The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046527	Escherichia coli strain RM19259 chromosome, complete genome	5511015	381	28802	5511015	holin,transposase,integrase	Enterobacteria_phage(31.71%)	48	3938:3952	28927:28941
WP_000539792.1|381_528_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|527_1097_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|1367_1901_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_000284506.1|1905_2121_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290230.1|2198_2444_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|2484_2664_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000142932.1|2800_4747_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
3938:3952	attL	AACCAGCGCACCAAA	NA	NA	NA	NA
WP_001356551.1|5550_5703_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_001204769.1|5954_6389_-	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_000971055.1|6474_6615_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|6611_6974_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774488.1|6970_7261_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_000224916.1|7253_7424_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_001054341.1|7423_7879_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	1.1e-60
WP_001303586.1|7875_7977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881075.1|8093_8891_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001302427.1|8900_9452_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000709082.1|9916_11443_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_032102575.1|11500_11608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070451.1|11699_12032_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|12099_12402_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_085948178.1|12890_14103_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001415640.1|14409_15339_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.4	3.6e-111
WP_001182899.1|15425_15965_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_001067457.1|16034_16265_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	69.3	3.8e-22
WP_000858974.1|16369_17059_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000380252.1|17139_18201_+	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
WP_000866321.1|18178_18556_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000233576.1|19036_19243_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995439.1|19318_19615_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|19620_20406_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186740.1|20402_21080_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_001303590.1|21079_21262_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000548547.1|21234_21426_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001444000.1|21436_21718_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763383.1|21816_22038_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289954.1|22034_22982_+	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_001356547.1|22983_23160_+	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_000207903.1|23493_23850_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_000610375.1|23846_24209_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000457728.1|24296_24539_+	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000556581.1|24542_24677_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	97.7	1.4e-21
WP_001193437.1|24695_24950_+	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063648.1|24983_26270_+|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_027868261.1|26290_26992_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_001216963.1|27051_27159_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|27139_27871_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569336.1|27875_28802_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
28927:28941	attR	AACCAGCGCACCAAA	NA	NA	NA	NA
>prophage 2
NZ_CP046527	Escherichia coli strain RM19259 chromosome, complete genome	5511015	243787	342561	5511015	lysis,protease,tail,terminase,integrase,transposase,portal,holin,tRNA,capsid	Escherichia_phage(45.16%)	120	265367:265383	339589:339605
WP_001283590.1|243787_244600_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289184.1|244599_245613_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699109.1|245678_246815_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.8	3.1e-24
WP_000615802.1|246913_247909_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127753.1|247905_249084_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817183.1|249358_250579_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683769.1|250737_252744_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|252864_253143_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089225.1|253176_253725_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447361.1|253724_254534_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043834.1|254533_255358_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001297933.1|255361_256447_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001302029.1|256481_257414_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730817.1|257579_258131_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001301548.1|258301_259144_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000794741.1|259145_259667_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001301662.1|259899_260073_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000822672.1|260069_260540_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000675435.1|260536_261037_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000182852.1|261047_261806_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001112844.1|261828_264468_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000033336.1|264549_265113_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
265367:265383	attL	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_001195817.1|265758_266244_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000426146.1|266446_268591_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531969.1|268590_269901_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030901.1|270080_270365_-	DUF406 family protein	NA	NA	NA	NA	NA
WP_001301981.1|270736_272077_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000952959.1|272441_273473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|273867_274623_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|274916_275849_+	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000331680.1|276070_284446_-	hypothetical protein	NA	A0A0P0ZCC7	Stx2-converting_phage	100.0	0.0e+00
WP_000012445.1|284514_285780_-	hypothetical protein	NA	A0A0P0ZD72	Stx2-converting_phage	100.0	4.4e-229
WP_000540400.1|285790_286084_-	hypothetical protein	NA	A0A0P0ZDW9	Stx2-converting_phage	100.0	4.1e-13
WP_000455652.1|286093_286540_-	hypothetical protein	NA	V5UT82	Shigella_phage	100.0	1.1e-76
WP_000509483.1|286542_287199_-	hypothetical protein	NA	A0A0P0ZCM5	Stx2-converting_phage	100.0	5.1e-104
WP_000035557.1|287293_287695_-	hypothetical protein	NA	A0A088CC37	Shigella_phage	100.0	1.2e-71
WP_000078907.1|287751_287892_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000835361.1|288122_288857_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZH34	Escherichia_phage	100.0	9.7e-136
WP_001301884.1|288947_289565_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000455635.1|289570_289849_-	hypothetical protein	NA	A0A088CD71	Shigella_phage	100.0	1.1e-50
WP_000197192.1|289863_291132_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_001146323.1|291128_292754_-	hypothetical protein	NA	A0A0P0ZDC2	Stx2-converting_phage	100.0	0.0e+00
WP_001303606.1|293048_293237_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001024006.1|293375_293645_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_001301432.1|293646_295584_-|tail	tail fiber protein	tail	A0A0P0ZCY7	Stx2-converting_phage	100.0	1.1e-64
WP_000207923.1|295580_296231_-	hypothetical protein	NA	A0A2R2X2B3	Escherichia_phage	100.0	7.8e-121
WP_000829200.1|296230_296794_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_001290743.1|296777_297239_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_001140442.1|297288_297678_-	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_000214474.1|297733_298948_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000994870.1|298971_299388_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.6e-69
WP_085948178.1|299518_300731_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000787025.1|301449_303594_-|portal	portal protein	portal	A0A0P0ZBZ2	Stx2-converting_phage	100.0	0.0e+00
WP_000143988.1|303593_305300_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_001086069.1|305280_306087_-|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
