The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046557	Leclercia sp. 1106151 chromosome, complete genome	4850895	387530	427445	4850895	integrase,transposase	Enterobacteria_phage(40.0%)	28	381240:381254	431697:431711
381240:381254	attL	CCGGAGCTGCTGGTG	NA	NA	NA	NA
WP_104009829.1|387530_387764_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	80.0	5.8e-10
WP_009652456.1|387776_387989_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_016154441.1|388279_388630_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_156653758.1|389611_390761_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.6	9.8e-50
WP_009652402.1|391346_391589_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_016154439.1|393515_393845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156653759.1|395386_396506_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.4	3.9e-51
WP_016154435.1|396797_397160_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_009654826.1|397205_398210_-	cation diffusion facilitator family transporter	NA	A0A1V0SED0	Indivirus	25.1	7.8e-19
WP_009654818.1|398395_400891_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.6	2.0e-92
WP_016154433.1|400904_401369_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_009654812.1|401458_401911_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_016154432.1|401992_404488_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.8	3.9e-144
WP_071687229.1|404562_404985_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_009654822.1|404974_405238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023302364.1|405550_406498_+	UDP-3-O-acyl-N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
WP_023336667.1|406717_407152_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_023302365.1|407301_410742_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016154430.1|411787_412240_-	peptide deformylase	NA	Q6VT21	Vibrio_phage	32.6	7.8e-11
WP_016154429.1|412416_413784_-	outer membrane porin, OprD family	NA	NA	NA	NA	NA
WP_016154425.1|415194_415407_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_016154424.1|415833_416571_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	32.6	9.7e-27
WP_094898333.1|418904_420144_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	79.4	1.4e-131
WP_016154418.1|420596_422558_-	DUF3732 domain-containing protein	NA	NA	NA	NA	NA
WP_016154417.1|422554_423043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016154416.1|423039_424263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156653760.1|424830_425853_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_016154414.1|426254_427445_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	54.7	1.5e-122
431697:431711	attR	CACCAGCAGCTCCGG	NA	NA	NA	NA
>prophage 2
NZ_CP046557	Leclercia sp. 1106151 chromosome, complete genome	4850895	1887607	1939402	4850895	capsid,tail,transposase,portal,lysis,tRNA,terminase,head,integrase,protease	Enterobacteria_phage(38.1%)	60	1887889:1887904	1918174:1918189
WP_103179129.1|1887607_1888099_+|transposase	transposase	transposase	NA	NA	NA	NA
1887889:1887904	attL	GCAGCCACGCTTCTGG	NA	NA	NA	NA
WP_103179130.1|1888238_1889360_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_103179131.1|1889449_1890913_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_039028964.1|1890913_1891585_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_103179175.1|1891709_1893080_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.2	6.5e-109
WP_103179176.1|1893099_1893729_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_139156335.1|1893756_1894866_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_103179178.1|1894907_1895381_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_156654295.1|1895373_1896045_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_156238412.1|1896162_1897413_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	6.7e-20
WP_156654296.1|1897530_1898661_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.8	2.0e-119
WP_114387395.1|1898641_1898887_-	excisionase	NA	NA	NA	NA	NA
WP_156654297.1|1898939_1901192_-	exonuclease	NA	K7PJT5	Enterobacteria_phage	63.0	1.5e-171
WP_156655460.1|1901329_1901659_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_156654298.1|1901674_1902010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156654299.1|1902175_1902358_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_156654300.1|1902750_1903140_-	helix-turn-helix domain-containing protein	NA	A0A077KGZ5	Edwardsiella_phage	68.6	2.8e-17
WP_156654301.1|1903248_1903488_+	helix-turn-helix domain-containing protein	NA	K7PKH4	Enterobacteria_phage	56.9	3.3e-16
WP_156654302.1|1903475_1904030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156654303.1|1904084_1904903_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	47.8	8.5e-56
WP_156654304.1|1904905_1905646_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	72.4	1.1e-97
