3636742	5540574	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_004209699.1|3627268_3628990_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3629034_3629736_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3630089_3630308_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3630438_3632718_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3632748_3633066_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3633391_3633613_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_025368306.1|3633689_3635630_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.0	5.0e-38
WP_002896440.1|3635626_3636742_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 11
NZ_CP046612	Klebsiella pneumoniae strain WCGKP294 chromosome, complete genome	5540574	4119579	4169681	5540574	tRNA,coat,head,integrase,terminase	Cronobacter_phage(20.75%)	68	4120241:4120257	4176896:4176912
WP_032431582.1|4119579_4119897_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.0	5.3e-22
WP_032431581.1|4119896_4120136_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	48.1	6.1e-15
WP_157190462.1|4120214_4121699_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.1	1.1e-29
4120241:4120257	attL	GTCTGGCGGTGAACCGC	NA	NA	NA	NA
WP_032431580.1|4122568_4123663_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	87.4	3.6e-179
WP_157190463.1|4123667_4124843_-	hypothetical protein	NA	A0A248XD04	Klebsiella_phage	93.6	5.4e-221
WP_157190464.1|4124846_4125320_-	hypothetical protein	NA	A0A248XD04	Klebsiella_phage	91.6	9.5e-76
WP_117048175.1|4126393_4128871_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.3	2.0e-196
WP_157190465.1|4128857_4129253_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	55.6	1.6e-36
WP_004178860.1|4129249_4129720_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.4	9.6e-28
WP_077257725.1|4129719_4130139_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.5	8.2e-31
WP_157190466.1|4130238_4132845_-	tape measure protein	NA	A0A1B1W284	Salmonella_phage	38.8	4.0e-91
WP_004191518.1|4132887_4133217_-	hypothetical protein	NA	A0A222YZ97	Escherichia_phage	53.3	3.2e-22
WP_004191520.1|4133252_4133831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117048179.1|4133920_4134205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191522.1|4134249_4134780_-	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	85.7	7.6e-82
WP_157190467.1|4134960_4135665_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	54.6	9.5e-64
WP_157190433.1|4136555_4136939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032431569.1|4136935_4137304_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	83.6	1.0e-48
WP_055323024.1|4137306_4137669_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	49.2	2.5e-20
WP_132468086.1|4137679_4137997_-	hypothetical protein	NA	G8GWD9	Rhodobacter_phage	61.4	7.3e-32
WP_157190432.1|4138162_4138546_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	77.2	6.1e-49
WP_157190431.1|4138548_4138824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157190430.1|4138833_4139931_-|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	73.3	1.2e-150
WP_004178846.1|4139942_4140374_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.1	1.4e-41
WP_157190429.1|4140377_4141763_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	64.5	9.0e-167
WP_029503697.1|4141860_4142064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157190428.1|4142158_4143166_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	68.5	3.8e-114
WP_157190427.1|4143092_4144562_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.8	3.7e-150
WP_032431561.1|4144574_4146047_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.7	5.9e-249
WP_009483899.1|4146046_4146562_-	hypothetical protein	NA	A0A0H5AUE2	Pseudomonas_phage	61.9	1.5e-50
WP_114466339.1|4147043_4147394_-	hypothetical protein	NA	H2EQH5	Salmonella_phage	39.8	9.3e-12
WP_040181191.1|4147390_4147894_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	78.4	5.0e-75
WP_004146347.1|4147896_4148211_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	6.3e-44
WP_117099949.1|4149876_4150566_-	antiterminator	NA	I6PDF8	Cronobacter_phage	56.7	1.2e-63
WP_157190426.1|4150562_4150706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157190425.1|4150702_4151344_-	HNH endonuclease	NA	A0A2I7QND8	Vibrio_phage	45.5	1.0e-40
WP_104447027.1|4151340_4151979_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	68.9	9.2e-74
WP_032413853.1|4151971_4152142_-	NinE family protein	NA	G8C7V4	Escherichia_phage	71.4	2.8e-14
WP_016831925.1|4152147_4152744_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	54.3	2.1e-56
WP_074385044.1|4152833_4153322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085858706.1|4153331_4153589_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	75.3	1.1e-25
WP_032428632.1|4153588_4153876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157190468.1|4154048_4154597_-	ead/Ea22-like family protein	NA	A0A2H4FRZ0	Salmonella_phage	57.4	5.9e-29
WP_110138984.1|4154607_4155360_-	hypothetical protein	NA	M1FN76	Enterobacteria_phage	85.2	5.8e-128
WP_157190469.1|4155356_4155866_-	hypothetical protein	NA	A0A2H4N7F5	Pectobacterium_phage	73.5	6.5e-22