WP_001301714.1|306142_306346_-	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_000738505.1|306495_306789_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001082654.1|306820_307285_-|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000455406.1|307292_307442_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001056885.1|307441_308011_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
WP_000087461.1|308284_308818_-	lysozyme	NA	V5USG4	Shigella_phage	100.0	7.9e-103
WP_000284506.1|308822_309038_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290212.1|309114_309387_-	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000143458.1|309427_309607_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000874499.1|309741_311679_-	SASA family carbohydrate esterase	NA	A0A1I9LJQ8	Stx_converting_phage	100.0	0.0e+00
WP_000738068.1|312165_312435_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|312446_313406_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001204880.1|314187_314622_-	antitermination protein	NA	G9L695	Escherichia_phage	100.0	2.8e-82
WP_000144764.1|314614_314809_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001107963.1|314805_315411_-	recombination protein NinG	NA	A0A0P0ZCS9	Stx2-converting_phage	100.0	1.7e-98
WP_001292288.1|315410_316133_-	DNA-binding protein	NA	A0A0P0ZCJ8	Stx2-converting_phage	100.0	5.4e-131
WP_001563210.1|316125_316335_-	protein ninF	NA	G9L691	Escherichia_phage	100.0	1.4e-31
WP_000924600.1|316294_316696_-	hypothetical protein	NA	G9L690	Escherichia_phage	100.0	1.4e-72
WP_000201603.1|316770_317445_-	phage antirepressor Ant	NA	G9L689	Escherichia_phage	100.0	1.6e-129
WP_001254258.1|317701_317896_-	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	2.9e-31
WP_000153301.1|317892_318420_-	phage N-6-adenine-methyltransferase	NA	A0A0N7KZD1	Stx2-converting_phage	100.0	7.3e-101
WP_000573864.1|318416_319019_-	endonuclease	NA	G9L687	Escherichia_phage	100.0	1.7e-114
WP_001229012.1|319011_319428_-	NinB protein	NA	G9L686	Escherichia_phage	100.0	3.9e-73
WP_000103680.1|319601_319817_-	hypothetical protein	NA	G9L684	Escherichia_phage	100.0	2.2e-32
WP_001000130.1|319949_320228_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000145935.1|320298_320589_-	protein ren	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
WP_000788871.1|320585_321287_-	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	100.0	3.4e-130
WP_000185456.1|321283_322222_-	replication protein	NA	C1JJ53	Enterobacteria_phage	100.0	2.8e-172
WP_000438489.1|322254_322551_-	hypothetical protein	NA	A0A0N7KZD0	Stx2-converting_phage	100.0	5.2e-48
WP_001180318.1|322689_322917_-	transcriptional regulator	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000250473.1|322995_323703_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_000885202.1|323763_324105_+	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	100.0	5.1e-63
WP_001221210.1|324172_324634_+	hypothetical protein	NA	A0A0P0ZD85	Stx2-converting_phage	100.0	1.7e-77
WP_000957426.1|324627_325674_+	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_000198444.1|326329_326713_+	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000167595.1|326771_327242_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000065487.1|327392_327761_+	DUF2528 family protein	NA	A0A0P0ZCC3	Stx2-converting_phage	100.0	4.5e-65
WP_001198861.1|327833_327998_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372940.1|327966_328131_+	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	100.0	1.9e-23
WP_000995464.1|328185_328482_+	host-nuclease inhibitor protein Gam	NA	A0A0P0ZCL3	Stx2-converting_phage	100.0	2.1e-49
WP_000100845.1|328487_329273_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000186866.1|329269_329950_+	YqaJ viral recombinase family protein	NA	A0A0P0ZBV6	Stx2-converting_phage	100.0	2.1e-132
WP_000682315.1|329946_330129_+	DUF1317 domain-containing protein	NA	Q6H9Z1	Enterobacteria_phage	100.0	9.7e-29
WP_000548531.1|330101_330293_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_001447493.1|330303_330585_+	cell division protein ZapA	NA	Q6H9Z3	Enterobacteria_phage	100.0	3.2e-47
WP_000774248.1|330683_330905_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	100.0	3.8e-35
WP_001289942.1|330901_331849_+	ead/Ea22-like family protein	NA	A0A0P0ZDS3	Stx2-converting_phage	100.0	2.1e-183
WP_001301469.1|331850_332357_+	hypothetical protein	NA	A0A0N7C063	Escherichia_phage	100.0	4.2e-90
WP_001301947.1|332316_332532_+	hypothetical protein	NA	A0A0N7C076	Escherichia_phage	100.0	7.9e-38
WP_001142590.1|332533_332752_+	DUF4014 domain-containing protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_000212746.1|332753_333041_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_000206751.1|333044_333662_+	DUF551 domain-containing protein	NA	A0A1I9LJM0	Stx_converting_phage	100.0	7.7e-118
WP_000376712.1|333661_333946_+	DUF4752 family protein	NA	A0A0N7KZC7	Stx2-converting_phage	100.0	4.5e-49
WP_000203836.1|334301_334925_+	phage antirepressor Ant	NA	A0A0P0ZAZ7	Stx2-converting_phage	100.0	1.7e-112
WP_000669287.1|334967_335135_+	hypothetical protein	NA	A0A0P0ZCR2	Stx2-converting_phage	100.0	2.9e-27
WP_000163444.1|335361_335988_+	adenine methylase	NA	A0A2R2Z304	Escherichia_phage	100.0	1.0e-122
WP_001291844.1|335947_336160_+	DUF1382 family protein	NA	A0A2R2X2A7	Escherichia_phage	100.0	7.1e-31
WP_000994803.1|336195_336573_+	DUF1627 domain-containing protein	NA	A0A2R2Z2X7	Escherichia_phage	100.0	2.0e-52
WP_000453637.1|336651_336834_+	helix-turn-helix domain-containing protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
WP_001218308.1|336817_337987_-|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	100.0	1.7e-230
WP_000958700.1|338418_339576_+|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000257010.1|339750_340887_-	acyltransferase	NA	Q716G3	Shigella_phage	72.8	1.4e-80
339589:339605	attR	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000960724.1|340896_341577_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000403517.1|341563_342031_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_001005794.1|342030_342561_-	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	5.7e-69
>prophage 3
NZ_CP046527	Escherichia coli strain RM19259 chromosome, complete genome	5511015	577675	636560	5511015	tail,transposase,tRNA,holin	Enterobacteria_phage(30.43%)	59	NA	NA
WP_000083666.1|577675_578413_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|578544_579879_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001383425.1|579911_580793_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189215.1|580895_581483_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|581538_581922_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262720.1|582226_582916_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	3.5e-55
WP_000997403.1|582963_584001_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|584207_584627_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000138184.1|584695_585394_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082974.1|585425_588086_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949250.1|588199_589555_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001322343.1|589600_589924_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000852126.1|589920_591219_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	7.4e-46
WP_001235102.1|596992_599566_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040152.1|599695_600427_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079092.1|600423_601404_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|601538_602276_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|602546_602888_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|602991_603039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200120.1|603137_604298_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225204.1|604340_605462_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168032.1|605472_606543_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	6.9e-90
WP_001301878.1|606752_607118_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|607267_607786_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
WP_000969012.1|607775_609002_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589827.1|609017_609500_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|609576_609924_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|609965_610733_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|610763_611312_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|611330_611579_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|611715_613077_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|613243_614035_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_001301442.1|615396_615990_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059175.1|616112_616991_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880923.1|617076_618738_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|618886_619228_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117844.1|619289_619580_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|619569_620046_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|620177_620660_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217542.1|621505_621754_+	DNA damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001132157.1|622255_622846_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001144077.1|623028_623679_+	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001301665.1|623757_624816_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_000442132.1|624945_625368_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001023396.1|625528_625798_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000165061.1|626015_626342_+|transposase	transposase	transposase	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