WP_156654305.1|1905664_1906084_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_156654306.1|1906087_1906348_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	65.5	2.4e-25
WP_156654307.1|1906857_1908774_-	NACHT domain-containing protein	NA	NA	NA	NA	NA
WP_156654308.1|1909418_1909652_+	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	75.3	5.8e-26
WP_072010775.1|1909693_1909939_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	65.2	4.5e-21
WP_032617608.1|1910069_1910276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051916131.1|1910296_1910629_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	64.2	9.4e-38
WP_032617610.1|1910628_1911669_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	56.3	1.8e-106
WP_032617611.1|1911682_1912297_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	62.2	2.8e-64
WP_072010776.1|1913092_1913416_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_103179204.1|1913936_1914176_+|lysis	lysis protein	lysis	A0A2H4JCI1	uncultured_Caudovirales_phage	57.9	2.3e-17
WP_156654309.1|1914176_1914680_+	glycoside hydrolase family protein	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	76.6	6.5e-75
WP_156654310.1|1914669_1915122_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	56.5	3.3e-33
WP_156654311.1|1915132_1915426_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	70.1	7.5e-31
WP_156654312.1|1915769_1916120_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	80.7	4.6e-51
WP_032617619.1|1916116_1916317_+	hypothetical protein	NA	Q6UAR8	Klebsiella_phage	89.4	1.7e-10
WP_156654313.1|1916509_1916983_+|terminase	phage terminase small subunit P27 family	terminase	A0A1W6JP17	Morganella_phage	73.9	8.3e-64
WP_156654314.1|1916986_1918714_+|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	77.4	2.1e-269
1918174:1918189	attR	GCAGCCACGCTTCTGG	NA	NA	NA	NA
WP_156654315.1|1918713_1920018_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	90.8	1.4e-230
WP_156654316.1|1920026_1920881_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	76.8	2.8e-118
WP_114317019.1|1920893_1922114_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	95.6	8.1e-212
WP_156654317.1|1922166_1922352_+	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	60.0	2.4e-11
WP_156264399.1|1922361_1922688_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	53.7	1.5e-27
WP_156654318.1|1922684_1923026_+|head	phage head closure protein	head	A0A1J0GUY4	Halomonas_phage	48.6	1.1e-06
WP_156654319.1|1923022_1923472_+	hypothetical protein	NA	Q9MCS9	Enterobacteria_phage	83.9	1.2e-64
WP_156654320.1|1923468_1923798_+	DUF3168 domain-containing protein	NA	A0A1P8DTJ3	Proteus_phage	52.7	1.1e-22
WP_156654321.1|1923856_1924561_+|tail	phage tail protein	tail	Q9MCS7	Enterobacteria_phage	82.9	8.5e-105
WP_156654322.1|1924595_1924982_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	93.0	7.5e-63
WP_156654323.1|1924990_1925269_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	95.7	5.3e-42
WP_016042208.1|1925326_1925515_+	hypothetical protein	NA	K7PH36	Enterobacterial_phage	100.0	3.0e-25
WP_156654324.1|1928832_1929174_+|tail	phage tail protein	tail	E4WL34	Enterobacteria_phage	58.2	2.3e-31
WP_156654325.1|1929226_1929964_+|tail	phage minor tail protein L	tail	M9NYX1	Enterobacteria_phage	83.7	2.3e-124
WP_156654326.1|1929966_1930713_+	peptidase P60	NA	M9NZD8	Enterobacteria_phage	72.8	2.3e-108
WP_156654327.1|1930690_1931305_+|tail	tail assembly protein	tail	K7PH59	Enterobacterial_phage	69.3	4.7e-75
WP_156654328.1|1931358_1936308_+	DUF1983 domain-containing protein	NA	E4WL39	Enterobacteria_phage	76.9	0.0e+00
WP_156654329.1|1936372_1938034_+	hypothetical protein	NA	G8GWG3	Rhodobacter_phage	35.2	1.5e-22
WP_156654330.1|1938033_1938336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156654331.1|1938347_1939079_+	hypothetical protein	NA	A0A291AXP5	Shigella_phage	38.2	1.2e-24
WP_156654332.1|1939162_1939402_+	DNA polymerase V	NA	I6PD82	Cronobacter_phage	60.8	6.1e-23
>prophage 3
NZ_CP046557	Leclercia sp. 1106151 chromosome, complete genome	4850895	2201250	2211366	4850895		Escherichia_phage(16.67%)	9	NA	NA
WP_156654443.1|2201250_2203680_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	49.6	8.8e-218
WP_103824474.1|2203830_2204136_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_156654444.1|2204241_2204952_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_103179479.1|2204990_2205320_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_103179480.1|2205469_2205796_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	52.5	6.6e-20
WP_103179481.1|2205905_2207120_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	29.7	6.3e-47
WP_156654445.1|2207131_2208151_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	27.5	6.1e-19
WP_156654446.1|2208204_2209584_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.6	9.7e-28