WP_117114239.1|4155862_4156165_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_040239947.1|4156164_4156941_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	65.0	8.8e-95
WP_004178815.1|4156937_4157666_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.0	7.8e-37
WP_065520217.1|4157799_4158021_-	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_062628060.1|4158060_4158288_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	78.6	6.2e-25
WP_157190490.1|4158399_4159098_+	helix-turn-helix domain-containing protein	NA	Q76H56	Enterobacteria_phage	83.6	6.2e-108
WP_014837632.1|4159120_4159240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077265302.1|4159438_4160266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058843000.1|4160262_4161072_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_157190470.1|4161117_4161309_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	67.2	3.4e-16
WP_087783474.1|4161746_4161941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157190471.1|4162029_4162314_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	75.5	3.6e-38
WP_065907833.1|4162329_4163175_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.5e-68
WP_004223153.1|4163171_4163852_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	92.9	2.3e-123
WP_157190491.1|4163848_4164277_+	regulator	NA	M9NYX4	Enterobacteria_phage	79.6	2.2e-63
WP_157190472.1|4164273_4164930_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	6.0e-113
WP_004146321.1|4164926_4165145_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	2.1e-09
WP_040245581.1|4165146_4165362_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	51.4	2.0e-12
WP_004151317.1|4165363_4165699_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_157190473.1|4165575_4166739_+|integrase	tyrosine-type recombinase/integrase	integrase	G8C7S0	Escherichia_phage	86.6	2.1e-201
WP_004143017.1|4167169_4168036_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_004143016.1|4168037_4168250_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_020803895.1|4168295_4169681_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
4176896:4176912	attR	GCGGTTCACCGCCAGAC	NA	NA	NA	NA
>prophage 1
NZ_CP046613	Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-1, complete sequence	237090	3161	84424	237090	transposase	Escherichia_phage(20.0%)	58	NA	NA
WP_001067855.1|3161_3866_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_048337402.1|4772_5225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181742.1|6136_6349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118062.1|6442_6721_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_000427614.1|7067_8072_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_040238778.1|8475_9486_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_085808088.1|9723_10806_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	96.1	3.4e-185
WP_042948535.1|10913_13973_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	95.8	0.0e+00
WP_046654864.1|14024_15278_+	lactose permease	NA	NA	NA	NA	NA
WP_003846919.1|15334_15505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032435793.1|16669_16996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118106.1|17076_17973_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016151338.1|18137_19214_-	dihydroorotase	NA	NA	NA	NA	NA
WP_004118110.1|19210_20467_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_004118113.1|20503_21445_-	dihydroorotate dehydrogenase	NA	A0A1V0SH91	Hokovirus	32.6	3.6e-18
WP_016151336.1|21437_22286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118116.1|22650_23907_+	MFS transporter	NA	NA	NA	NA	NA
WP_004118118.1|24119_25385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019441.1|25753_26734_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
WP_074424053.1|26933_27902_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	97.5	1.5e-181
WP_072096758.1|27945_28227_+	copper homeostasis periplasmic binding protein CopC	NA	NA	NA	NA	NA
WP_004118092.1|28323_28584_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_064142075.1|28640_30704_-	TonB-dependent copper receptor	NA	NA	NA	NA	NA
WP_015065566.1|30786_31206_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_000427614.1|31566_32571_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_071527925.1|32868_33111_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_017146588.1|33441_33735_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.9	1.8e-48
WP_004152282.1|33833_34601_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_004118246.1|34601_35558_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_004118243.1|35554_36553_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_004118241.1|36549_37452_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_065810017.1|37496_39821_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_040238740.1|39907_40861_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_001572456.1|40857_41379_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_157190492.1|42610_43687_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_071527922.1|44732_44903_-	galactoside O-acetyltransferase	NA	NA	NA	NA	NA
WP_060591595.1|44969_46214_-	lactose permease	NA	NA	NA	NA	NA