WP_001299612.1|626338_627229_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	5.6e-170
WP_000998000.1|627035_627680_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.8e-69
WP_000612591.1|627729_628077_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000731241.1|628810_629155_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284517.1|629159_629375_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143065.1|629524_631378_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000499458.1|631785_631953_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_001302581.1|632038_632782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|633034_633658_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001028854.1|633654_634320_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223948.1|634316_634928_-	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001108081.1|634902_635469_-	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001254939.1|635804_636560_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP046527	Escherichia coli strain RM19259 chromosome, complete genome	5511015	2223012	2237677	5511015	tail,tRNA,integrase	Enterobacteria_phage(40.0%)	18	2224293:2224308	2241822:2241837
WP_000956557.1|2223012_2223546_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_001093918.1|2223963_2224245_-	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
2224293:2224308	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000829415.1|2224589_2224787_-	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_000145668.1|2225122_2225407_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_001242740.1|2225403_2225754_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000008211.1|2225744_2226281_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001230514.1|2227602_2228202_+	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000268945.1|2228266_2229580_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001023355.1|2229581_2229851_+|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_001118000.1|2229962_2230535_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_072140863.1|2230607_2231237_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001143816.1|2231318_2231960_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_001217541.1|2232120_2232369_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000332269.1|2232430_2233528_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_000543818.1|2233616_2234654_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891404.1|2234787_2235030_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235522.1|2235195_2236179_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918366.1|2236261_2237677_+	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.1	8.3e-200
2241822:2241837	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
>prophage 5
NZ_CP046527	Escherichia coli strain RM19259 chromosome, complete genome	5511015	2374566	2433578	5511015	transposase,protease	Pectobacterium_phage(12.5%)	60	NA	NA
WP_000312488.1|2374566_2375826_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|2375828_2376833_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|2376914_2377112_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|2377215_2378514_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177633.1|2378718_2379144_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076303.1|2379182_2381624_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001293282.1|2381804_2382536_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220128.1|2382662_2383064_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511966.1|2383082_2383781_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012572.1|2383831_2384491_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|2384508_2384907_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101670.1|2384916_2385555_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943960.1|2385557_2386721_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_001301849.1|2386804_2388430_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|2388546_2388822_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254630.1|2388970_2389300_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569696.1|2389481_2390231_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|2390227_2390983_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001295191.1|2391090_2392155_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_001301921.1|2392509_2393907_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218362.1|2393922_2394228_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776517.1|2394237_2394702_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|2394715_2395366_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949515.1|2395375_2396230_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170812.1|2396229_2396916_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000492914.1|2397044_2397320_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|2397646_2398042_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|2398048_2398363_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|2398367_2398595_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|2398636_2399086_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001301745.1|2399156_2399951_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000604943.1|2400573_2401005_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_000826431.1|2401012_2402221_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_001119481.1|2402355_2402994_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|2403211_2403832_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228346.1|2404140_2405553_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331454.1|2405597_2406260_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001301505.1|2406367_2407333_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560631.1|2407440_2408301_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000084622.1|2408389_2408770_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589487.1|2408887_2410831_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886884.1|2411020_2411761_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000937659.1|2411972_2412911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175287.1|2412973_2413528_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|2413852_2414059_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935036.1|2414137_2415481_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001301936.1|2415803_2416442_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|2416647_2418381_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060930.1|2418377_2422157_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|2422159_2422501_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223210.1|2422712_2422964_+	type II toxin-antitoxin system ChpS family antitoxin	NA	NA	NA	NA	NA
WP_000239579.1|2422957_2423308_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055075.1|2423388_2423919_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265942.1|2424228_2425185_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_001301928.1|2426840_2427863_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596020.1|2427849_2428845_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853749.1|2428877_2429876_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_001219792.1|2430051_2431425_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|2431580_2432132_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|2432225_2433578_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 6
NZ_CP046527	Escherichia coli strain RM19259 chromosome, complete genome	5511015	2831333	2895596	5511015	plate,tRNA,transposase	uncultured_Caudovirales_phage(33.33%)	53	NA	NA
