The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044376	Klebsiella pneumoniae strain 2018S06-082 chromosome, complete genome	5308286	1577150	1604675	5308286	tail,holin,transposase,bacteriocin,terminase	Escherichia_phage(29.41%)	29	NA	NA
WP_156657436.1|1577150_1580699_-|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	30.9	1.9e-83
WP_096834935.1|1580863_1581232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156657438.1|1581242_1581797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074181930.1|1581927_1582134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043906941.1|1582271_1582754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096834933.1|1582808_1583981_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.4e-22
WP_015958312.1|1584004_1584397_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_012967909.1|1584393_1584945_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	5.9e-29
WP_044612633.1|1585317_1585551_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	48.5	5.8e-10
WP_156657439.1|1585552_1585963_-	protein singed	NA	NA	NA	NA	NA
WP_102025577.1|1585966_1586179_-	hypothetical protein	NA	G8C7P8	Escherichia_phage	52.2	4.9e-08
WP_156657440.1|1589490_1590834_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	74.2	8.7e-183
WP_156657442.1|1590838_1592143_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	60.0	4.8e-146
WP_156657443.1|1592120_1593116_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	43.8	2.0e-35
WP_156657445.1|1593476_1593653_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_156657447.1|1593744_1594197_-	hypothetical protein	NA	H9C186	Pectobacterium_phage	79.3	2.2e-53
WP_156657448.1|1595609_1596772_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	43.4	2.5e-53
WP_156657450.1|1596936_1597182_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	1.3e-33
WP_156657451.1|1597289_1597520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156657453.1|1597886_1598171_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	71.3	3.6e-30
WP_012967892.1|1599269_1599551_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	72.0	3.8e-32
WP_156657454.1|1600498_1601125_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_060876507.1|1601377_1602193_-	molecular chaperone	NA	A0A286N2Q2	Klebsiella_phage	73.3	3.1e-106
WP_156657456.1|1602189_1602486_-	DUF1364 family protein	NA	A0A0U2KD41	Escherichia_phage	70.8	1.1e-34
WP_022065463.1|1602478_1602649_-	protein NinE-like protein from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	92.5	2.9e-19
WP_156657457.1|1602648_1603104_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.2	1.0e-58
WP_022066186.1|1603280_1603799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053810488.1|1604134_1604320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060876503.1|1604414_1604675_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 2
NZ_CP044376	Klebsiella pneumoniae strain 2018S06-082 chromosome, complete genome	5308286	1610328	1615315	5308286		Escherichia_phage(33.33%)	8	NA	NA
WP_000158004.1|1610328_1610532_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	95.5	5.2e-31
WP_124988779.1|1610528_1610897_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	3.2e-10
WP_060876500.1|1610889_1611603_-	Replication protein P	NA	A0A0N7BTP7	Escherichia_phage	57.1	5.8e-69
WP_032443373.1|1612589_1612850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023282479.1|1613415_1613649_-	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	63.2	3.4e-18
WP_156657459.1|1613690_1614443_+	LexA family transcriptional repressor	NA	A0A286S2B2	Klebsiella_phage	66.4	4.1e-73
WP_156657460.1|1614959_1615151_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_156657462.1|1615159_1615315_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	71.2	2.0e-14
>prophage 3
NZ_CP044376	Klebsiella pneumoniae strain 2018S06-082 chromosome, complete genome	5308286	1618502	1623326	5308286	tRNA	Escherichia_phage(42.86%)	7	NA	NA
WP_156657463.1|1618502_1619591_+	enterohemolysin	NA	H6WRX0	Salmonella_phage	56.5	1.4e-106
WP_156657465.1|1619625_1620273_+	hypothetical protein	NA	R9VWB9	Serratia_phage	53.1	5.7e-55
WP_023159473.1|1620269_1620578_+	hypothetical protein	NA	I6PD68	Cronobacter_phage	55.9	7.1e-24
WP_032430507.1|1620585_1620825_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	82.1	6.1e-31
WP_023159475.1|1620889_1621102_+	excisionase	NA	A0A0U2RY08	Escherichia_phage	71.8	1.1e-23
WP_040206282.1|1621103_1622342_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	67.1	1.3e-161
WP_156657467.1|1622390_1623326_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	94.1	3.1e-139
>prophage 4
NZ_CP044376	Klebsiella pneumoniae strain 2018S06-082 chromosome, complete genome	5308286	5160399	5169996	5308286	integrase	Enterobacteria_phage(83.33%)	11	5145490:5145505	5180149:5180164
5145490:5145505	attL	TTTGATCAGCGCGGCA	NA	NA	NA	NA
WP_156658560.1|5160399_5162733_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	82.9	0.0e+00
WP_064145154.1|5162747_5163068_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_064145153.1|5163064_5163292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156658672.1|5163288_5163672_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.4	7.5e-31
WP_064145150.1|5164639_5165377_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	63.7	6.4e-79