WP_060591598.1|46265_49340_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.5	0.0e+00
WP_040238691.1|49461_50544_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	97.8	1.9e-188
WP_017900939.1|51273_51678_+	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
WP_025999313.1|51953_52436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372130.1|55373_55553_-	hypothetical protein	NA	A0A1B2IAL0	Erwinia_phage	60.7	6.8e-11
WP_017901324.1|57438_58461_+|transposase	IS21-like element ISSen3 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	85.0	2.1e-173
WP_032437422.1|58457_59240_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.9	2.7e-136
WP_017901323.1|59970_62178_+	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_017901322.1|62180_64757_+	EstP	NA	NA	NA	NA	NA
WP_001261275.1|65009_65240_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017901321.1|65236_65662_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_032437465.1|65724_66648_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.5	1.1e-165
WP_049257520.1|67640_69212_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	31.9	4.2e-19
WP_077252861.1|69303_69417_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	81.1	3.6e-10
WP_032430764.1|72256_74122_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_032430763.1|74325_75882_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	3.4e-106
WP_032430762.1|75878_77048_+	restriction endonuclease subunit S	NA	E3T4D5	Cafeteria_roenbergensis_virus	28.7	1.2e-07
WP_032430798.1|77061_78381_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_049257514.1|78373_81487_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	23.8	3.5e-25
WP_048322237.1|81548_81764_-	hypothetical protein	NA	J9Q747	Salmonella_phage	73.6	3.8e-16
WP_001567368.1|83020_84424_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP046613	Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-1, complete sequence	237090	91615	143111	237090	transposase,protease	Stx2-converting_phage(35.29%)	44	NA	NA
WP_101987924.1|91615_92899_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_049125651.1|93022_93826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001118645.1|94918_95842_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.2	1.0e-166
WP_049256935.1|95878_96328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064106742.1|98222_99032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032440835.1|100127_100535_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	40.2	3.1e-14
WP_017900880.1|101275_102085_-	N-formylglutamate deformylase	NA	NA	NA	NA	NA
WP_017900879.1|102077_103286_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_017900878.1|103297_104692_-	cytosine permease	NA	NA	NA	NA	NA
WP_017900877.1|104745_106422_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_017900876.1|106929_108027_+	ATP-binding cassette domain-containing protein	NA	Q6GZ03	Mycoplasma_phage	37.9	7.7e-12
WP_017900875.1|108023_108668_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014228066.1|108670_109351_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017900874.1|109381_110257_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017900873.1|110267_111800_+	aromatic amino acid lyase	NA	NA	NA	NA	NA
WP_017900872.1|111833_112391_-	HutD family protein	NA	NA	NA	NA	NA
WP_017900871.1|112387_113149_-	histidine utilization repressor	NA	NA	NA	NA	NA
WP_017900870.1|113251_114619_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_017900868.1|115792_116059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048337397.1|116207_117131_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.0	1.4e-176
WP_017901337.1|117176_117590_-	hypothetical protein	NA	A0A222YY57	Escherichia_phage	46.3	1.1e-19
WP_011251286.1|117659_118079_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011251285.1|118075_118387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118218.1|119142_119520_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	92.1	7.1e-58
WP_032430752.1|119516_119864_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	7.7e-59
WP_017901237.1|119912_121451_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	92.8	4.1e-277
WP_012569499.1|122215_123196_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_017901242.1|123264_124230_-	DMT family transporter	NA	NA	NA	NA	NA
WP_017901243.1|124226_125045_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	8.8e-29
WP_017901244.1|125049_125712_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_017901245.1|125708_126380_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004118155.1|126403_127252_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_020481021.1|127408_128362_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.0	1.7e-10
WP_017901247.1|128448_129660_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_048322246.1|129998_130922_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.4	6.9e-171
WP_017901409.1|131271_131532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072096747.1|131720_132689_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	8.5e-180
WP_032435794.1|132690_133641_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.2	8.1e-167