WP_000176537.1|2831333_2832629_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|2832681_2832942_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|2832928_2833129_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185286.1|2833294_2833840_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635546.1|2833836_2834247_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239181.1|2834260_2834971_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001302206.1|2835170_2835995_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260720.1|2836047_2837766_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094000.1|2837876_2838584_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202328.1|2838580_2838985_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874227.1|2839102_2839918_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294606.1|2839957_2840611_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|2840603_2841635_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140187.1|2841822_2842398_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997018.1|2848157_2848961_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_000648586.1|2848957_2849872_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|2850112_2850913_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211693.1|2850990_2851761_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644686.1|2851808_2853167_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|2853238_2853994_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001301721.1|2854027_2854750_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|2854746_2855214_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301976.1|2855278_2856010_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_001086136.1|2856547_2857348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302684.1|2857825_2858275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000964776.1|2858277_2858874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001452678.1|2858983_2859175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284958.1|2859195_2859675_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087743.1|2859640_2861050_-	membrane protein	NA	NA	NA	NA	NA
WP_001303798.1|2861060_2864495_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240517.1|2864631_2866044_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088854.1|2866048_2866792_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614375.1|2866788_2869566_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.7	4.7e-82
WP_000343292.1|2869574_2870336_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246434.1|2870340_2871672_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080153.1|2871674_2872199_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113707.1|2872195_2873476_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348794.1|2873500_2874583_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|2874546_2876397_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000599596.1|2876400_2876814_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056994.1|2876904_2878296_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|2878346_2878571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037399.1|2878605_2879106_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|2879802_2880321_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103125.1|2880530_2882672_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.1e-25
WP_000509129.1|2882747_2886980_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_000995683.1|2887119_2887836_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_000339419.1|2888017_2889526_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_000420853.1|2890878_2892015_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001145876.1|2892017_2893778_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000247943.1|2893979_2894243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795385.1|2894157_2894343_-	protein YncO	NA	NA	NA	NA	NA
WP_000027427.1|2894423_2895596_+|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP046527	Escherichia coli strain RM19259 chromosome, complete genome	5511015	2914381	2933439	5511015	tail,transposase	Escherichia_phage(44.44%)	19	NA	NA
WP_000749881.1|2914381_2915437_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|2915724_2916828_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893282.1|2916839_2918093_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_156292151.1|2919162_2919351_-	hypothetical protein	NA	J3JZZ6	Escherichia_phage	89.7	5.5e-11
WP_085948178.1|2919388_2920601_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_085948178.1|2921047_2922261_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000708831.1|2922286_2922670_-	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	36.2	4.4e-07
WP_001274756.1|2922797_2923511_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000437875.1|2923611_2923812_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000251069.1|2923930_2924224_+	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000788819.1|2925175_2925487_+	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_001096963.1|2925486_2926281_+|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	92.9	2.8e-80
WP_000805544.1|2926280_2926874_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_000344820.1|2926845_2927289_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_001115553.1|2927309_2927720_-|tail	tail fiber protein	tail	A0A0F7LBW5	Escherichia_phage	97.6	2.2e-65
WP_000904979.1|2927749_2928304_+	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_000355475.1|2928361_2929135_-	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000246059.1|2929957_2930701_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_085948178.1|2932225_2933439_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 8
NZ_CP046527	Escherichia coli strain RM19259 chromosome, complete genome	5511015	3513126	3551227	5511015	lysis,protease,tail,terminase,integrase,portal,holin	Enterobacteria_phage(48.84%)	50	3502568:3502582	3534862:3534876
3502568:3502582	attL	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_000533643.1|3513126_3514197_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
WP_001303849.1|3514174_3514393_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|3514432_3514600_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_000120056.1|3514842_3515445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763363.1|3515655_3515877_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_023436627.1|3515975_3516257_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000548536.1|3516267_3516459_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000682316.1|3516431_3516614_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000186844.1|3516610_3517291_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_001254218.1|3517988_3518171_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000567001.1|3518167_3518338_+	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001108055.1|3518330_3518951_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_001028854.1|3518947_3519613_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_000750155.1|3519824_3520784_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|3521121_3521244_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|3521258_3521948_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|3522131_3522875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|3522960_3523119_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_012578864.1|3523199_3523598_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_001303850.1|3523740_3523956_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000075107.1|3523955_3524453_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000092302.1|3524449_3524917_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_001139679.1|3524904_3525057_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000349509.1|3525731_3526223_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_000934137.1|3526222_3528325_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_001072975.1|3528321_3528534_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_010904538.1|3528461_3529586_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_127446149.1|3529707_3530043_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_001136597.1|3529987_3532015_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_001097050.1|3532101_3532425_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|3532417_3532693_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677094.1|3532704_3533283_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001079422.1|3533279_3533681_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000211123.1|3533691_3534435_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001300035.1|3534495_3534882_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
3534862:3534876	attR	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_001161009.1|3534890_3535220_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000371994.1|3535191_3538257_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447253.1|3538256_3538586_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152360.1|3538595_3539294_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000194779.1|3539299_3540043_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090841.1|3539979_3540588_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000515426.1|3540648_3544062_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_001233141.1|3544132_3544732_+	outer membrane protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000741889.1|3544791_3546108_+|tail	tail fiber protein	tail	H6WZM9	Escherichia_phage	95.6	1.2e-70
