The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045008	Proteus cibarius strain ZF2 chromosome, complete genome	4237246	1013518	1024359	4237246		Mycobacterium_phage(22.22%)	12	NA	NA
WP_075671546.1|1013518_1014718_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	36.6	2.4e-27
WP_156733094.1|1015341_1016310_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	72.4	2.2e-135
WP_156733095.1|1016334_1018461_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	50.4	2.0e-202
WP_075671552.1|1018466_1018886_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	37.6	8.0e-10
WP_075671554.1|1018897_1019122_-	glutaredoxin family protein	NA	V5UN81	Mycobacterium_phage	45.7	7.8e-12
WP_156733096.1|1019405_1019879_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	34.2	2.2e-16
WP_023581133.1|1020076_1020286_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	4.5e-22
WP_023581134.1|1020423_1020798_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	48.0	2.5e-23
WP_075671558.1|1020811_1021777_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_075671560.1|1021878_1022523_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_036912266.1|1022683_1022947_-	YbeD family protein	NA	NA	NA	NA	NA
WP_075671562.1|1023147_1024359_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	48.1	2.3e-102
>prophage 2
NZ_CP045008	Proteus cibarius strain ZF2 chromosome, complete genome	4237246	1328721	1381006	4237246	head,lysis,integrase,terminase,tail,holin,plate	Enterobacteria_phage(20.41%)	82	1333375:1333390	1381249:1381264
WP_075673144.1|1328721_1330773_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	24.9	3.0e-17
WP_075673145.1|1330774_1331233_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_075673146.1|1331370_1331784_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_036912304.1|1331862_1332180_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_075673147.1|1332380_1332662_+	acylphosphatase	NA	NA	NA	NA	NA
WP_023581360.1|1332705_1333035_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
1333375:1333390	attL	TGTCTCCTGAAGTCTC	NA	NA	NA	NA
WP_156734421.1|1333470_1334655_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	51.6	3.4e-114
WP_063693452.1|1334658_1334865_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	51.8	8.7e-10
WP_156733158.1|1335277_1335823_-	phage N-6-adenine-methyltransferase	NA	G9L688	Escherichia_phage	60.5	8.7e-57
WP_156733159.1|1335812_1336148_-	DUF2591 family protein	NA	A0A1P8DTH6	Proteus_phage	48.1	1.5e-14
WP_156733160.1|1336518_1336764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733161.1|1336871_1337024_-	hypothetical protein	NA	A0A1P8DTI8	Proteus_phage	97.3	5.1e-15
WP_156733162.1|1337023_1337557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733163.1|1337556_1337736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733164.1|1337759_1338053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733165.1|1338112_1338610_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	80.0	1.4e-53
WP_156733166.1|1338599_1339298_-	exonuclease	NA	A0A2R2Z325	Escherichia_phage	57.8	7.0e-75
WP_156733167.1|1339294_1340224_-	recombinase RecT	NA	F1C5B8	Cronobacter_phage	65.8	1.2e-109
WP_156733168.1|1340217_1340439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733169.1|1340435_1340699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164530202.1|1340706_1340862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733170.1|1340917_1341826_-	cell envelope biogenesis protein TolA	NA	A0A2I7QK72	Vibrio_phage	47.9	2.0e-21
WP_156733171.1|1341900_1342044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733172.1|1342045_1342234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733173.1|1342263_1342503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733174.1|1342703_1343207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733175.1|1343227_1343500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733176.1|1343974_1344685_-	helix-turn-helix domain-containing protein	NA	M9NZE3	Enterobacteria_phage	62.9	1.5e-77
WP_156733177.1|1344803_1345007_+	transcriptional regulator	NA	K7P6H5	Enterobacteria_phage	62.9	1.5e-14
WP_109391284.1|1345140_1345482_+	transcriptional regulator	NA	A0A1P8DTF0	Proteus_phage	91.9	2.7e-48
WP_156733178.1|1345618_1346287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733179.1|1346286_1347102_+	hypothetical protein	NA	G8C7U5	Escherichia_phage	57.9	2.4e-79
WP_156733180.1|1347105_1347960_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	59.6	2.8e-86
WP_152964332.1|1347979_1348147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733181.1|1348619_1348853_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_156733182.1|1348854_1349031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733183.1|1349041_1349491_+	hypothetical protein	NA	A0A2I7R8L6	Vibrio_phage	36.0	6.4e-13
WP_156733184.1|1349654_1349879_+	DUF3310 domain-containing protein	NA	A0A0A6Z5B6	Enterobacter_phage	75.4	6.1e-25
WP_156733185.1|1350000_1350450_+	hypothetical protein	NA	A0A1P8DTF9	Proteus_phage	97.3	2.4e-76
WP_164530201.1|1350436_1350562_+	hypothetical protein	NA	A0A1P8DTE6	Proteus_phage	89.5	3.0e-13
WP_156733187.1|1350704_1350995_+	DUF1364 family protein	NA	K7P6U2	Enterobacteria_phage	77.9	2.2e-38
WP_156733188.1|1350991_1351357_+	RusA family crossover junction endodeoxyribonuclease	NA	E5AGG1	Erwinia_phage	62.4	6.7e-37
WP_156733189.1|1351509_1351701_+	hypothetical protein	NA	A0A1P8DTD3	Proteus_phage	84.1	2.6e-24
WP_063108508.1|1351697_1352525_+	antitermination protein	NA	H6WRZ1	Salmonella_phage	43.4	2.9e-56
WP_156733190.1|1353025_1353505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733191.1|1353722_1354010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036906009.1|1354193_1354490_+|holin	holin	holin	E7C9S8	Salmonella_phage	45.4	1.0e-19
WP_156733192.1|1354486_1354891_+	structural protein	NA	A0A0E3JJ20	Enterobacteria_phage	46.3	5.9e-26
WP_156733193.1|1354887_1355337_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	30.9	2.5e-09
WP_156733194.1|1355333_1355495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733195.1|1355729_1355897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072063061.1|1356009_1356699_+	hypothetical protein	NA	Q5G8R0	Enterobacteria_phage	71.6	1.5e-90
WP_167515512.1|1356801_1357341_+	helix-turn-helix domain-containing protein	NA	C7U0W1	Enterobacteria_phage	75.0	1.1e-51
WP_156733196.1|1357294_1358815_+|terminase	phage terminase large subunit	terminase	Q7Y5U7	Haemophilus_phage	49.9	1.1e-130
WP_156733197.1|1358811_1360230_+	DUF1073 domain-containing protein	NA	A0A077KC81	Edwardsiella_phage	37.8	3.0e-77
WP_156734423.1|1360288_1361002_+|head	phage head morphogenesis protein	head	A0A2R3UAK2	Myoviridae_environmental_samples	41.3	7.4e-40
WP_129037614.1|1361051_1362212_+	DUF2213 domain-containing protein	NA	A0A219YBB9	Aeromonas_phage	36.2	7.5e-58
WP_156733198.1|1362214_1362703_+	hypothetical protein	NA	A0A077KAW3	Edwardsiella_phage	47.2	2.4e-34
WP_156733199.1|1362702_1363728_+	hypothetical protein	NA	A0A077KC85	Edwardsiella_phage	37.5	6.9e-63
WP_156734424.1|1363852_1364056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733200.1|1364058_1364463_+	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_156733201.1|1364455_1364914_+	hypothetical protein	NA	A0A077KC03	Edwardsiella_phage	53.0	9.0e-31
WP_156734426.1|1364903_1365281_+	hypothetical protein	NA	K4I3A0	Acinetobacter_phage	41.8	5.7e-23
WP_156733202.1|1365268_1365754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733203.1|1365765_1367223_+	DUF3383 family protein	NA	H9C0W5	Aeromonas_phage	33.9	1.7e-67
WP_129037599.1|1367235_1367682_+	hypothetical protein	NA	A0A1V0DZ74	Acinetobacter_phage	51.0	9.7e-38