WP_004144067.1|133772_134243_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_023287184.1|134239_134683_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_065810015.1|137520_138444_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.5	3.9e-166
WP_000612626.1|140662_141010_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_064761963.1|141006_141348_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	98.2	3.2e-57
WP_017901367.1|142148_143111_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP046613	Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-1, complete sequence	237090	176711	236373	237090	transposase,integrase	Escherichia_phage(52.17%)	46	183828:183843	208928:208943
WP_048337404.1|176711_177635_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.4	7.3e-173
WP_049015454.1|178209_179307_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	42.9	1.5e-60
WP_032430783.1|180885_181902_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_017900948.1|183140_183677_+	hypothetical protein	NA	NA	NA	NA	NA
183828:183843	attL	TGTTCGAAGGCCTCCG	NA	NA	NA	NA
WP_001067855.1|183971_184676_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032488413.1|184812_185673_+	class A extended-spectrum beta-lactamase SHV-2a	NA	A0A077SL40	Escherichia_phage	99.7	7.6e-156
WP_002210513.1|185693_186455_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|186716_187619_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_001067855.1|189265_189970_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032488413.1|190106_190967_+	class A extended-spectrum beta-lactamase SHV-2a	NA	A0A077SL40	Escherichia_phage	99.7	7.6e-156
WP_002210513.1|190987_191749_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|192010_192913_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_001067855.1|194559_195264_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032488413.1|195400_196261_+	class A extended-spectrum beta-lactamase SHV-2a	NA	A0A077SL40	Escherichia_phage	99.7	7.6e-156
WP_002210513.1|196281_197043_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|197304_198207_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_016946353.1|200696_201764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016946352.1|201849_202104_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_004194318.1|202619_204104_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.1	1.1e-29
WP_017901102.1|204189_205326_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004213829.1|205391_205709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197568.1|205860_206184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181760.1|206180_206939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014386528.1|206935_207895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017901101.1|207937_208345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017901100.1|208354_208798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003031967.1|210061_211030_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	29.1	2.8e-13
208928:208943	attR	TGTTCGAAGGCCTCCG	NA	NA	NA	NA
WP_025999344.1|212393_213131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017901253.1|213210_213693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072096726.1|213774_214887_+	tellurite resistance domain protein	NA	NA	NA	NA	NA
WP_023288354.1|214936_216385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157190494.1|216402_219471_+	virulence factor SrfB	NA	NA	NA	NA	NA
WP_017901257.1|219470_222185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017901258.1|222178_223198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017901259.1|223194_225162_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017901260.1|225161_225887_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.8	3.1e-17
WP_025999345.1|225876_227091_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017901262.1|227141_228710_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_065810019.1|228745_229249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032747566.1|229308_229764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065810020.1|229857_231450_-|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.2	1.4e-174
WP_017901265.1|231480_231831_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.9	3.4e-38
WP_004189163.1|231827_232268_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	2.6e-19
WP_004902307.1|232464_232647_+	DUF4113 domain-containing protein	NA	A0A1W6JNT0	Morganella_phage	57.1	9.1e-11
WP_004117790.1|234235_235207_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
WP_017900945.1|235206_236373_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	96.9	2.2e-222
>prophage 1
NZ_CP046614	Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-2, complete sequence	230910	97657	151988	230910	integrase,transposase	Salmonella_phage(38.46%)	56	127533:127547	149113:149127
WP_023287126.1|97657_98581_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.1	1.2e-172
WP_017900715.1|98758_98962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839965.1|99037_99574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017900716.1|100268_100613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024266240.1|101770_102868_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	42.2	1.3e-59