WP_001024022.1|3546109_3546379_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000950813.1|3546555_3547536_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_115801843.1|3547569_3548589_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_072127173.1|3549085_3549247_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_000951025.1|3549416_3550298_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	89.8	1.1e-146
WP_001247925.1|3550528_3551227_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
>prophage 9
NZ_CP046527	Escherichia coli strain RM19259 chromosome, complete genome	5511015	3767937	3837777	5511015	protease,tail,transposase,head,portal,holin	Escherichia_phage(25.58%)	77	NA	NA
WP_000156526.1|3767937_3769698_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|3769883_3770336_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|3770410_3771451_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|3771807_3772317_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839159.1|3772535_3773165_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|3773127_3775290_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261230.1|3775299_3775746_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001301436.1|3775868_3777923_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
WP_000424181.1|3777954_3778413_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|3778508_3779171_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|3779343_3779757_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|3779801_3780119_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|3780176_3781367_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|3781461_3781740_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|3781736_3782066_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375128.1|3782156_3782816_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
WP_000273151.1|3784207_3784450_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034474.1|3784517_3786989_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_001098307.1|3787082_3787274_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|3787270_3787459_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133046.1|3788032_3788218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394511.1|3788404_3788794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|3788935_3789091_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001303876.1|3789368_3789656_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|3789655_3789847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|3789874_3790276_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|3790384_3790657_+	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|3790640_3791066_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|3791272_3791728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001475117.1|3791806_3792904_+	hypothetical protein	NA	V5URT9	Shigella_phage	69.6	8.8e-133
WP_000788745.1|3792910_3793657_+	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.8	3.1e-113
WP_000450992.1|3793678_3794449_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_001151233.1|3794464_3794878_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|3795229_3796003_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000955173.1|3796368_3796506_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_001013642.1|3796550_3796763_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_001341388.1|3796930_3797209_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265172.1|3797210_3798260_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001217436.1|3798272_3798644_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090264.1|3798633_3799005_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_000265265.1|3799156_3799975_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001303877.1|3800261_3800501_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000261909.1|3800595_3801309_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874392.1|3802076_3803927_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_085948178.1|3804102_3805315_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001303878.1|3805520_3805835_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|3806362_3806548_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|3806769_3806883_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|3807103_3807637_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|3807796_3808069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411791.1|3808324_3808531_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000235421.1|3809281_3809557_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_001171554.1|3809632_3810013_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3810009_3810357_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3810406_3811945_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001301919.1|3811994_3812237_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000259002.1|3814121_3814328_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|3814324_3815917_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|3815906_3817412_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|3817448_3817796_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|3817853_3818120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029208397.1|3818101_3818842_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|3818855_3819287_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_156292136.1|3819313_3819745_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082463.1|3819708_3822288_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000847274.1|3822284_3822614_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_001151105.1|3822613_3823312_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194801.1|3823322_3824066_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_000649829.1|3824835_3825363_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_000515111.1|3825496_3828970_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	95.5	0.0e+00
WP_001230444.1|3829037_3829637_+	outer membrane protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000268962.1|3829700_3831014_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	2.8e-77
WP_001023352.1|3831015_3831285_+|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_001301613.1|3833558_3834677_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107391.1|3834673_3836467_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|3836485_3837193_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003653.1|3837189_3837777_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 10
NZ_CP046527	Escherichia coli strain RM19259 chromosome, complete genome	5511015	4099503	4216071	5511015	lysis,protease,tail,terminase,integrase,transposase,head,portal,holin,tRNA,capsid	Enterobacteria_phage(37.25%)	147	4161435:4161450	4189685:4189700
WP_000952736.1|4099503_4100325_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000759316.1|4100480_4101527_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|4101523_4102318_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074985.1|4102484_4103603_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000003742.1|4103571_4103841_-	excisionase	NA	NA	NA	NA	NA
WP_077699040.1|4103902_4104292_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000559928.1|4104424_4104940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414141.1|4105054_4105207_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000948454.1|4105522_4105999_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|4106123_4106447_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693915.1|4106430_4106856_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262323.1|4106924_4107962_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_001301518.1|4107993_4108416_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	91.4	1.8e-73
WP_000451012.1|4108449_4109166_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_000017339.1|4109162_4109480_+	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	70.6	1.1e-32
WP_001310212.1|4109476_4109779_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_001017965.1|4109768_4110086_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_000156547.1|4110039_4110357_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_000515959.1|4110343_4110781_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_001014296.1|4110782_4110974_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000207955.1|4110976_4111564_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001278450.1|4111679_4111784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|4111972_4112185_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001341388.1|4112352_4112631_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265168.1|4112632_4113682_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001217415.1|4113694_4113952_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	65.3	3.1e-20