WP_000984213.1|5165373_5165634_+	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	67.9	6.4e-26
WP_064145149.1|5165633_5166197_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.8	2.6e-56
WP_156658673.1|5166414_5166798_-	protein kinase	NA	NA	NA	NA	NA
WP_156658561.1|5166730_5167297_-	protein kinase	NA	NA	NA	NA	NA
WP_064145147.1|5167531_5168779_-	DUF3644 domain-containing protein	NA	NA	NA	NA	NA
WP_156658562.1|5168775_5169996_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	49.0	7.8e-106
5180149:5180164	attR	TGCCGCGCTGATCAAA	NA	NA	NA	NA
>prophage 1
NZ_CP044377	Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence	310104	0	6287	310104		Bacillus_phage(100.0%)	2	NA	NA
WP_046654924.1|4821_5175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156658674.1|5495_6287_+	NgrC	NA	A0A219UQS0	Bacillus_phage	31.8	3.1e-10
>prophage 2
NZ_CP044377	Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence	310104	15041	20349	310104		Salmonella_phage(42.86%)	9	NA	NA
WP_004026417.1|15041_15362_+	hypothetical protein	NA	J9Q750	Salmonella_phage	50.9	2.2e-28
WP_004026416.1|15442_15757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087761868.1|15875_16127_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	75.3	5.4e-22
WP_156658675.1|16291_16510_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	66.7	4.4e-20
WP_156658676.1|16603_17101_+	hypothetical protein	NA	A0A076G835	Escherichia_phage	57.6	1.5e-23
WP_004197241.1|17097_17286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004883219.1|17987_18632_+	hypothetical protein	NA	A0A0U4JEF1	Pseudomonas_phage	39.8	1.4e-05
WP_004197228.1|19048_19435_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	85.1	3.7e-17
WP_153236429.1|20013_20349_+	hypothetical protein	NA	J9Q804	Salmonella_phage	51.4	3.3e-14
>prophage 3
NZ_CP044377	Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence	310104	24251	25920	310104		Salmonella_phage(50.0%)	2	NA	NA
WP_004197222.1|24251_25019_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	62.7	3.5e-43
WP_049131032.1|25470_25920_+	hypothetical protein	NA	A0A1I9KFG8	Aeromonas_phage	34.5	1.1e-12
>prophage 4
NZ_CP044377	Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence	310104	39929	42248	310104		Pseudomonas_phage(50.0%)	2	NA	NA
WP_004152765.1|39929_41414_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_156652404.1|41825_42248_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	49.3	6.3e-31
>prophage 5
NZ_CP044377	Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence	310104	45692	236708	310104	transposase	Escherichia_phage(17.24%)	107	NA	NA
WP_000589001.1|45692_47033_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001515348.1|47675_48248_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_100280317.1|49415_49610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|49634_49874_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|49873_50161_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_156658678.1|51600_51972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095465480.1|52038_52374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156652396.1|52839_53028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029884711.1|53472_53850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156652395.1|54176_54473_+	hydrogenase expression/formation protein HypD	NA	NA	NA	NA	NA
WP_156658679.1|54541_55609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042935952.1|56189_56423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042935918.1|56964_57321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156658680.1|57374_58148_-	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	46.7	1.5e-09
WP_156652394.1|59293_59968_-	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
WP_156658681.1|63194_66143_-	conjugal transfer protein TraI	NA	NA	NA	NA	NA
WP_004196318.1|66156_66945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156658709.1|66944_67409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071528223.1|68347_68761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156658682.1|68952_69477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196331.1|69493_70036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196361.1|70401_71439_+	thioredoxin	NA	NA	NA	NA	NA
WP_004181920.1|71482_72838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181922.1|76860_77166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196338.1|78053_78410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156650867.1|81206_82283_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_156652391.1|84218_84833_-	lytic transglycosylase	NA	NA	NA	NA	NA
WP_156652390.1|84965_85694_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_156652389.1|85710_86016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156652388.1|86029_86371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156652387.1|86434_86644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156652414.1|88637_89078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156652386.1|89119_89434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156652384.1|91431_91662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156658683.1|91652_91964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156658684.1|91960_92704_+	hypothetical protein	NA	A0A2H4PQP5	Staphylococcus_phage	27.7	1.9e-06