WP_156654447.1|2209905_2211366_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.7	6.6e-43
>prophage 4
NZ_CP046557	Leclercia sp. 1106151 chromosome, complete genome	4850895	2786465	2948933	4850895	capsid,tail,transposase,holin,portal,lysis,tRNA,terminase,coat,head,integrase,protease	Enterobacteria_phage(24.11%)	181	2821876:2821903	2874676:2874703
WP_156654702.1|2786465_2787161_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_103180016.1|2787227_2789138_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.7	2.3e-88
WP_103180017.1|2789264_2789609_+	RidA family protein	NA	NA	NA	NA	NA
WP_039030781.1|2789614_2789797_-	YoaH family protein	NA	NA	NA	NA	NA
WP_103180019.1|2789858_2791211_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	41.7	1.6e-43
WP_103180020.1|2791214_2791793_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_156654703.1|2791976_2793341_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_156654704.1|2793505_2795098_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_103180023.1|2795098_2796658_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.0	7.3e-40
WP_114314650.1|2797121_2798099_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_103180025.1|2798157_2798955_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_103180026.1|2798958_2799819_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_103180027.1|2799876_2800335_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_139156373.1|2800722_2801286_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_156654705.1|2801282_2802098_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_103180030.1|2802161_2803880_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_001062678.1|2804099_2804309_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_032622791.1|2804334_2804466_-	YobF family protein	NA	NA	NA	NA	NA
WP_156654706.1|2806001_2806292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103180034.1|2806365_2806509_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_103180035.1|2806667_2806907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039030796.1|2806962_2807754_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_103180036.1|2807932_2809306_+	MFS transporter	NA	NA	NA	NA	NA
WP_103180037.1|2809353_2810235_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_103180038.1|2810430_2812479_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.0	1.4e-83
WP_103180039.1|2812498_2813182_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_103180040.1|2813279_2813777_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_103180041.1|2813908_2815192_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_156654707.1|2815160_2817794_+	MCE family protein	NA	NA	NA	NA	NA
WP_103180043.1|2817870_2819313_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_103181101.1|2819416_2819656_+	YebV family protein	NA	NA	NA	NA	NA
WP_039030805.1|2819760_2819952_+	YebW family protein	NA	NA	NA	NA	NA
WP_156654708.1|2819952_2820597_-	protein-serine/threonine phosphatase	NA	M9P0E4	Enterobacteria_phage	48.4	4.3e-55
WP_103181102.1|2820854_2821721_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
2821876:2821903	attL	ATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_032611732.1|2822598_2824077_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.8	1.3e-200
WP_032611763.1|2824094_2824922_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	42.0	3.7e-51
WP_156655494.1|2825033_2825357_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.0	9.2e-22
WP_156654709.1|2825704_2826703_-	hypothetical protein	NA	O64338	Escherichia_phage	49.8	3.1e-44
WP_156654710.1|2826714_2827017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156653759.1|2827219_2828339_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.4	3.9e-51
WP_156654711.1|2828349_2829921_-	hypothetical protein	NA	A0A0F7L427	uncultured_marine_virus	34.6	1.3e-25
WP_156654712.1|2829981_2834979_-	DUF1983 domain-containing protein	NA	G8C7R4	Escherichia_phage	44.5	4.7e-16
WP_156654713.1|2835034_2835628_-|tail	tail assembly protein	tail	G8C7R3	Escherichia_phage	88.0	2.9e-90
WP_156654714.1|2835615_2836347_-	peptidase P60	NA	G8C7R2	Escherichia_phage	92.1	7.4e-144
WP_082693158.1|2836359_2837133_-|tail	phage minor tail protein L	tail	G8C7R1	Escherichia_phage	87.5	3.6e-133
WP_156654715.1|2837129_2837480_-	hypothetical protein	NA	G8C7R0	Escherichia_phage	94.8	1.6e-56
WP_156654716.1|2837795_2838071_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_127472154.1|2838577_2838964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156654717.1|2839065_2842221_-|tail	phage tail tape measure protein	tail	G8C7Q6	Escherichia_phage	63.5	0.0e+00
WP_156654718.1|2842220_2842508_-	hypothetical protein	NA	I6PD79	Cronobacter_phage	58.5	2.7e-17
WP_156654719.1|2842525_2842864_-	hypothetical protein	NA	G8C7Q5	Escherichia_phage	83.0	1.4e-49