WP_001213059.1|4115372_4115555_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001289717.1|4115592_4115862_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_000284518.1|4115937_4116153_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731241.1|4116157_4116502_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|4116552_4117086_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|4117356_4117926_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|4117925_4118072_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|4118299_4118506_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|4118570_4118795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|4119151_4119292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302295.1|4119421_4119607_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000279786.1|4119648_4120014_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|4120303_4120867_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001301491.1|4120863_4122525_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|4122588_4124526_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|4124570_4124792_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000126019.1|4127319_4127646_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|4127655_4128006_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|4128002_4128449_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|4128445_4128790_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|4128855_4129572_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|4129586_4129961_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_000807950.1|4133554_4133896_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_001152182.1|4133895_4134594_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000170104.1|4134610_4134865_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_010904626.1|4134974_4135085_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|4135387_4136266_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_000967271.1|4136319_4137057_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_071526731.1|4137002_4137239_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_115801847.1|4137251_4137341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|4137360_4139709_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|4140299_4143701_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301834.1|4145804_4145930_+	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001303921.1|4146009_4146285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|4146345_4147707_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799385.1|4148070_4148934_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|4148917_4150054_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|4150303_4151530_+	peptidase T	NA	NA	NA	NA	NA
WP_001301987.1|4151578_4152700_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000085256.1|4152948_4154178_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_000953272.1|4154542_4154731_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_125090562.1|4154780_4155107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000106745.1|4155231_4155405_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	51.2	8.4e-06
WP_000226782.1|4155535_4155733_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|4155725_4155938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551675.1|4155927_4156392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204985.1|4156384_4156618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|4156623_4156923_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833628.1|4156919_4158320_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	5.6e-116
WP_000192401.1|4158520_4158772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126695.1|4158768_4159179_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|4159189_4159462_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|4159588_4159813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796968.1|4160064_4160271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907465.1|4160270_4161326_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
WP_000380883.1|4161338_4161674_+|head	head decoration protein	head	NA	NA	NA	NA
4161435:4161450	attL	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000224603.1|4161686_4162100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|4162305_4162848_+|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|4163103_4163385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|4163985_4165446_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|4165445_4166117_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|4166285_4167656_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|4167659_4168301_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|4168336_4169443_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|4169496_4169958_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|4169967_4170621_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|4170792_4172043_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741454.1|4172156_4173299_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088655.1|4173288_4173525_-	excisionase	NA	NA	NA	NA	NA
WP_000945520.1|4173628_4174453_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	69.3	3.8e-96
WP_000788869.1|4174449_4175151_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145915.1|4175147_4175450_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|4175517_4175850_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|4175914_4176037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053040.1|4178118_4178574_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000224907.1|4178573_4178744_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|4178736_4179027_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099695.1|4179023_4179386_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971093.1|4179382_4179523_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|4179519_4180209_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000544528.1|4180530_4180836_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|4180822_4181299_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_010917798.1|4181515_4181698_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000738495.1|4181788_4182082_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_000079504.1|4182373_4182784_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|4183069_4183276_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|4183440_4183635_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|4184023_4184569_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_024748455.1|4184543_4186469_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000198153.1|4186465_4186672_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|4186668_4188270_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|4188250_4189570_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|4189579_4189912_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
4189685:4189700	attR	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000063265.1|4189967_4190993_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|4191034_4191433_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000752995.1|4191444_4191798_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000975100.1|4191809_4192388_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683105.1|4192384_4192780_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001143002.1|4192787_4193528_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|4193543_4193966_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|4193947_4194382_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840323.1|4194374_4196924_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000847331.1|4196920_4197250_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|4197249_4197948_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194779.1|4197953_4198697_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090920.1|4198633_4199266_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000515612.1|4199326_4202725_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_001230336.1|4202791_4203391_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000279120.1|4203455_4206371_+	membrane protein	NA	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_000885630.1|4206370_4206952_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000488340.1|4207071_4207962_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|4207980_4208487_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|4208523_4209024_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|4209102_4209285_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|4209782_4210451_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937476.1|4210507_4210756_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_001171554.1|4210831_4211212_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|4211208_4211556_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998051.1|4211605_4213144_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_001226373.1|4213446_4214931_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201843.1|4215117_4216071_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