WP_032164002.1|96006_96762_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_156652413.1|96876_97032_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_156652382.1|97051_97246_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001706973.1|101363_102170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000214164.1|103920_104103_-|transposase	transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	98.2	1.3e-25
WP_156658685.1|106699_107446_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_156658686.1|113620_114163_-	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_000379665.1|114451_114748_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001088742.1|115053_115614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001446018.1|115711_116044_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001214166.1|116246_116681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001556591.1|116680_119047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156658687.1|122254_123658_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|123686_124319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156658688.1|125706_126525_-	DNA repair protein	NA	NA	NA	NA	NA
WP_156658689.1|126635_127130_-	nuclease	NA	A0A1X6WF84	Pacmanvirus	34.3	7.5e-07
WP_156658690.1|131399_132158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117109815.1|135684_136389_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	6.9e-139
WP_156658691.1|136878_137988_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	2.8e-33
WP_156658692.1|139361_139970_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_156658693.1|140016_140721_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	97.9	3.2e-136
WP_000608644.1|141359_142622_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_156652373.1|143208_143550_+	RamA family antibiotic efflux transcriptional regulator	NA	D0R0F8	Streptococcus_phage	28.7	9.7e-06
WP_156652372.1|144584_146021_+	glutathione synthase	NA	NA	NA	NA	NA
WP_156658694.1|146438_147443_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_032193599.1|147941_148646_-	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	28.7	6.4e-20
WP_156658695.1|148675_149380_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	5.8e-138
WP_040178261.1|149404_150655_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000134999.1|150894_151536_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_001082319.1|152358_153162_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_156658710.1|153161_154115_+	APH(6)-I family aminoglycoside O-phosphotransferase	NA	NA	NA	NA	NA
WP_156658696.1|154334_155150_+	APH(3')-I family aminoglycoside O-phosphotransferase	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	97.8	1.1e-159
WP_156658697.1|155450_156149_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.9e-134
WP_001100942.1|156836_157484_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_156652370.1|163114_163699_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	28.6	1.8e-12
WP_156652368.1|168066_169023_+	citrate lyase subunit beta	NA	NA	NA	NA	NA
WP_004210261.1|171193_171832_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_078207732.1|176027_177527_+	kinase	NA	NA	NA	NA	NA
WP_094320090.1|178660_178984_-	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
WP_000156884.1|181297_182320_-|transposase	IS110-like element IS5708 family transposase	transposase	NA	NA	NA	NA
WP_156658698.1|184092_185175_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	98.1	5.0e-189
WP_156658699.1|188420_189674_+	lactose permease	NA	NA	NA	NA	NA
WP_003846919.1|189730_189901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156652359.1|192481_192796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156658711.1|193039_193492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156652358.1|195792_196869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197570.1|197032_198100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197551.1|200508_200937_-	peptidase S24	NA	A0A1W6JNS2	Morganella_phage	39.5	1.3e-15
WP_004197545.1|201032_201305_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_076611975.1|201429_202189_+|transposase	IS5-like element ISKpn12 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	38.8	2.0e-11
WP_004197549.1|203081_203267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587836.1|204524_204818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000027057.1|205831_206692_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|206874_207432_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_156658700.1|207853_208552_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	98.3	1.2e-135
WP_011264039.1|208631_208871_+	macrolide transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	46.2	9.5e-08
WP_151292569.1|209016_209880_+	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_001354008.1|209917_210163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|210631_211423_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_000800531.1|212601_212934_-	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_001261740.1|215506_216298_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_156658701.1|216355_216964_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_001456218.1|217059_217902_-	alpha/beta fold putative hydrolase EstX	NA	NA	NA	NA	NA