WP_156733204.1|1367681_1368092_+	hypothetical protein	NA	A0A068CGG2	Acinetobacter_phage	40.7	4.1e-19
WP_156733205.1|1368345_1370736_+	hypothetical protein	NA	A0A1W6JPF2	Morganella_phage	47.6	5.5e-180
WP_156733206.1|1370801_1371797_+	DUF4431 domain-containing protein	NA	NA	NA	NA	NA
WP_156733207.1|1372067_1372850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049201304.1|1372840_1373242_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_156733208.1|1373358_1373868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733209.1|1373925_1374633_+	hypothetical protein	NA	A0A1V0DZ59	Acinetobacter_phage	54.4	4.8e-47
WP_156733210.1|1374633_1374909_+	hypothetical protein	NA	A0A1X9SFF3	Acinetobacter_phage	46.7	2.9e-16
WP_156733211.1|1374895_1375786_+	hypothetical protein	NA	A0A220NQG9	Acinetobacter_phage	42.4	4.7e-60
WP_156733212.1|1375766_1376459_+|plate	phage baseplate protein	plate	A0A2R3UAK1	Myoviridae_environmental_samples	40.2	4.4e-29
WP_049206563.1|1376460_1376814_+	hypothetical protein	NA	I2GUF7	Acinetobacter_phage	52.1	9.4e-28
WP_156733213.1|1376810_1378001_+	hypothetical protein	NA	E2GM17	Acinetobacter_phage	40.4	6.3e-76
WP_156733214.1|1378000_1378633_+	DUF2612 domain-containing protein	NA	K4HYS2	Acinetobacter_phage	49.0	5.6e-47
WP_167515513.1|1379648_1380155_+|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	44.2	4.3e-26
WP_156733215.1|1380154_1380775_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_156733216.1|1380775_1381006_-	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	92.1	6.3e-33
1381249:1381264	attR	TGTCTCCTGAAGTCTC	NA	NA	NA	NA
>prophage 3
NZ_CP045008	Proteus cibarius strain ZF2 chromosome, complete genome	4237246	1410031	1444248	4237246	head,lysis,capsid,integrase,terminase,tail,holin,protease,portal	Morganella_phage(29.73%)	52	1404780:1404796	1452318:1452334
1404780:1404796	attL	TTATTTTGTGCAAATTG	NA	NA	NA	NA
WP_109402803.1|1410031_1411114_+|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	79.7	2.3e-170
WP_072065180.1|1411167_1411455_+	DinI-like family protein	NA	A0A1W6JP10	Morganella_phage	31.8	8.7e-08
WP_072065179.1|1411498_1411744_-	pyocin activator PrtN family protein	NA	A0A1W6JP35	Morganella_phage	70.7	6.7e-25
WP_156733224.1|1411793_1412267_-	SAM-dependent methyltransferase	NA	A0A1W6JP48	Morganella_phage	78.1	9.2e-71
WP_156733225.1|1412250_1412751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733226.1|1412760_1413399_-	hypothetical protein	NA	H2BDG4	Pseudomonas_virus	41.9	3.3e-39
WP_156733227.1|1413400_1413856_-	hypothetical protein	NA	A0A248SL53	Klebsiella_phage	40.5	1.3e-26
WP_156733228.1|1413864_1414362_-	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	66.1	5.0e-43
WP_156733229.1|1414354_1414888_-	HD family hydrolase	NA	A0A1W6JP41	Morganella_phage	59.6	1.4e-54
WP_156733230.1|1414969_1415866_-	recombination-associated protein RdgC	NA	A0A1W6JP69	Morganella_phage	59.7	2.6e-98
WP_156733231.1|1416091_1416295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733232.1|1416419_1417139_-	transcriptional regulator	NA	E7C9R0	Salmonella_phage	33.8	5.0e-28
WP_036900996.1|1417214_1417448_+	hypothetical protein	NA	A0A1B5FPK9	Escherichia_phage	40.9	2.2e-09
WP_156733233.1|1417499_1417958_+	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	45.4	3.5e-27
WP_099660103.1|1418244_1418424_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	58.6	6.2e-12
WP_156733234.1|1418433_1419555_+	replication protein 15	NA	K7PLZ7	Enterobacterial_phage	57.2	6.8e-48
WP_156733235.1|1419551_1420190_+	phage N-6-adenine-methyltransferase	NA	K7PGU4	Enterobacteria_phage	66.7	9.8e-84
WP_036904905.1|1420186_1420579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023582529.1|1420578_1420749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036904907.1|1420811_1421195_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	53.7	1.7e-27
WP_156733236.1|1421213_1422020_+	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	62.1	8.8e-90
WP_156733237.1|1422016_1423042_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	45.9	7.5e-86
WP_156733238.1|1423069_1423750_+	hypothetical protein	NA	A0A1W6JP37	Morganella_phage	49.1	5.2e-51
WP_041705231.1|1424075_1424288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733239.1|1424359_1424608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099660111.1|1424927_1425143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058336245.1|1425146_1425389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004916901.1|1425518_1425908_+	membrane protein	NA	S4TRS4	Salmonella_phage	35.0	4.2e-13
WP_004918415.1|1425904_1426198_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_036976899.1|1426184_1426517_+	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	70.3	4.4e-35
WP_156734430.1|1426518_1427007_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	90.2	6.8e-53
WP_156733240.1|1427822_1428134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733241.1|1428123_1428534_+	hypothetical protein	NA	A0A1P8DTD7	Proteus_phage	70.6	9.8e-45
WP_156733242.1|1428537_1428876_+	HNH endonuclease	NA	F1C587	Cronobacter_phage	67.9	3.7e-42
WP_156733243.1|1428923_1429331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064720837.1|1429700_1430168_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	60.4	2.5e-44
WP_156733244.1|1430121_1431864_+|terminase	phage terminase small subunit P27 family	terminase	A0A0U2C138	Paracoccus_phage	45.3	1.8e-143
WP_109402514.1|1431864_1433190_+|portal	phage portal protein	portal	A0A1P8DTI5	Proteus_phage	80.6	1.0e-207
WP_156733245.1|1433194_1434046_+|protease	Clp protease ClpP	protease	A0A1P8DTI2	Proteus_phage	98.6	2.1e-150
WP_156733246.1|1434057_1435272_+|capsid	phage major capsid protein	capsid	A0A1P8DTJ7	Proteus_phage	99.3	1.6e-220
WP_069368412.1|1435557_1435884_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1P8DTJ4	Proteus_phage	95.4	2.7e-53
WP_069368413.1|1435892_1436222_+|head	phage head closure protein	head	A0A2H4JHA9	uncultured_Caudovirales_phage	33.9	1.6e-05
WP_069368414.1|1436211_1436685_+	hypothetical protein	NA	A0A0R6PHU8	Moraxella_phage	31.7	5.7e-12
WP_069368415.1|1436689_1437031_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_072063869.1|1437040_1437715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069368417.1|1437749_1438163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072063870.1|1438159_1438438_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_156733247.1|1438480_1441765_+|tail	phage tail tape measure protein	tail	A0A220VZA0	Acinetobacter_phage	31.1	8.4e-38
WP_156733248.1|1441765_1442362_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	50.3	7.8e-51
WP_156733249.1|1442361_1442943_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	49.5	2.0e-51
WP_156733250.1|1443001_1443829_+	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	37.1	4.0e-05
WP_156733251.1|1443849_1444248_+	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	49.2	1.1e-32
1452318:1452334	attR	TTATTTTGTGCAAATTG	NA	NA	NA	NA
>prophage 4
NZ_CP045008	Proteus cibarius strain ZF2 chromosome, complete genome	4237246	1518286	1524509	4237246	integrase	Escherichia_phage(44.44%)	14	1511673:1511686	1521171:1521184
1511673:1511686	attL	TTTTAATTTATTCA	NA	NA	NA	NA
WP_156733270.1|1518286_1519462_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	58.3	1.5e-133
WP_099659572.1|1519442_1519631_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	56.9	5.9e-13
WP_103004601.1|1519835_1520042_-	DUF4060 family protein	NA	NA	NA	NA	NA
WP_156733271.1|1520049_1520652_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	57.1	1.2e-59
WP_156733272.1|1520638_1521007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733273.1|1520999_1521185_-	hypothetical protein	NA	NA	NA	NA	NA