WP_156654720.1|2842928_2843861_-|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	93.5	5.1e-158
WP_156654721.1|2843908_2844358_-	hypothetical protein	NA	G8C7Q2	Escherichia_phage	92.6	1.3e-74
WP_156654722.1|2844347_2844947_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	88.9	5.0e-98
WP_156654723.1|2844949_2845303_-	hypothetical protein	NA	G8C7Q0	Escherichia_phage	88.9	7.9e-51
WP_156654724.1|2845304_2845787_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	86.2	1.0e-77
WP_156654725.1|2846185_2847322_-|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	92.3	3.2e-194
WP_156654726.1|2847338_2848091_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	91.6	1.6e-125
WP_156654727.1|2848197_2848407_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	53.0	2.0e-14
WP_156654728.1|2848410_2849517_-	hypothetical protein	NA	G8C7P5	Escherichia_phage	92.4	3.8e-192
WP_156654729.1|2849518_2850922_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	89.8	2.1e-240
WP_156654730.1|2850926_2852498_-|terminase	terminase	terminase	G8C7P3	Escherichia_phage	92.7	1.5e-306
WP_156654731.1|2852494_2853067_-|terminase	terminase small subunit	terminase	I6PDJ6	Cronobacter_phage	80.5	2.4e-65
WP_156654732.1|2853090_2853318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156654733.1|2853403_2853970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156654734.1|2854093_2854486_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	56.6	2.9e-30
WP_103179509.1|2854485_2855049_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	86.6	2.2e-79
WP_103179508.1|2855026_2855251_-|lysis	lysis protein	lysis	M9NZI9	Enterobacteria_phage	83.8	4.8e-30
WP_103179202.1|2855772_2856096_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_103179507.1|2856257_2856443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156654735.1|2857127_2857910_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	73.6	7.0e-108
WP_156654736.1|2857906_2858047_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	76.3	8.0e-07
WP_156654737.1|2858043_2858655_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	75.4	2.4e-79
WP_156655495.1|2858657_2858864_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	57.4	2.1e-16
WP_156654738.1|2858863_2859460_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	86.2	1.4e-95
WP_156654739.1|2859494_2859734_-	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	58.0	1.5e-16
WP_156654740.1|2860625_2861408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156654741.1|2861590_2861923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156655496.1|2861919_2862354_-	hypothetical protein	NA	F1C5B6	Cronobacter_phage	34.6	1.8e-09
WP_156654742.1|2862358_2862622_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	63.8	4.4e-22
WP_156654743.1|2862635_2863388_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	79.6	3.8e-111
WP_156655497.1|2863390_2864671_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	53.2	1.9e-102
WP_156654744.1|2864752_2865322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568772.1|2865333_2865552_-	hypothetical protein	NA	A0A0M4QX15	Salmonella_phage	64.8	1.5e-20
WP_156654745.1|2865624_2866038_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	75.0	4.0e-46
WP_156654746.1|2866173_2866647_+	hypothetical protein	NA	K7PLT9	Enterobacteria_phage	60.5	3.6e-51
WP_156654747.1|2866643_2867576_+	hypothetical protein	NA	K7PGT0	Enterobacteria_phage	50.8	8.1e-79
WP_103179488.1|2867945_2868152_+	cell division inhibitor protein	NA	K7PM31	Enterobacteria_phage	86.8	4.9e-29
WP_156654748.1|2868463_2871805_+	exodeoxyribonuclease	NA	K7P6V4	Enterobacteria_phage	62.7	0.0e+00
WP_156654749.1|2871816_2872932_+	enterohemolysin	NA	K7PKR8	Enterobacteria_phage	87.9	6.5e-184
WP_156654750.1|2872969_2873209_+	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	87.3	1.4e-30
WP_032611896.1|2873273_2873546_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	63.3	7.2e-28
WP_156654751.1|2873514_2874600_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	66.8	4.5e-145
WP_103180045.1|2874920_2875259_-	YebY family protein	NA	NA	NA	NA	NA
2874676:2874703	attR	ATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_156654752.1|2875273_2876146_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_103180047.1|2876147_2876513_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_103180048.1|2876649_2876880_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	66.2	5.3e-16
WP_103181103.1|2876987_2877644_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_103180049.1|2877668_2878331_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	38.5	6.5e-06
WP_156654753.1|2878312_2880394_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_156654754.1|2880484_2881132_-	DUF533 domain-containing protein	NA	NA	NA	NA	NA