WP_000147567.1|219760_220321_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_156652363.1|223352_224357_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_004026538.1|226972_228049_-	DUF3150 domain-containing protein	NA	NA	NA	NA	NA
WP_004186944.1|228141_229194_-	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_156658702.1|230603_231599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025368601.1|234019_234268_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_004181778.1|234257_234542_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	59.1	4.7e-22
WP_040120489.1|236282_236708_-|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	51.5	1.8e-33
>prophage 6
NZ_CP044377	Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence	310104	268009	269188	310104		Salmonella_phage(100.0%)	1	NA	NA
WP_004026500.1|268009_269188_+	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	33.0	9.1e-19
>prophage 7
NZ_CP044377	Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence	310104	275818	277066	310104		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004181813.1|275818_277066_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	23.0	1.4e-12
>prophage 8
NZ_CP044377	Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence	310104	282133	283108	310104	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_012478345.1|282133_283108_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
>prophage 9
NZ_CP044377	Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence	310104	291462	294813	310104		Escherichia_phage(33.33%)	6	NA	NA
WP_156652415.1|291462_291873_+	DNA-binding protein	NA	Q71TH9	Escherichia_phage	60.0	1.3e-41
WP_004196726.1|292057_292417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026468.1|292647_293091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026466.1|293345_293606_+	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	41.0	5.9e-11
WP_004196690.1|293638_294073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026464.1|294069_294813_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	49.6	1.8e-60
>prophage 10
NZ_CP044377	Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence	310104	301696	306657	310104	transposase	Enterobacteria_phage(66.67%)	6	NA	NA
WP_156658707.1|301696_302317_-	Eac protein	NA	A0A075B8I7	Enterobacteria_phage	47.0	4.8e-51
WP_004181834.1|302383_302602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046654927.1|303510_303828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046654926.1|303857_304247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156658712.1|304624_305137_+	hypothetical protein	NA	K7PM35	Enterobacteria_phage	34.7	8.3e-09
WP_012478345.1|305682_306657_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
>prophage 1
NZ_CP044378	Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-2, complete sequence	149953	18476	52161	149953	integrase,transposase	Salmonella_phage(41.67%)	27	22722:22752	48100:48130
WP_156658743.1|18476_19868_-|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
WP_012477564.1|20615_21206_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_156658714.1|22238_22568_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	43.0	1.5e-08
22722:22752	attL	CCGCAGAATTCGGAAAAAATCGTACGCTAAG	NA	NA	NA	NA
WP_156658744.1|22903_24244_-	HAMP domain-containing protein	NA	A0A1B0VAH3	Salmonella_phage	100.0	1.6e-51
WP_138663954.1|24325_25009_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.8e-131
WP_156658715.1|24920_25100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156658716.1|25659_26619_+	resolvase	NA	NA	NA	NA	NA
WP_001445143.1|28352_28604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|28497_28800_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|28886_29702_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_156658717.1|30031_30208_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.7e-06
WP_156658718.1|31281_31965_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	98.6	8.7e-131
WP_000219391.1|32106_33012_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_156658719.1|34245_34830_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_156658720.1|36629_37835_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_156652363.1|38062_39067_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_156658721.1|39248_39521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|39648_40488_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|40481_40829_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|40992_41784_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|41789_42080_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_151292574.1|42191_42689_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.1	4.1e-21
WP_151295363.1|42833_43847_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.8e-71
WP_000454193.1|44048_44399_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_032446871.1|44651_45134_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	9.7e-60
WP_156658722.1|49688_50564_-	CTX-M family class A extended-spectrum beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	81.7	2.3e-123
48100:48130	attR	CTTAGCGTACGATTTTTTCCGAATTCTGCGG	NA	NA	NA	NA
WP_000608644.1|50898_52161_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