1521171:1521184	attR	TTTTAATTTATTCA	NA	NA	NA	NA
WP_036935799.1|1521345_1521606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733274.1|1521595_1521820_-	hypothetical protein	NA	A0A1U9ZAB3	Proteus_phage	61.6	1.4e-16
WP_156733275.1|1521812_1522016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164530196.1|1522051_1522213_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	49.0	6.4e-08
WP_156733276.1|1522278_1522692_-	single-stranded DNA-binding protein	NA	A0A1W6JNW8	Morganella_phage	73.7	9.2e-51
WP_156733277.1|1522681_1523380_-	exonuclease	NA	A0A2R2Z325	Escherichia_phage	57.3	2.0e-74
WP_156733278.1|1523376_1524261_-	recombinase RecT	NA	A0A2L1IV84	Escherichia_phage	61.9	2.2e-94
WP_156733279.1|1524257_1524509_-	hypothetical protein	NA	A0A1P8DTG3	Proteus_phage	91.6	7.8e-37
>prophage 5
NZ_CP045008	Proteus cibarius strain ZF2 chromosome, complete genome	4237246	1527969	1569466	4237246	terminase,tail,holin	Proteus_phage(26.83%)	60	NA	NA
WP_156733285.1|1527969_1528794_-	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	41.0	2.1e-38
WP_156734432.1|1528943_1529627_-	helix-turn-helix domain-containing protein	NA	A0A1P8DTH0	Proteus_phage	95.2	2.0e-127
WP_049257589.1|1529709_1529919_+	helix-turn-helix transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	94.2	1.8e-31
WP_109391284.1|1530062_1530404_+	transcriptional regulator	NA	A0A1P8DTF0	Proteus_phage	91.9	2.7e-48
WP_156733178.1|1530540_1531209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733179.1|1531208_1532024_+	hypothetical protein	NA	G8C7U5	Escherichia_phage	57.9	2.4e-79
WP_156733180.1|1532027_1532882_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	59.6	2.8e-86
WP_152964332.1|1532901_1533069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733181.1|1533541_1533775_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_156733182.1|1533776_1533953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733183.1|1533963_1534413_+	hypothetical protein	NA	A0A2I7R8L6	Vibrio_phage	36.0	6.4e-13
WP_156733184.1|1534576_1534801_+	DUF3310 domain-containing protein	NA	A0A0A6Z5B6	Enterobacter_phage	75.4	6.1e-25
WP_156733185.1|1534922_1535372_+	hypothetical protein	NA	A0A1P8DTF9	Proteus_phage	97.3	2.4e-76
WP_156733286.1|1535464_1536058_+	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	87.7	4.1e-84
WP_071233632.1|1536210_1536402_+	hypothetical protein	NA	A0A1P8DTD3	Proteus_phage	96.8	1.3e-28
WP_104731779.1|1536398_1536902_+	DUF1133 family protein	NA	A0A1P8DTF1	Proteus_phage	94.0	2.2e-86
WP_036906009.1|1537316_1537613_+|holin	holin	holin	E7C9S8	Salmonella_phage	45.4	1.0e-19
WP_156733287.1|1537609_1538002_+	M15 family peptidase	NA	A0A1P8DTE2	Proteus_phage	97.9	1.9e-50
WP_156733288.1|1537998_1538376_+	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	31.7	6.3e-06
WP_156733289.1|1538263_1538521_+	peptidase	NA	Q8SBD8	Shigella_phage	45.2	2.6e-11
WP_156733290.1|1538517_1538928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733291.1|1539406_1539949_+	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	59.1	8.4e-52
WP_164530194.1|1539945_1540104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733292.1|1540134_1540293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733293.1|1540285_1540462_+	hypothetical protein	NA	A0A1W6JNV6	Morganella_phage	74.5	8.8e-19
WP_109829196.1|1540534_1540753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733294.1|1540840_1541449_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	78.5	3.6e-75
WP_156733295.1|1541451_1542939_+|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	88.6	4.5e-265
WP_156733296.1|1542938_1544309_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	49.7	1.8e-122
WP_156733297.1|1544305_1545427_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	51.0	3.3e-103
WP_156733298.1|1545495_1545735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733299.1|1545837_1546611_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.7	1.7e-66
WP_156733300.1|1546624_1547578_+	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	71.9	1.4e-126
WP_156733301.1|1547580_1547865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733302.1|1547904_1548384_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	47.7	2.2e-32
WP_156733303.1|1548386_1548740_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	44.7	4.5e-22
WP_156733304.1|1548741_1549194_+	hypothetical protein	NA	I6PCW1	Cronobacter_phage	52.7	9.2e-36
WP_156733305.1|1549190_1549592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733306.1|1549637_1550294_+|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	57.2	6.6e-59
WP_156733307.1|1550345_1550651_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	56.4	1.7e-22
WP_156733308.1|1550665_1550956_+	hypothetical protein	NA	F8UBV2	Escherichia_phage	47.0	7.7e-12
WP_156733309.1|1551047_1551419_+	hypothetical protein	NA	E7C9U7	Salmonella_phage	62.7	1.9e-34
WP_109372780.1|1551424_1551604_-	hypothetical protein	NA	A0A192Y6A8	Salmonella_phage	81.4	1.7e-22
WP_156734434.1|1551934_1553476_+	DNA repair protein	NA	NA	NA	NA	NA
WP_156733310.1|1553605_1554322_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_156733311.1|1554412_1554583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733312.1|1555303_1556029_+	hypothetical protein	NA	A0A0P0ZD96	Stx2-converting_phage	56.8	1.0e-65
WP_164530193.1|1556241_1556721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109391246.1|1556742_1557060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733314.1|1557204_1558074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733315.1|1558134_1561068_+|tail	phage tail tape measure protein	tail	A0A0K0VLY2	Klebsiella_phage	29.8	5.5e-97
WP_156733316.1|1561079_1561295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733317.1|1561298_1561541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115370826.1|1561683_1562025_+|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	49.1	2.6e-27
WP_109391241.1|1562021_1562765_+|tail	phage minor tail protein L	tail	K7PJS0	Enterobacterial_phage	59.0	1.3e-87
WP_156733318.1|1562761_1563472_+	peptidase P60	NA	F1C573	Cronobacter_phage	64.8	9.9e-85
WP_156733319.1|1563468_1564056_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	59.4	3.2e-57
WP_156733320.1|1564107_1567779_+	DUF1983 domain-containing protein	NA	A0A1P8DTI4	Proteus_phage	62.2	0.0e+00
WP_156733321.1|1567783_1569196_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	62.5	8.7e-141
WP_156733322.1|1569235_1569466_-	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	97.4	7.4e-34
>prophage 6
NZ_CP045008	Proteus cibarius strain ZF2 chromosome, complete genome	4237246	1612143	1648732	4237246	tRNA,head,lysis,capsid,integrase,terminase,tail,protease,portal	Morganella_phage(25.93%)	48	1603961:1603976	1645511:1645526
1603961:1603976	attL	AACATATTTTGCATAT	NA	NA	NA	NA
WP_075672653.1|1612143_1613247_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_075672652.1|1613356_1613806_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_075672651.1|1613798_1614428_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_109850542.1|1614566_1615820_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.8e-20
WP_156733332.1|1615929_1617063_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	72.0	1.4e-154
WP_017628380.1|1617037_1617289_-	excisionase	NA	NA	NA	NA	NA
WP_156733333.1|1617374_1617899_-	HD family hydrolase	NA	A0A1W6JP41	Morganella_phage	61.0	1.1e-53
WP_156733334.1|1618294_1618942_-	helix-turn-helix domain-containing protein	NA	K7PM82	Enterobacteria_phage	64.6	8.4e-75
WP_049217157.1|1619045_1619240_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	61.0	6.5e-15
WP_098943242.1|1619277_1619754_+	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	61.1	7.9e-46