WP_157190496.1|103990_104821_-	NgrC	NA	A0A219UQS0	Bacillus_phage	34.0	4.2e-10
WP_023287126.1|104845_105769_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.1	1.2e-172
WP_157190507.1|105805_106273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017900712.1|107346_107640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025999287.1|107673_108255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839966.1|108643_109513_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_014839967.1|109566_109887_+	hypothetical protein	NA	J9Q750	Salmonella_phage	53.8	8.2e-31
WP_014839968.1|110568_110772_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	64.2	2.8e-16
WP_025999286.1|110814_111426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839969.1|111490_111736_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	65.8	6.1e-18
WP_062878103.1|111882_112071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017900706.1|112063_112798_+	hypothetical protein	NA	A0A1V0E5L5	Salmonella_phage	36.3	9.4e-14
WP_014839970.1|113063_113288_+	hypothetical protein	NA	B1GS76	Salmonella_phage	51.2	2.3e-08
WP_017900705.1|113291_114365_+	hypothetical protein	NA	A6N3G8	Burkholderia_virus	56.8	1.1e-18
WP_017900703.1|114781_115189_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	56.1	3.5e-18
WP_017900702.1|115185_115470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839971.1|115959_116172_+	hypothetical protein	NA	J9Q804	Salmonella_phage	50.0	3.0e-13
WP_017900701.1|116428_117061_+	hypothetical protein	NA	A0A1V0E5L6	Salmonella_phage	55.9	1.5e-28
WP_017900700.1|117100_117622_+	DUF262 domain-containing protein	NA	A0A2H4FWH2	Salmonella_phage	68.5	5.4e-64
WP_009654227.1|117714_118002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009654204.1|118254_118575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017900698.1|118664_119099_+	hypothetical protein	NA	A0A1I9KFG8	Aeromonas_phage	28.3	4.3e-06
WP_017900697.1|119184_119817_+	hypothetical protein	NA	K4JV11	Caulobacter_phage	41.2	8.3e-27
WP_025999285.1|120098_120443_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_017900695.1|120439_120685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099501131.1|120758_121148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017900693.1|122047_123289_+	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	29.4	8.7e-12
WP_009654205.1|123393_123816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009654202.1|123808_123991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017900692.1|123983_124403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017900691.1|124426_124864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017900690.1|124959_125451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017900689.1|125954_126368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839973.1|126671_127094_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.0	1.8e-30
WP_024266263.1|127093_127249_+	UV protection protein ImpB	NA	I6RSM4	Salmonella_phage	68.6	3.4e-14
WP_014839974.1|127266_129495_-	thiazole biosynthesis protein ThiF	NA	NA	NA	NA	NA
127533:127547	attL	CTGGGAACACATCAA	NA	NA	NA	NA
WP_157190497.1|129491_130673_-	metallohydrolase	NA	NA	NA	NA	NA
WP_017900684.1|130809_131670_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_014839975.1|131677_132196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032447056.1|132235_134446_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_157190498.1|135012_138021_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	62.7	0.0e+00
WP_004118540.1|138181_138739_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	47.2	8.4e-39
WP_004118538.1|138870_139203_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_011977829.1|139556_140705_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	65.9	1.7e-123
WP_004118534.1|140979_141354_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	56.0	4.5e-28
WP_001549953.1|141882_143079_+	MFS transporter	NA	NA	NA	NA	NA
WP_004118529.1|143150_143978_-	universal stress protein	NA	NA	NA	NA	NA
WP_001549885.1|143996_145475_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.0	1.6e-198
WP_001549886.1|145958_146312_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.1	5.9e-22
WP_001572362.1|147903_148926_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_015062840.1|148949_151988_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.6	2.5e-294
149113:149127	attR	TTGATGTGTTCCCAG	NA	NA	NA	NA
>prophage 2
NZ_CP046614	Klebsiella pneumoniae strain WCGKP294 plasmid pWCGKP294-2, complete sequence	230910	158549	214914	230910	protease,integrase,transposase	Escherichia_phage(18.75%)	52	184688:184747	190844:192041
WP_157190508.1|158549_159515_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	29.7	5.6e-06
WP_157190500.1|159511_161644_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_157190501.1|161782_162826_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_157190502.1|162822_164556_+	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_157190503.1|164548_165019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157190504.1|165027_166095_+	SAVED domain-containing protein	NA	NA	NA	NA	NA