WP_103180052.1|2881219_2881567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103180053.1|2881715_2882894_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_039030817.1|2882999_2883641_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_103180054.1|2883680_2885492_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_103180055.1|2885726_2887202_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.2	6.0e-76
WP_103180056.1|2887525_2888431_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_103180057.1|2888554_2889997_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_156654755.1|2890108_2891080_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_103180059.1|2891196_2892519_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.5e-14
WP_156655498.1|2892534_2893479_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_103180060.1|2893556_2894312_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.9	6.5e-18
WP_103180061.1|2894308_2895094_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_103180062.1|2895195_2896206_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	28.1	3.6e-08
WP_103180063.1|2896214_2896826_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_103180064.1|2896909_2897431_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	3.4e-10
WP_103180065.1|2897465_2898206_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_103180066.1|2898233_2898677_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_156654756.1|2898678_2900451_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_103180068.1|2900691_2901258_+	hydrolase	NA	NA	NA	NA	NA
WP_000497460.1|2901611_2901851_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	100.0	7.4e-37
WP_048217473.1|2901936_2902347_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_142489978.1|2902538_2902871_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	53.1	2.0e-19
WP_142489979.1|2902870_2903110_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	75.6	4.4e-29
WP_156654757.1|2904679_2904982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156654758.1|2904981_2906643_-	hypothetical protein	NA	A0A0F7L427	uncultured_marine_virus	37.9	8.9e-28
WP_156654759.1|2906707_2911636_-	DUF1983 domain-containing protein	NA	E4WL39	Enterobacteria_phage	42.6	5.2e-15
WP_156654760.1|2911689_2912304_-|tail	tail assembly protein	tail	K7PH59	Enterobacterial_phage	69.8	2.7e-75
WP_156654761.1|2912281_2913028_-	peptidase P60	NA	M9NZD8	Enterobacteria_phage	73.3	6.0e-109
WP_156654762.1|2913030_2913768_-|tail	phage minor tail protein L	tail	M9NYX1	Enterobacteria_phage	84.1	7.7e-125
WP_156654763.1|2913820_2914162_-|tail	phage tail protein	tail	E4WL34	Enterobacteria_phage	58.2	5.1e-31
WP_156654764.1|2914170_2917449_-|tail	phage tail tape measure protein	tail	A0A220NRN7	Escherichia_phage	71.3	0.0e+00
WP_156654765.1|2917489_2917831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156654766.1|2917901_2918165_-	DUF4035 domain-containing protein	NA	K7PLY6	Enterobacterial_phage	89.7	2.8e-37
WP_156654767.1|2918188_2918590_-|tail	phage tail protein	tail	K7P7C2	Enterobacteria_phage	88.7	5.1e-62
WP_156654768.1|2918643_2919114_-|tail	phage tail protein	tail	K7PJR9	Enterobacterial_phage	94.2	3.5e-78
WP_156654769.1|2919168_2919516_-	DUF3168 domain-containing protein	NA	K7P7Q9	Enterobacteria_phage	90.4	9.8e-54
WP_156654770.1|2919512_2919962_-	hypothetical protein	NA	K7PH84	Enterobacterial_phage	96.0	9.3e-73
WP_150320643.1|2919958_2920297_-|head	phage head closure protein	head	K7P7L2	Enterobacteria_phage	87.5	1.5e-51
WP_156654771.1|2920296_2920623_-	hypothetical protein	NA	K7PGU9	Enterobacterial_phage	93.5	5.9e-53
WP_057059277.1|2920657_2921815_-|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	96.4	2.0e-204
WP_156654772.1|2921817_2922495_-|head,protease	HK97 family phage prohead protease	head,protease	Q77W96	Enterobacteria_phage	93.8	2.2e-118
WP_156654773.1|2922512_2923787_-|portal	phage portal protein	portal	F1C584	Cronobacter_phage	98.3	5.8e-245
WP_156654774.1|2923786_2925301_-|terminase	terminase large subunit	terminase	Q9MCT1	Enterobacteria_phage	96.4	4.0e-285
WP_063922244.1|2925306_2925792_-	hypothetical protein	NA	K7PGU7	Enterobacterial_phage	92.5	2.6e-76
WP_156654775.1|2925975_2926179_-	hypothetical protein	NA	A0A220NRN5	Escherichia_phage	73.1	3.5e-19
WP_156654776.1|2926178_2926520_-	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	96.5	9.6e-62
WP_156654777.1|2926516_2927107_-	hypothetical protein	NA	K7P7D2	Enterobacteria_phage	87.2	3.7e-101
WP_156654778.1|2927088_2928546_-	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	72.0	6.1e-214
WP_156654779.1|2928670_2929084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156654780.1|2929181_2929475_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	67.0	8.3e-30
WP_156654781.1|2929471_2929666_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	73.4	5.7e-19
WP_156654782.1|2929616_2929892_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	84.3	8.3e-32