WP_017628377.1|1620015_1620195_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	55.2	3.4e-10
WP_156734436.1|1620752_1621268_+	hypothetical protein	NA	U5P0A0	Shigella_phage	44.2	5.9e-23
WP_156733335.1|1621289_1622096_+	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	62.5	6.8e-90
WP_156733336.1|1622092_1623118_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	46.8	8.3e-85
WP_049219743.1|1623145_1623544_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	54.3	1.6e-31
WP_004244726.1|1623882_1624095_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	81.4	3.1e-26
WP_156733337.1|1624427_1624886_+	Hsp20 family protein	NA	NA	NA	NA	NA
WP_088495923.1|1625416_1626748_-	RNA-dependent DNA polymerase	NA	NA	NA	NA	NA
WP_156733338.1|1626752_1627400_-	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_156733339.1|1627843_1628260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733340.1|1628278_1628464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733341.1|1628689_1629259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733342.1|1629239_1629392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036905789.1|1629548_1629818_+	bacteriophage protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	4.6e-19
WP_156733343.1|1629817_1630288_+	glycoside hydrolase family protein	NA	A0A1W6JNW4	Morganella_phage	61.8	1.2e-49
WP_164530192.1|1630269_1630428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733344.1|1630430_1630895_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	34.5	5.2e-10
WP_156733345.1|1630938_1631520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733346.1|1631806_1632883_+	DUF4297 domain-containing protein	NA	NA	NA	NA	NA
WP_156733347.1|1632934_1634674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733348.1|1634832_1635171_+	HNH endonuclease	NA	F1C587	Cronobacter_phage	68.8	7.1e-41
WP_006537822.1|1635290_1635758_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	9.5e-44
WP_156733349.1|1635711_1637445_+|terminase	phage terminase small subunit P27 family	terminase	A0A0U2C138	Paracoccus_phage	46.2	5.8e-147
WP_004242475.1|1637444_1638713_+|portal	phage portal protein	portal	Q77W97	Enterobacteria_phage	80.4	1.8e-201
WP_004242476.1|1638730_1639399_+|head,protease	HK97 family phage prohead protease	head,protease	K7PM91	Enterobacterial_phage	65.8	6.6e-83
WP_156733350.1|1639402_1640569_+|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	79.8	9.6e-170
WP_004242478.1|1640607_1640907_+	hypothetical protein	NA	K7PKV5	Enterobacterial_phage	63.3	2.8e-33
WP_087802803.1|1640906_1641236_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_087802806.1|1641225_1641699_+	hypothetical protein	NA	A0A0R6PHU8	Moraxella_phage	30.5	1.3e-11
WP_087802809.1|1641704_1642046_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017628356.1|1642055_1642721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088495854.1|1642785_1643202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041701216.1|1643198_1643477_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_004242485.1|1643505_1643697_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_156733351.1|1643823_1647099_+|tail	phage tail tape measure protein	tail	B7SE05	Pseudomonas_virus	46.7	8.4e-54
1645511:1645526	attR	ATATGCAAAATATGTT	NA	NA	NA	NA
WP_156733352.1|1647099_1647696_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	53.3	3.2e-52
WP_156733353.1|1647695_1648277_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.0	1.8e-52
WP_156733354.1|1648333_1648732_+	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	47.0	2.7e-31
>prophage 7
NZ_CP045008	Proteus cibarius strain ZF2 chromosome, complete genome	4237246	1715841	1729405	4237246	tRNA	Tupanvirus(55.56%)	13	NA	NA
WP_075673357.1|1715841_1717770_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.2	3.9e-128
WP_036937410.1|1717773_1718313_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.4	3.7e-15
WP_004263702.1|1718407_1718605_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_006537111.1|1718647_1719004_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_120655563.1|1719112_1719160_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_023582383.1|1719335_1720319_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.7	4.9e-34
WP_075673356.1|1720333_1722721_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	27.4	3.5e-09
WP_023582381.1|1722725_1723022_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	4.2e-13
WP_099659661.1|1723401_1724412_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_075673354.1|1724413_1725163_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L090	Tupanvirus	28.1	7.1e-09
WP_099659662.1|1725296_1726442_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	28.8	3.5e-39
WP_075673352.1|1726442_1727423_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	34.7	1.1e-38
WP_156733370.1|1727422_1729405_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	27.2	1.1e-21
>prophage 8
NZ_CP045008	Proteus cibarius strain ZF2 chromosome, complete genome	4237246	2296231	2304895	4237246	holin	Cronobacter_phage(33.33%)	9	NA	NA
WP_156733531.1|2296231_2297284_-	nucleotidyltransferase	NA	I1TRN7	Cronobacter_phage	28.9	1.2e-30
WP_156733533.1|2297267_2298047_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	39.2	1.4e-31
WP_156733535.1|2298193_2298787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733537.1|2299065_2299560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115349912.1|2299559_2299904_-	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	84.3	2.0e-43
WP_004243326.1|2299906_2300179_-|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	38.9	1.9e-12
WP_020945795.1|2300175_2300547_-	hypothetical protein	NA	G9L6E6	Escherichia_phage	39.1	3.9e-16
WP_156733539.1|2300838_2302320_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_156733541.1|2302393_2304895_-	hypothetical protein	NA	G9L6E4	Escherichia_phage	57.4	5.8e-71
>prophage 9
NZ_CP045008	Proteus cibarius strain ZF2 chromosome, complete genome	4237246	2309031	2339690	4237246	terminase,tail,integrase	Salmonella_phage(26.92%)	38	2328913:2328928	2336617:2336632
WP_156733548.1|2309031_2312115_-	hypothetical protein	NA	T1SBJ1	Salmonella_phage	50.8	1.6e-163
WP_004243338.1|2312117_2312666_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	60.2	3.4e-45
WP_156733550.1|2312665_2313154_-	hypothetical protein	NA	A0A0F6R7N6	Escherichia_coli_O157_typing_phage	59.9	2.1e-49
WP_156733552.1|2313137_2315600_-	hypothetical protein	NA	A0A0F6TJD3	Escherichia_coli_O157_typing_phage	70.0	0.0e+00
WP_004243342.1|2315599_2316205_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	60.7	5.1e-66
WP_004243343.1|2316204_2316516_-	hypothetical protein	NA	Q858G5	Salmonella_phage	38.5	1.8e-14
WP_115370897.1|2316579_2316921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060555916.1|2316929_2317361_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	54.8	1.4e-30
WP_004243350.1|2317419_2318400_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	59.4	6.5e-111
WP_115370896.1|2318415_2319093_-	peptidase	NA	T1SAP9	Salmonella_phage	64.3	6.8e-43
WP_004243354.1|2319110_2319425_-	hypothetical protein	NA	Q2A090	Sodalis_phage	45.5	1.2e-13
WP_156733554.1|2319421_2321086_-|tail	phage tail protein	tail	A0A193GYI4	Enterobacter_phage	65.4	2.4e-198
WP_115370894.1|2321095_2321305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733556.1|2321490_2322975_-|terminase	terminase	terminase	G9L6B8	Escherichia_phage	77.8	1.6e-230
WP_156733558.1|2322974_2323544_-|terminase	terminase small subunit	terminase	G9L6B7	Escherichia_phage	47.5	3.7e-42
WP_156733560.1|2323587_2324238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733562.1|2324266_2324608_-	hypothetical protein	NA	H9C172	Pectobacterium_phage	58.1	1.6e-29