WP_157190509.1|166605_168399_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_004194318.1|169167_170652_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.1	1.1e-29
WP_024266306.1|171170_171779_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_014839899.1|171915_172314_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_017901071.1|172687_173044_-	hypothetical protein	NA	A0A141HRY5	Bacillus_phage	40.8	2.1e-11
WP_024266308.1|173424_174219_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_024266310.1|174463_175285_-	DNA repair ATPase	NA	NA	NA	NA	NA
WP_017901073.1|175393_175888_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	35.1	5.5e-18
WP_024266312.1|176067_177339_+	DUF1173 family protein	NA	NA	NA	NA	NA
WP_024266313.1|177734_178220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049593900.1|178230_178563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025999330.1|179914_180514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024266320.1|181144_181879_+	PsiA protein	NA	NA	NA	NA	NA
WP_017901080.1|182130_182889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017901081.1|182955_183702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017901082.1|183892_184462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048336589.1|184540_184654_-	small membrane protein	NA	NA	NA	NA	NA
184688:184747	attL	AGGAAGGTGCGAACAAGTCCCTGATATGAGATCATGTTTGTCATCTGGAGCCATGGAACA	NA	NA	NA	NA
WP_014839893.1|184720_185737_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	3.7e-186
WP_071600436.1|186716_187430_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_017901372.1|187488_188592_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	62.1	1.0e-120
WP_077252868.1|188755_188905_+	DinI-like family protein	NA	NA	NA	NA	NA
WP_157190505.1|188920_189142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001752311.1|189630_190662_-|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_014839893.1|190876_191893_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	3.7e-186
WP_014839892.1|192498_193149_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
190844:192041	attR	AGGAAGGTGCGAACAAGTCCCTGATATGAGATCATGTTTGTCATCTGGAGCCATGGAACAGGGTTCATCATGAGTCATCAACTTACCTTCGCCGACAGTGAATTCAGCAGTAAGCGCCGTCAGACCAGAAAAGAGATTTTCTTGTCCCGTATGGAGCAGATTCTGCCATGGCAAAACATGGTGGAAGTCATCGAGCCGTTTTACCCCAAGGCTGGTAATGGCCGGCGACCTTATCCGCTGGAAACCATGCTACGCATTCACTGCATGCAGCATTGGTACAACCTGAGCGATGGCGCGATGGAAGATGCTCTGTACGAAATCGCCTCCATGCGTCGGTTTGCCCGGTTATCCCTGGATAGCGCCTTGCCTGACCGCACCACCATCATGAATTTCCGCCACCTGCTGGAGCAGCATCAACTGGCCCGCCAATTGTTCAAGACCATCAATCGCTGGCTGGCCGAAGCAGGCGTCATGATGACTCAAGGCACCTTGGTCGATGCCACCATCATTGAGGCACCCAGCTCGACCAAGAACAAAGAGCAGCAACGCGATCCGGAGATGCATCAGACCAAGAAAGGCAATCAGTGGCACTTTGGCATGAAGGCCCACATTGGTGTCGATGCCAAGAGTGGCCTGACCCACAGCCTAGTCACCACCGCGGCCAACGAGCATGACCTCAATCAGCTGGGTAATCTGCTGCATGGAGAGGAGCAATTTGTCTCAGCCGATGCCGGCTACCAAGGGGCGCCACAGCGCGAGGAGCTGGCCGAGGTGGATGTGGACTGGCTGATCGCCGAGCGCCCCGGCAAGGTAAGAACCTTGAAACAGCATCCACGCAAGAACAAAACGGCCATCAACATCGAATACATGAAAGCCAGCATCCGGGCCAAGGTGGAGCACCCATTTCGCATCATCAAGCGACAGTTCGGCTTCGTGAAAGCCAGATACAAGGGGTTGCTGAAAAACGATAACCAACTGGCGATGTTATTCACGCTGGCCAACCTGTTTCGGGCGGACCAAATGATACGTCAGTGGGAGAGATCTCACTAAAAACTGGGGATAACGCCTTAAATGGCGAAGAAACGGTCTAAATAGGCTGATTCAAGGCATTTACGGGAGAAAAAATCGGCTCAAACATGAAGAAATGAAATGACTGAGTCAGCCGAGAAGAATTTCCCCGCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_100248964.1|193627_194792_+|transposase	IS3-like element ISKpn37 family transposase	transposase	Q716C2	Shigella_phage	48.0	1.3e-73
WP_017901334.1|195762_196338_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.8	1.1e-30
WP_014839890.1|196418_196997_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	3.3e-06
WP_014839889.1|197047_198088_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	46.8	5.5e-76
WP_014839888.1|198111_198567_-	tellurium resistance membrane protein TerB	NA	NA	NA	NA	NA
WP_014839887.1|198589_199753_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_014839886.1|199749_200334_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	29.0	4.5e-11
WP_014839885.1|200645_201704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839884.1|201715_202858_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	28.5	6.3e-33
WP_014839883.1|202850_203624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024266325.1|203625_204705_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.5	5.6e-39
WP_014839881.1|205672_206896_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_017901328.1|206898_207372_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_017901327.1|207550_207742_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_017901326.1|207738_208278_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_001166628.1|208408_208864_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_031623830.1|208935_209286_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000732275.1|209301_209577_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522996.1|209604_210030_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000209296.1|210068_211754_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_001143760.1|211908_214914_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