WP_156654783.1|2929899_2930529_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	87.6	8.7e-101
WP_156654784.1|2930528_2930810_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	46.0	2.0e-17
WP_063136051.1|2930796_2931183_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	95.3	3.3e-58
WP_156654785.1|2931290_2931446_-	DUF3927 domain-containing protein	NA	S4TRP5	Salmonella_phage	63.8	2.7e-08
WP_063160072.1|2931442_2931871_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	91.6	9.8e-64
WP_156654786.1|2932144_2932927_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.0	4.1e-108
WP_156654787.1|2932923_2933901_-	DNA primase	NA	F1C597	Cronobacter_phage	87.3	5.2e-169
WP_156654788.1|2933897_2935508_-	DEAD/DEAH box helicase	NA	F1C598	Cronobacter_phage	85.6	3.6e-276
WP_156654789.1|2935934_2936231_-	hypothetical protein	NA	A0A1B5FPB9	Escherichia_phage	69.3	1.7e-27
WP_156654790.1|2936214_2936448_-	helix-turn-helix domain-containing protein	NA	A0A2H4JEY0	uncultured_Caudovirales_phage	50.7	1.4e-11
WP_156654791.1|2936567_2937257_+	helix-turn-helix domain-containing protein	NA	F1C5C2	Cronobacter_phage	66.2	7.3e-85
WP_156654792.1|2937440_2937761_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	50.0	5.5e-19
WP_156654793.1|2937750_2937948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156654794.1|2938127_2938352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156654795.1|2938352_2938733_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	71.8	3.9e-40
WP_156654796.1|2938924_2939143_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	72.2	1.5e-20
WP_156654797.1|2939139_2939646_+	hypothetical protein	NA	F1C5A2	Cronobacter_phage	54.8	2.1e-52
WP_156655499.1|2939658_2940516_+	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	78.5	6.0e-129
WP_063135773.1|2940508_2940931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156654798.1|2940923_2941169_+	excisionase	NA	Q8W657	Enterobacteria_phage	85.5	7.1e-35
WP_156654799.1|2941224_2942538_+	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	87.2	9.0e-225
WP_156654800.1|2942516_2943290_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	81.9	3.1e-60
WP_103180070.1|2943340_2943736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103180071.1|2943776_2944517_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	31.7	1.8e-25
WP_103822389.1|2944513_2945485_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_156654801.1|2945636_2946380_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_156655500.1|2946464_2947025_-	VOC family protein	NA	NA	NA	NA	NA
WP_103180075.1|2947199_2948933_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.9	1.5e-86
>prophage 5
NZ_CP046557	Leclercia sp. 1106151 chromosome, complete genome	4850895	3563552	3680133	4850895	capsid,tail,integrase,transposase,portal,lysis,tRNA,terminase,head,protease,plate	Salmonella_phage(47.56%)	123	3608353:3608398	3642228:3642273
WP_103180761.1|3563552_3564290_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_103180762.1|3564422_3565751_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	29.3	2.5e-41
WP_103180763.1|3565802_3566186_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	68.9	5.8e-31
WP_103180764.1|3566500_3567190_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.3	9.3e-56
WP_103180765.1|3567283_3568369_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_103180766.1|3568575_3568995_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	36.5	7.0e-14
WP_103180767.1|3569066_3569765_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_156655042.1|3569800_3572464_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_103180769.1|3572574_3573930_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_103181124.1|3573973_3574297_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_156655043.1|3574293_3575601_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.2	2.2e-42
WP_103180771.1|3575753_3576209_-	DUF4385 domain-containing protein	NA	A0A0C5AAP9	Cyanophage	48.7	1.0e-34
WP_103180772.1|3581879_3584453_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.1	3.8e-126
WP_156655044.1|3584582_3585314_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_103180774.1|3585310_3586291_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_103180775.1|3586421_3587159_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_032613238.1|3587430_3587772_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_103180776.1|3588030_3589191_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_156655045.1|3589187_3590060_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_103180778.1|3590120_3591242_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_103180779.1|3591252_3592323_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	52.1	4.8e-91
WP_156655508.1|3592536_3592911_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_103180781.1|3593110_3593596_+	YfiR family protein	NA	NA	NA	NA	NA