WP_156733563.1|2324667_2325099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049203709.1|2325218_2325614_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	60.9	5.2e-35
WP_156733565.1|2325610_2326024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243368.1|2326270_2326996_-	ATP-binding protein	NA	A0A1W6JP39	Morganella_phage	78.8	6.7e-105
WP_036976826.1|2326995_2327838_-	hypothetical protein	NA	A0A0D4DBT2	Acinetobacter_phage	59.7	3.8e-51
WP_004243371.1|2327848_2328034_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	50.8	6.0e-10
WP_156733566.1|2328173_2328452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072068383.1|2328529_2329138_+	DNA-binding protein	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	35.4	1.5e-28
2328913:2328928	attL	TAACCGCATTATTAAT	NA	NA	NA	NA
WP_004243375.1|2329386_2329548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733568.1|2329534_2331256_+	DNA breaking-rejoining protein	NA	H6WRX1	Salmonella_phage	51.6	2.4e-108
WP_156733570.1|2331301_2332342_+	enterohemolysin	NA	H6WRX0	Salmonella_phage	50.1	7.9e-99
WP_004250862.1|2332386_2332644_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_156733572.1|2332731_2333265_+	hypothetical protein	NA	J9Q748	Salmonella_phage	46.3	8.8e-38
WP_156733574.1|2333334_2333865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733576.1|2333916_2334096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112843754.1|2334092_2334734_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	61.1	2.3e-72
WP_156733578.1|2334736_2334934_+	hypothetical protein	NA	A0A1P8DTH3	Proteus_phage	65.1	5.8e-19
WP_004250848.1|2334933_2335122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733580.1|2335129_2336326_-|integrase	tyrosine-type recombinase/integrase	integrase	T1S9J3	Salmonella_phage	61.9	4.8e-140
WP_098942517.1|2336544_2338122_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
2336617:2336632	attR	ATTAATAATGCGGTTA	NA	NA	NA	NA
WP_075671849.1|2338223_2339690_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.3	2.3e-88
>prophage 10
NZ_CP045008	Proteus cibarius strain ZF2 chromosome, complete genome	4237246	2556135	2562535	4237246	lysis,holin	Enterobacteria_phage(37.5%)	9	NA	NA
WP_156733698.1|2556135_2556594_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	47.6	1.3e-24
WP_075674211.1|2556657_2557110_-	hypothetical protein	NA	B5M9T3	Pseudomonas_phage	33.8	1.1e-12
WP_156733700.1|2557120_2558608_-	DUF3383 family protein	NA	Q6IWV2	Burkholderia_phage	30.8	1.5e-58
WP_088495160.1|2558616_2559129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733702.1|2559226_2559676_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	29.7	4.3e-09
WP_156733704.1|2559672_2560077_-	structural protein	NA	A0A0E3JJ20	Enterobacteria_phage	47.3	2.6e-26
WP_088495157.1|2560069_2560378_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	54.5	5.3e-27
WP_156733706.1|2560740_2561556_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.5	3.4e-57
WP_088495150.1|2561797_2562535_+	helix-turn-helix transcriptional regulator	NA	A0A088CBP2	Shigella_phage	45.9	1.4e-57
>prophage 11
NZ_CP045008	Proteus cibarius strain ZF2 chromosome, complete genome	4237246	3001747	3086904	4237246	tRNA,lysis,integrase,terminase,tail,protease,plate,portal	Enterobacteria_phage(25.0%)	87	3037981:3038004	3081725:3081748
WP_156733866.1|3001747_3003085_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_156733868.1|3003081_3003750_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_075674253.1|3003728_3005468_+	OmpA family protein	NA	NA	NA	NA	NA
WP_023583757.1|3005490_3005982_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_156733869.1|3006267_3008979_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	8.9e-94
WP_156733873.1|3011503_3012271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733875.1|3012349_3013066_+	hypothetical protein	NA	A0A077K801	Ralstonia_phage	38.7	1.8e-09
WP_156733877.1|3013216_3014488_+	hypothetical protein	NA	A0A077K801	Ralstonia_phage	21.5	4.2e-09
WP_156733878.1|3014541_3015279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733880.1|3015290_3017429_+	hypothetical protein	NA	A0A077K801	Ralstonia_phage	30.1	1.1e-30
WP_075674106.1|3017467_3017722_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_156733882.1|3017722_3019120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733883.1|3019119_3022443_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_109419414.1|3022488_3024111_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_109419415.1|3024143_3025907_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_156733885.1|3025870_3026968_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_099659268.1|3026942_3027506_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_075674113.1|3027508_3027943_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_156733887.1|3028022_3029405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733889.1|3029415_3030036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075674117.1|3030451_3031183_+	ankyrin repeat domain-containing protein	NA	A0A0G2Y7V3	Acanthamoeba_polyphaga_mimivirus	33.8	6.5e-07
WP_075674116.1|3031326_3031620_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_075674163.1|3032139_3032667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733891.1|3032941_3034357_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_099659264.1|3034848_3035268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099659263.1|3035467_3035977_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_075674159.1|3036339_3036648_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_075674158.1|3036793_3037333_-	hypothetical protein	NA	NA	NA	NA	NA
3037981:3038004	attL	ACTTGACCCGTTACTTGACCCGCA	NA	NA	NA	NA
WP_099659261.1|3038029_3039256_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	30.2	1.5e-35
WP_156733893.1|3039637_3041194_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_156733895.1|3043334_3047087_-	DUF1983 domain-containing protein	NA	A0A0P0ZBW1	Stx2-converting_phage	53.0	5.6e-280
WP_156734468.1|3047101_3047686_-|tail	tail assembly protein	tail	K7PH50	Enterobacteria_phage	48.0	6.9e-44
WP_156733897.1|3047655_3048384_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	61.5	1.2e-88
WP_156733898.1|3048405_3049110_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	51.5	6.4e-68
WP_156733900.1|3049163_3049739_-	hypothetical protein	NA	I6PDJ9	Cronobacter_phage	48.5	3.4e-19
WP_156733902.1|3049816_3050713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733903.1|3050753_3051083_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	54.6	4.3e-27
WP_156733905.1|3051082_3054100_-|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	30.9	1.1e-103
WP_156733907.1|3054068_3054389_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	42.5	1.5e-16
WP_156733909.1|3054409_3054799_-|tail	phage minor tail protein G	tail	K7PJY4	Enterobacterial_phage	36.5	8.5e-14
WP_156733910.1|3054810_3055332_-|tail	phage tail protein	tail	M9NYX0	Enterobacteria_phage	74.0	7.0e-64
WP_164530211.1|3055343_3055739_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	60.3	2.6e-42
WP_156733913.1|3055738_3056302_-|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	57.1	6.2e-50
WP_156733915.1|3056311_3056584_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	43.8	1.6e-14
WP_156733917.1|3056595_3056937_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	50.0	1.5e-19
WP_167515514.1|3057025_3058990_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	64.5	1.7e-248
WP_156733921.1|3058982_3060473_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	66.9	1.9e-191