>prophage 11
NZ_CP046527	Escherichia coli strain RM19259 chromosome, complete genome	5511015	4295000	4368637	5511015	lysis,protease,tail,terminase,integrase,transposase,head,portal,holin,capsid	Enterobacteria_phage(33.33%)	84	4294837:4294864	4353109:4353136
4294837:4294864	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001639428.1|4295000_4296131_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	5.7e-103
WP_000113189.1|4296108_4296357_-	excisionase	NA	NA	NA	NA	NA
WP_000048551.1|4296421_4298893_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_001090196.1|4298985_4299177_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|4299173_4299362_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001356681.1|4299759_4299927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|4299920_4300154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|4300131_4300539_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|4300561_4300780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|4300852_4301152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|4301415_4301823_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|4301899_4302127_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705621.1|4302110_4302662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|4302633_4303674_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_001302276.1|4303705_4304128_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.6	1.2e-77
WP_000774808.1|4304314_4304896_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001505071.1|4304892_4305057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|4305755_4306514_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961820.1|4306792_4307005_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001217394.1|4307225_4307483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|4307552_4307831_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001302148.1|4307832_4308879_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_000904166.1|4308891_4309251_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_000640048.1|4309259_4309790_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|4310031_4310229_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935548.1|4310379_4311438_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_001415558.1|4312177_4312336_+	DUF1737 domain-containing protein	NA	Q5MBW4	Stx1-converting_phage	100.0	3.5e-11
WP_000284517.1|4313204_4313420_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731259.1|4313424_4313769_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|4313819_4314353_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|4314623_4315193_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|4315192_4315339_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001082601.1|4315346_4315814_+|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	92.2	1.1e-71
WP_001302717.1|4316277_4316592_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|4316673_4316898_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867498.1|4317284_4317830_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_156292138.1|4317804_4319730_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|4319726_4319933_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|4319929_4321531_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|4321511_4322831_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|4322840_4323173_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|4323228_4324254_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|4324295_4324694_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|4324705_4325059_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|4325073_4325607_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_024248974.1|4325603_4325999_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	80.9	9.7e-58
WP_000235090.1|4326006_4326759_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|4326772_4327195_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000438877.1|4327221_4327530_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	99.0	1.5e-53
WP_000918257.1|4327573_4330219_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	98.6	0.0e+00
WP_000847298.1|4330215_4330545_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|4330544_4331243_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_122989782.1|4331942_4332572_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	96.6	2.7e-102
WP_000514948.1|4332812_4335668_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	72.8	0.0e+00
WP_001228334.1|4335735_4336335_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.0	1.0e-106
WP_000216534.1|4336486_4337791_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	3.9e-79
WP_001023474.1|4337792_4338062_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|4339088_4340414_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_106409364.1|4342011_4342134_+	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|4342240_4343152_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|4343217_4343787_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000998051.1|4344752_4346291_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_000612591.1|4346340_4346688_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001303943.1|4347404_4347683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|4348110_4348257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|4348393_4349041_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|4349224_4349815_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_000147167.1|4352566_4352785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001079499.1|4353286_4353793_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
4353109:4353136	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056491.1|4353838_4354339_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|4354424_4354604_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|4354984_4355791_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|4355790_4356984_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001302292.1|4356995_4358354_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	4.3e-36
WP_000763520.1|4358357_4359953_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194604.1|4359952_4361515_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|4361606_4361651_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|4361788_4362670_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|4362666_4363287_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001302160.1|4363314_4364898_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|4365110_4365983_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|4366022_4366613_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|4366609_4367368_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|4367587_4368637_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 12
NZ_CP046527	Escherichia coli strain RM19259 chromosome, complete genome	5511015	4640245	4749420	5511015	protease,tail,terminase,transposase,head,portal,holin,capsid	Stx2-converting_phage(41.0%)	130	NA	NA
WP_000214712.1|4640245_4640449_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|4640484_4641945_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000347470.1|4642033_4643317_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_016241229.1|4643376_4643691_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001143804.1|4643852_4644494_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001303500.1|4644575_4645205_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|4645277_4645853_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023407.1|4645966_4646236_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000268848.1|4646237_4647551_-|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.2	1.4e-81
WP_001230508.1|4647615_4648215_-	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000143597.1|4648282_4650796_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.5	0.0e+00
WP_000514693.1|4650792_4652361_-	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	98.2	1.1e-298
WP_050439450.1|4652702_4653335_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194720.1|4653280_4654024_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_001179510.1|4654034_4654733_-|tail	phage minor tail protein L	tail	A0A0P0ZD89	Stx2-converting_phage	97.8	7.6e-130
WP_000807954.1|4654732_4655074_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212925.1|4655066_4658309_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.6	0.0e+00