WP_156655046.1|3593588_3594809_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_156655047.1|3594792_3596160_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_103181125.1|3596213_3596540_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914145.1|3596739_3597087_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_103180784.1|3597128_3597896_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_103180785.1|3597926_3598463_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003863133.1|3598481_3598730_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_103180786.1|3598982_3600344_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_103180787.1|3600510_3601302_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_156655048.1|3601320_3602607_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_139156362.1|3602660_3603254_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_103180790.1|3603375_3604254_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_114317036.1|3604339_3606001_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_103180792.1|3606152_3606494_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_156655509.1|3606589_3606862_-	RnfH family protein	NA	NA	NA	NA	NA
WP_103180794.1|3606866_3607343_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_103180795.1|3607460_3607943_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.2	8.9e-29
3608353:3608398	attL	ATGTAGAAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAA	NA	NA	NA	NA
WP_156655049.1|3608513_3608729_-	late control protein B	NA	Q53ZE7	Salmonella_virus	69.4	7.9e-22
WP_156655050.1|3608798_3609896_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	85.0	4.5e-177
WP_156655051.1|3609892_3610378_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	92.4	8.5e-64
WP_156655052.1|3610374_3613449_-|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	76.6	0.0e+00
WP_007848878.1|3613441_3613561_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	92.3	3.3e-14
WP_156655053.1|3613575_3613878_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	94.0	4.4e-42
WP_156655054.1|3613932_3614448_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	9.6e-90
WP_059307183.1|3614457_3615630_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	92.6	1.6e-209
WP_156655055.1|3615830_3616292_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	51.4	1.0e-13
WP_156655056.1|3619238_3619760_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	61.8	3.1e-59
WP_059307179.1|3619752_3620661_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	77.2	7.1e-120
WP_059307178.1|3620647_3621007_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	89.1	5.5e-52
WP_156655057.1|3621003_3621582_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	90.6	2.6e-99
WP_156655510.1|3621664_3622561_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	48.1	1.4e-75
WP_156655058.1|3622550_3623000_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	81.1	5.7e-62
WP_156655059.1|3622992_3623424_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	91.6	7.1e-70
WP_156655060.1|3623519_3623945_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	94.3	3.0e-65
WP_156655061.1|3623944_3624322_-	peptidase	NA	A0A1S6KZZ2	Salmonella_phage	56.8	4.1e-29
WP_156655062.1|3624326_3624836_-	glycoside hydrolase family protein	NA	E5G6N1	Salmonella_phage	75.1	9.9e-71
WP_039029573.1|3624816_3625032_-	membrane protein	NA	E5G6N0	Salmonella_phage	90.1	1.0e-29
WP_039029574.1|3625035_3625239_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	97.0	4.2e-33
WP_156655063.1|3625238_3625703_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	91.6	1.2e-78
WP_156655064.1|3625796_3626447_-	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	95.8	1.2e-110
WP_156655065.1|3626450_3627512_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	94.6	3.2e-188
WP_156655066.1|3627528_3628362_-|capsid	capsid protein	capsid	A0A1S6KZW9	Salmonella_phage	89.5	5.0e-120
WP_156655067.1|3628504_3630271_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	95.6	0.0e+00
WP_109866361.1|3630270_3631320_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	90.2	1.6e-176
WP_109866360.1|3631372_3632044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152159316.1|3632403_3633198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152159315.1|3633201_3633402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152159314.1|3633619_3633853_-	DinI-like family protein	NA	A0A1S6L014	Salmonella_phage	84.4	3.0e-30
WP_152159313.1|3633863_3634052_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	96.8	1.0e-25
WP_156655068.1|3634206_3636600_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.5	0.0e+00
WP_156655069.1|3636596_3637448_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	E5G6L8	Salmonella_phage	70.9	3.4e-116