WP_004247869.1|3060469_3060685_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	64.3	1.2e-17
WP_156733923.1|3060681_3062784_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	69.0	7.7e-295
WP_156733925.1|3062780_3063275_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	65.0	1.5e-47
WP_156733927.1|3063390_3063927_-	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	64.6	1.2e-63
WP_156733929.1|3064334_3064829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733931.1|3064865_3065285_-	hypothetical protein	NA	A0A1P8DTD7	Proteus_phage	71.2	1.2e-42
WP_036904935.1|3065973_3066177_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_036904932.1|3066416_3066899_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	83.5	1.4e-42
WP_164530183.1|3066901_3067060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109850081.1|3067041_3067512_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	58.6	1.7e-48
WP_036904926.1|3067511_3067781_-	bacteriophage protein	NA	A0A2H4FNF0	Salmonella_phage	47.7	5.7e-17
WP_072065159.1|3068121_3068370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733932.1|3068574_3068733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733934.1|3068845_3070012_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	43.3	7.3e-85
WP_135022270.1|3070252_3070636_-	antitermination protein	NA	A0A088CD47	Shigella_phage	69.0	1.8e-48
WP_156733936.1|3070664_3071690_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	45.6	6.4e-85
WP_156733236.1|3071686_3072493_-	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	62.1	8.8e-90
WP_036904907.1|3072511_3072895_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	53.7	1.7e-27
WP_023582529.1|3072957_3073128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036904905.1|3073127_3073520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733937.1|3073516_3074155_-	phage N-6-adenine-methyltransferase	NA	K7PGU4	Enterobacteria_phage	65.2	2.0e-81
WP_036901003.1|3074154_3075216_-	replication protein	NA	H2DE83	Erwinia_phage	54.4	5.1e-29
WP_099659597.1|3075228_3075408_-	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	56.9	4.7e-12
WP_098943307.1|3075397_3075607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135022262.1|3075695_3076154_-	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	45.4	1.3e-26
WP_135022261.1|3076192_3076387_-	hypothetical protein	NA	A0A1W6JP24	Morganella_phage	63.9	2.9e-15
WP_135022259.1|3076492_3077140_+	helix-turn-helix domain-containing protein	NA	A0A1W6JP50	Morganella_phage	62.7	1.1e-63
WP_072070916.1|3077249_3077453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006533955.1|3077672_3078047_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	69.7	4.6e-41
WP_156733939.1|3078112_3078940_+	DUF2303 family protein	NA	A0A2R2Z323	Escherichia_phage	56.2	8.5e-80
WP_156733941.1|3078998_3079496_+	single-stranded DNA-binding protein	NA	Q1MVN2	Enterobacteria_phage	62.3	3.0e-48
WP_156733943.1|3079564_3080245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156733945.1|3080657_3081020_+	DUF2591 family protein	NA	E9NID9	Enterobacter_phage	54.7	1.2e-25
WP_164530182.1|3080994_3081477_+	class I SAM-dependent methyltransferase	NA	A0A1W6JP48	Morganella_phage	78.6	2.1e-70
WP_156733946.1|3081530_3081719_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_075673948.1|3082062_3082935_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.8	5.7e-34
3081725:3081748	attR	ACTTGACCCGTTACTTGACCCGCA	NA	NA	NA	NA
WP_075673947.1|3082938_3083151_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_075673946.1|3083803_3084745_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_075673945.1|3084979_3085423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075673944.1|3085512_3086904_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.3	4.7e-38
>prophage 12
NZ_CP045008	Proteus cibarius strain ZF2 chromosome, complete genome	4237246	3461500	3513687	4237246	transposase,protease	uncultured_virus(28.57%)	41	NA	NA
WP_002001451.1|3461500_3462685_-|transposase	IS4-like element ISEc29 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	4.5e-50
WP_156734089.1|3462787_3463546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032469918.1|3463766_3464153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146008853.1|3464149_3464722_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_156734091.1|3464796_3466086_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_108479663.1|3466088_3466985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000667167.1|3466968_3467595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000433891.1|3467591_3467873_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_156734093.1|3467908_3468148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156734094.1|3468161_3468749_+	plasmid-related protein	NA	NA	NA	NA	NA
WP_156734096.1|3468775_3469411_-	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
WP_140266354.1|3469397_3469958_-	conjugative transfer protein	NA	NA	NA	NA	NA
WP_156734098.1|3469967_3471788_-	conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_156734099.1|3471836_3473987_-	phosphohydrolase	NA	NA	NA	NA	NA
WP_156734101.1|3474129_3478434_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_156734103.1|3478584_3480660_-|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_156734105.1|3480676_3483334_-	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_011117362.1|3483333_3487035_-	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
WP_010129446.1|3487050_3488814_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_156734107.1|3488830_3492508_-	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_000645939.1|3492526_3493111_-	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_156734109.1|3493107_3493707_-	DUF1819 family protein	NA	NA	NA	NA	NA
WP_001153780.1|3493716_3494604_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_000284113.1|3494711_3495026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000196208.1|3495113_3496019_-	DNA polymerase III subunit epsilon	NA	A0A2H4P6W5	Pseudomonas_phage	25.6	8.1e-07
WP_000182836.1|3496401_3496659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000116661.1|3496657_3497107_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A218MND2	uncultured_virus	57.1	4.1e-36
WP_001883756.1|3497114_3497384_+	hypothetical protein	NA	A0A218MNF2	uncultured_virus	76.3	9.3e-28
WP_001043260.1|3499810_3500626_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|3500686_3501490_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|3501489_3502326_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_058199817.1|3502730_3503510_+	APH(3')-VI family aminoglycoside O-phosphotransferase	NA	E4ZFP6	Streptococcus_phage	35.5	3.1e-31
WP_000480968.1|3503821_3504658_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001120891.1|3504629_3505169_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_156734112.1|3505228_3506212_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|3506341_3506647_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214122.1|3506674_3507889_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001447541.1|3508105_3508990_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_156734113.1|3509020_3510514_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_084929516.1|3510974_3511847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156734115.1|3512187_3513687_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP045008	Proteus cibarius strain ZF2 chromosome, complete genome	4237246	3519321	3547374	4237246	transposase,integrase	Escherichia_phage(50.0%)	22	3517877:3517892	3548175:3548190
3517877:3517892	attL	ATGATGCTTCACTTCG	NA	NA	NA	NA
WP_001120888.1|3519321_3520815_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_156734112.1|3520874_3521858_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_077782102.1|3522520_3523381_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_064754130.1|3523398_3524562_-	tetracycline-inactivating monooxygenase Tet(X)	NA	NA	NA	NA	NA
WP_044502095.1|3524558_3524936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082987283.1|3525230_3525476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|3525506_3527000_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|3527111_3527417_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_078081115.1|3528481_3529357_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001120888.1|3529866_3531360_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_156734129.1|3531777_3534756_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_000348524.1|3536929_3537373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497807.1|3537837_3538812_+	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_001995600.1|3538814_3539084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001218618.1|3539085_3540327_+|integrase	integrase family protein	integrase	A0A291AWU1	Escherichia_phage	39.8	1.3e-76
WP_000211147.1|3540456_3542475_-	DNA mismatch repair protein	NA	NA	NA	NA	NA
WP_000127615.1|3542620_3542809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075672703.1|3544010_3544457_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_075672704.1|3544425_3544836_-	DNA polymerase III subunit psi	NA	NA	NA	NA	NA
WP_075672705.1|3544965_3545982_+	16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC	NA	NA	NA	NA	NA
WP_075672706.1|3546404_3546668_-	DUF1435 family protein	NA	NA	NA	NA	NA
WP_156733366.1|3546918_3547374_-|transposase	IS200/IS605 family transposase	transposase	A0A0H3UZM0	Geobacillus_virus	36.7	2.5e-17
3548175:3548190	attR	ATGATGCTTCACTTCG	NA	NA	NA	NA
>prophage 14
NZ_CP045008	Proteus cibarius strain ZF2 chromosome, complete genome	4237246	3711885	3784168	4237246	tRNA,head,lysis,capsid,integrase,terminase,tail,holin,protease,portal	Proteus_phage(34.62%)	85	3740517:3740548	3780592:3780623
WP_075673537.1|3711885_3712836_-|holin	choline TMA-lyase-activating enzyme	holin	NA	NA	NA	NA
WP_156734205.1|3712936_3716365_-|holin	choline trimethylamine-lyase	holin	NA	NA	NA	NA
WP_075673539.1|3716421_3717570_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_036934514.1|3717577_3717841_-	EutN/CcmL family microcompartment protein	NA	NA	NA	NA	NA
WP_075673540.1|3717867_3719535_-	acetaldehyde dehydrogenase (acetylating)	NA	NA	NA	NA	NA
WP_006536328.1|3719607_3719886_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_006536329.1|3719900_3720185_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_004249182.1|3720205_3720484_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_006536331.1|3721160_3721679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075673541.1|3721678_3722539_-	winged helix family transcriptional regulator	NA	NA	NA	NA	NA
WP_075673542.1|3722565_3723153_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_156734207.1|3723524_3724388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075674388.1|3724514_3725789_-	bifunctional O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A0B5JD48	Pandoravirus	28.4	2.6e-19
WP_075674389.1|3726052_3726967_-	aromatic amino acid DMT transporter YddG	NA	NA	NA	NA	NA
WP_075673048.1|3727844_3728405_+	fimbrial protein	NA	NA	NA	NA	NA
WP_075673049.1|3728501_3729182_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_156734208.1|3729218_3731738_+	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_099660502.1|3731737_3732256_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_075673052.1|3732255_3733329_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_075673053.1|3733354_3733666_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	41.0	5.6e-08
WP_075673054.1|3733802_3734846_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_075673055.1|3734957_3735737_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_023583058.1|3735733_3736594_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	25.7	6.7e-11
WP_075673056.1|3736577_3737693_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	35.9	9.9e-31
WP_156734210.1|3738237_3739527_-	S8 family serine peptidase	NA	Q2A0D0	Sodalis_phage	33.1	1.3e-29
WP_075673058.1|3739687_3740275_-	CbrC family protein	NA	NA	NA	NA	NA
3740517:3740548	attL	TTGAACCGCTTCTCTGTTGCGCCGATGCTAGA	NA	NA	NA	NA
WP_156734212.1|3740574_3741978_-	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	64.1	1.3e-144
WP_156734214.1|3741982_3745750_-	DUF1983 domain-containing protein	NA	A0A1P8DTI4	Proteus_phage	95.2	0.0e+00
WP_115351040.1|3745769_3746348_-|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	99.5	1.3e-103
WP_023582500.1|3746419_3746920_-	hypothetical protein	NA	A0A1P8DTJ8	Proteus_phage	100.0	1.9e-87
WP_156734486.1|3747010_3747718_-	peptidase P60	NA	A0A1P8DTI6	Proteus_phage	97.9	7.6e-138
WP_156734216.1|3747723_3748473_-|tail	phage minor tail protein L	tail	A0A1P8DTI3	Proteus_phage	97.6	3.2e-142
WP_115350931.1|3748469_3748802_-|tail	phage tail protein	tail	A0A1P8DTI9	Proteus_phage	100.0	1.9e-62
WP_156734218.1|3748804_3752071_-|tail	phage tail tape measure protein	tail	A0A1P8DTH2	Proteus_phage	83.5	0.0e+00
WP_023582505.1|3752090_3752372_-	DUF4035 domain-containing protein	NA	A0A1P8DTH5	Proteus_phage	92.6	3.4e-41
WP_088495895.1|3752395_3752776_-|tail	phage tail protein	tail	A0A1P8DTJ2	Proteus_phage	100.0	7.9e-65
WP_036913331.1|3752778_3753246_-	hypothetical protein	NA	A0A1P8DTJ5	Proteus_phage	100.0	1.3e-80
WP_156734220.1|3753310_3753646_-	hypothetical protein	NA	A0A1P8DTJ3	Proteus_phage	98.2	9.1e-57
WP_156734222.1|3753642_3754083_-	hypothetical protein	NA	A0A1P8DTH7	Proteus_phage	97.9	3.5e-72
WP_023582510.1|3754079_3754403_-|head	phage head closure protein	head	A0A1P8DTK6	Proteus_phage	94.4	5.0e-52
WP_156734223.1|3754399_3754708_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	40.2	2.4e-11
WP_156734225.1|3754803_3756012_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	69.0	3.4e-154
WP_156734227.1|3756025_3756676_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	79.5	1.6e-94
WP_023582514.1|3756647_3757877_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	73.4	1.7e-177
WP_098943281.1|3757876_3758056_-	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	57.4	9.9e-10
WP_156734229.1|3758065_3759799_-|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	97.9	0.0e+00
WP_099660116.1|3759802_3760273_-|terminase	phage terminase small subunit P27 family	terminase	A0A1W6JP17	Morganella_phage	83.3	2.8e-72
WP_156734230.1|3760422_3760824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156734232.1|3760823_3761171_-	HNH endonuclease	NA	A0A1P8DTD1	Proteus_phage	92.9	5.9e-59
WP_156734234.1|3761234_3761612_-	hypothetical protein	NA	A0A1P8DTD7	Proteus_phage	59.7	3.9e-32
WP_156734236.1|3761601_3761913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156734430.1|3762729_3763218_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	90.2	6.8e-53
WP_036976899.1|3763219_3763552_-	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	70.3	4.4e-35
WP_004918415.1|3763538_3763832_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_004916901.1|3763828_3764218_-	membrane protein	NA	S4TRS4	Salmonella_phage	35.0	4.2e-13
WP_058336245.1|3764347_3764590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099660111.1|3764593_3764809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733239.1|3765128_3765377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041705231.1|3765448_3765661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733238.1|3765986_3766667_-	hypothetical protein	NA	A0A1W6JP37	Morganella_phage	49.1	5.2e-51