WP_156655070.1|3637444_3637672_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	66.7	1.9e-21
WP_156655071.1|3637671_3637905_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	77.9	2.7e-23
WP_156655072.1|3637972_3638314_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	83.2	5.1e-47
WP_156655073.1|3638277_3638478_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	87.7	2.6e-27
WP_156655074.1|3638485_3638995_-	hypothetical protein	NA	A0A1S6L008	Salmonella_phage	91.7	3.0e-83
WP_057060132.1|3639027_3639270_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	96.2	5.2e-38
WP_156655075.1|3639389_3640022_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	91.0	3.4e-105
WP_156655076.1|3640023_3641040_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S6L016	Salmonella_phage	92.3	2.0e-187
WP_156655077.1|3641053_3642022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156655078.1|3642438_3643359_+	hypothetical protein	NA	NA	NA	NA	NA
3642228:3642273	attR	ATGTAGAAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAA	NA	NA	NA	NA
WP_156655079.1|3643764_3644154_-	LexA family transcriptional regulator	NA	Q6UAV9	Klebsiella_phage	67.4	4.5e-47
WP_156655080.1|3644153_3644393_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	73.4	2.6e-29
WP_156655081.1|3645470_3646490_-	hypothetical protein	NA	O64338	Escherichia_phage	48.5	1.2e-43
WP_156655082.1|3646480_3646783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156655083.1|3646782_3648462_-	hypothetical protein	NA	A0A0F7L427	uncultured_marine_virus	37.2	2.0e-27
WP_156655084.1|3648526_3653452_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	59.7	0.0e+00
WP_156655085.1|3653504_3654104_-|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	77.0	3.1e-79
WP_156655086.1|3654157_3654496_-	hypothetical protein	NA	Q6UAW3	Klebsiella_phage	45.5	1.5e-19
WP_156655087.1|3654519_3655230_-	peptidase P60	NA	K7PGV2	Enterobacterial_phage	86.9	2.4e-131
WP_156655088.1|3655231_3655987_-|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	87.3	2.6e-128
WP_156655089.1|3655983_3656331_-|tail	phage tail protein	tail	K7P7G7	Enterobacteria_phage	67.0	4.4e-38
WP_156655090.1|3656330_3658835_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	66.0	1.0e-293
WP_156655091.1|3658815_3659124_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	53.1	1.5e-21
WP_156655092.1|3659144_3659567_-|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	40.9	9.5e-19
WP_156655093.1|3659596_3660334_-|tail	phage tail protein	tail	M9NYX0	Enterobacteria_phage	72.7	1.5e-96
WP_156655094.1|3660341_3660740_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	63.6	8.0e-44
WP_097455164.1|3660736_3661291_-|tail	phage tail protein	tail	K7PKQ5	Enterobacteria_phage	62.7	1.5e-43
WP_156655095.1|3661301_3661577_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_156655096.1|3661569_3661893_-	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	53.3	6.3e-23
WP_156655097.1|3661973_3663971_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	86.0	0.0e+00
WP_156655098.1|3663915_3665421_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	73.1	6.3e-214
WP_156655099.1|3665417_3665639_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	67.6	2.5e-18
WP_156655100.1|3665635_3667738_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	77.2	0.0e+00
WP_097455171.1|3667737_3668226_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	79.6	4.9e-67
WP_156655101.1|3668413_3668719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156653759.1|3668754_3669875_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.4	3.9e-51
WP_156655102.1|3670089_3671079_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.3	1.1e-131
WP_156655103.1|3671075_3671762_-	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	54.2	1.2e-58
WP_156655104.1|3671777_3672164_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	81.4	2.3e-56
WP_156655511.1|3672160_3672466_-	LexA family transcriptional regulator	NA	S5FXP5	Shigella_phage	50.5	2.9e-17
WP_156655105.1|3672477_3673707_-	phage N-6-adenine-methyltransferase	NA	K7PGU4	Enterobacteria_phage	77.9	5.6e-104
WP_156655106.1|3673703_3674168_-	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	28.6	8.9e-10
WP_156655107.1|3674164_3674926_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	60.3	2.1e-64
WP_156655108.1|3674879_3675098_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.4	2.5e-15
WP_156655109.1|3675261_3675813_-	DNA-binding protein	NA	S5FXP0	Shigella_phage	61.2	4.1e-62
WP_156655110.1|3675841_3676051_-	cell division protein	NA	NA	NA	NA	NA
WP_156655111.1|3676148_3676796_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	40.2	8.2e-38
WP_156655112.1|3677142_3677631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156655113.1|3678960_3680133_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	68.6	7.2e-149