WP_156733237.1|3766694_3767720_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	45.9	7.5e-86
WP_156733236.1|3767716_3768523_-	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	62.1	8.8e-90
WP_036904907.1|3768541_3768925_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	53.7	1.7e-27
WP_023582529.1|3768987_3769158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036904905.1|3769157_3769550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156733235.1|3769546_3770185_-	phage N-6-adenine-methyltransferase	NA	K7PGU4	Enterobacteria_phage	66.7	9.8e-84
WP_156733234.1|3770181_3771303_-	replication protein 15	NA	K7PLZ7	Enterobacterial_phage	57.2	6.8e-48
WP_099660103.1|3771312_3771492_-	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	58.6	6.2e-12
WP_156734238.1|3771778_3772237_-	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	45.4	2.1e-27
WP_156734240.1|3772275_3772503_-	helix-turn-helix domain-containing protein	NA	A0A1C9IHV8	Salmonella_phage	50.0	2.3e-11
WP_156734242.1|3772599_3773256_+	helix-turn-helix domain-containing protein	NA	A0A1W6JNY2	Morganella_phage	74.9	4.7e-89
WP_156734244.1|3773345_3774359_+	hypothetical protein	NA	A4KWR9	Enterobacteria_phage	37.5	3.5e-59
WP_072070916.1|3774597_3774801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006533955.1|3775136_3775511_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	69.7	4.6e-41
WP_156734246.1|3775576_3776404_+	DUF2303 family protein	NA	U5P439	Shigella_phage	54.7	3.2e-79
WP_156734248.1|3776462_3776960_+	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	66.1	5.3e-45
WP_156734250.1|3776973_3777675_+	hypothetical protein	NA	A0A1W6JP46	Morganella_phage	58.3	1.6e-71
WP_156734251.1|3777667_3778255_+	hypothetical protein	NA	M1F3E2	Salmonella_phage	44.7	3.2e-33
WP_156734253.1|3778257_3778653_+	chromosome partitioning protein ParB	NA	S4TTI6	Salmonella_phage	52.8	3.7e-25
WP_072065179.1|3778710_3778956_+	pyocin activator PrtN family protein	NA	A0A1W6JP35	Morganella_phage	70.7	6.7e-25
WP_072065180.1|3778999_3779287_-	DinI-like family protein	NA	A0A1W6JP10	Morganella_phage	31.8	8.7e-08
WP_109402803.1|3779340_3780423_-|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	79.7	2.3e-170
WP_156734255.1|3780519_3781554_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
3780592:3780623	attR	TTGAACCGCTTCTCTGTTGCGCCGATGCTAGA	NA	NA	NA	NA
WP_075673060.1|3781621_3782605_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_036934568.1|3782758_3784168_+	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	75.4	1.7e-192
>prophage 15
NZ_CP045008	Proteus cibarius strain ZF2 chromosome, complete genome	4237246	4109920	4169337	4237246	transposase,tRNA,integrase	Escherichia_phage(30.0%)	48	4154712:4154771	4173114:4173934
WP_075672602.1|4109920_4110949_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_075672603.1|4111082_4111757_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_075672604.1|4111871_4112495_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.5	8.4e-64
WP_075672605.1|4112867_4114826_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	39.3	5.7e-90
WP_075672606.1|4114985_4115297_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_075672607.1|4115293_4116949_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_156734361.1|4117350_4118934_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_075673976.1|4125119_4125806_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075673975.1|4125888_4127283_+	multidrug transporter subunit MdtD	NA	NA	NA	NA	NA
WP_075673974.1|4127348_4128278_-	ribokinase	NA	NA	NA	NA	NA
WP_075673973.1|4128559_4130059_+	ATPase RavA	NA	NA	NA	NA	NA
WP_075673972.1|4130066_4131524_+	ATPase RavA stimulator ViaA	NA	NA	NA	NA	NA
WP_075673971.1|4131524_4132517_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	36.8	5.8e-51
WP_023583317.1|4132676_4133138_+	transcriptional regulator AsnC	NA	NA	NA	NA	NA
WP_075673970.1|4133238_4133679_+	FMN-binding protein MioC	NA	NA	NA	NA	NA
WP_075673969.1|4134056_4135955_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_099659560.1|4135951_4136578_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_075673967.1|4137191_4137569_+	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_023583322.1|4137600_4138425_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_004246596.1|4138470_4138710_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_036914499.1|4138771_4139242_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_006534344.1|4139254_4139788_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_075673966.1|4139802_4141344_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_006534342.1|4141402_4142266_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_023583323.1|4142300_4143683_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_006534340.1|4143704_4144121_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_075673965.1|4144273_4145647_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0G2Y8M0	Acanthamoeba_polyphaga_mimivirus	34.3	1.3e-29
WP_156734363.1|4145806_4147633_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1I9J5	Paramecium_bursaria_Chlorella_virus	45.1	4.3e-132
WP_001029679.1|4147792_4148614_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_000267723.1|4148600_4150709_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001276994.1|4150705_4152373_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_071538080.1|4153175_4154750_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	99.4	2.8e-87
4154712:4154771	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|4154774_4155479_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845039.1|4155753_4156767_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_002015823.1|4156765_4156924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063840321.1|4157058_4157613_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001749986.1|4157709_4158162_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000679427.1|4158384_4158732_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|4158725_4159565_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000050481.1|4159969_4161511_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_004236386.1|4162323_4163463_-	class C beta-lactamase DHA-1	NA	NA	NA	NA	NA
WP_004193231.1|4163573_4164449_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025999322.1|4164452_4164818_-	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_052238321.1|4164710_4165046_+	ethidium bromide resistance protein	NA	NA	NA	NA	NA
WP_000259031.1|4165039_4165879_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|4166006_4166507_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001163403.1|4167041_4167824_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
WP_001324342.1|4167813_4169337_-|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
4173114:4173934	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCGAATCTGCCTTGTTGTAGCGCGGAACTCAAGTGATATTTGCCTCTTGTGTTTGCATTCGAGCTAATCCGGCAGCACTATTACTCCCAAGGGTTCCAGCAGTTGCTCCTGTTGCCAGGCACAGATCTTGACTCCTTCGAGGTTGACCCGTCTGGGGTCGAGCCCATCCAGATCGGCAAAGGTCAGGTCACAGCCCCGCAGATTGACCTGTTGCCAACAGTCGCGGGAGAAGGTGCCGCGGCTGAGATCTGAGCCCATCAAGGAAGCGCCGCTGAGATTGGCATTGCTCCAGTTGTTTTCAAACAGCTCGCATTTTTCCAGGCATTGGCCACTCAAGTTGGTATAGGCCAGGTTGCAACCTGAGATATAAGCCGAGCAGAAGTACATCTTATGGCTGACTTGATTGTAGAAGCGGGCCCGGGAAAAGTTGGCGCCCTTGAGATCGCACTCCCTGAACTCTATGCCAAAGCAGTTGGCACCGCTGAAGTTGGCCAAAGACAGACGGCAGGCCTTGAAACTGGCATCGCGCAGATCGGCATAGCTGAAGTGACACCCTTCAACGGCGCCGCTTTCAATGAAACTGCAATCCTCGAAACTGGCATCCTGCAGCTGACAGTGGCTGAAGTCACACTGATAAAAGCGGCAGCGGCGAAAACGGCTGTCACTCAAATCCTGGCGTGAGAAATCCTCTTGCTGAAAAACTTTATCAATAATATCCATACGGCTTCCTTTAATCAGGGAGGGTGCTAACGGGTATAGGAAG	NA	NA	NA	NA