WP_001453698.1|4658361_4658571_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|4658666_4659041_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|4659046_4659763_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|4659821_4660166_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|4660162_4660609_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|4660605_4660956_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126026.1|4660965_4661292_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	99.1	4.5e-53
WP_001063023.1|4663332_4663554_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000731239.1|4664097_4664505_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	97.2	1.3e-52
WP_000411805.1|4664509_4664716_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000023184.1|4665163_4667014_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001302123.1|4667491_4667923_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|4668373_4669087_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|4669222_4669420_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|4669644_4670199_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|4670261_4670567_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|4670579_4671629_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|4671630_4671903_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|4672024_4672369_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|4672488_4672701_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|4672934_4673492_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|4673493_4673712_-	DUF4014 domain-containing protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|4673839_4674151_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|4674143_4674371_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|4674367_4674649_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|4674681_4675398_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_001379651.1|4675431_4675854_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.0	5.7e-72
WP_001262402.1|4675885_4676929_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000693878.1|4676997_4677423_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|4677406_4677649_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|4678040_4678379_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|4678671_4678824_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|4678835_4679474_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|4679474_4679684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|4680248_4680437_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|4680433_4680622_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102123.1|4680714_4681959_+	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_016241229.1|4682597_4682912_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001171540.1|4683874_4684255_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|4684251_4684599_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998051.1|4684648_4686187_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_001121225.1|4686769_4687420_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001131642.1|4688130_4688706_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001023362.1|4688819_4689089_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_000268860.1|4689090_4690314_-|tail	tail fiber protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001230508.1|4690378_4690978_-	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_001304111.1|4691045_4691261_-	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_156292139.1|4691263_4694524_-	DUF1983 domain-containing protein	NA	A0A0P0ZBW1	Stx2-converting_phage	92.1	0.0e+00
WP_001179509.1|4694711_4695149_-|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	100.0	5.0e-63
WP_000807954.1|4695148_4695490_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212818.1|4695482_4698725_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.6	0.0e+00
WP_001453746.1|4698773_4698983_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|4699078_4699453_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|4699467_4700184_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|4700249_4700594_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|4700590_4701037_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|4701033_4701384_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|4701393_4701720_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_000267295.1|4701722_4704302_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_001063099.1|4704247_4704469_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|4704513_4706451_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301438.1|4706514_4708176_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000958416.1|4708172_4708736_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000095736.1|4709437_4709665_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|4710089_4710275_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539789.1|4710532_4710649_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	3.4e-11
WP_001056806.1|4710648_4711218_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|4711488_4712022_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731241.1|4712072_4712417_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000411805.1|4712421_4712628_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000023202.1|4713075_4714926_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_001303509.1|4715404_4715833_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_001059381.1|4716469_4717159_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001217455.1|4717155_4717515_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001265161.1|4717527_4718577_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_012779366.1|4718578_4718857_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|4719024_4719237_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|4719425_4719530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206793.1|4719645_4720230_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001118159.1|4720286_4720682_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000788938.1|4721492_4722233_-	replication protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_000095669.1|4722239_4723202_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000693943.1|4723224_4723650_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|4723646_4723949_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_001169686.1|4724046_4724418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302048.1|4724438_4724630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|4724631_4724910_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001240334.1|4725262_4725562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|4725633_4725852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331716.1|4725855_4726020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|4726420_4726609_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|4726605_4726797_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_085948178.1|4728025_4729238_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001296941.1|4730761_4730998_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000546375.1|4731688_4731814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302046.1|4731986_4732313_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705189.1|4732447_4732789_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|4732823_4733384_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001303515.1|4733386_4734097_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_000778147.1|4734204_4734510_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041704.1|4734708_4737135_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_001414236.1|4737195_4739619_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000213028.1|4739629_4740247_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526515.1|4740248_4741103_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|4741145_4741760_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_071525082.1|4741917_4743210_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000919231.1|4743162_4743858_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000225276.1|4743982_4745203_-	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_001019530.1|4745337_4746231_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091829.1|4746337_4747591_+	MFS transporter	NA	NA	NA	NA	NA
WP_000743952.1|4747987_4748323_+	acid shock protein	NA	NA	NA	NA	NA
WP_000233090.1|4748415_4748499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001260835.1|4748598_4749420_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 13
NZ_CP046527	Escherichia coli strain RM19259 chromosome, complete genome	5511015	4869359	4915589	5511015	tail,terminase,integrase,transposase,portal,head,holin,plate,tRNA,capsid	Enterobacteria_phage(72.92%)	61	4871762:4871786	4908231:4908255
WP_000029463.1|4869359_4870109_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154193.1|4870108_4870660_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956513.1|4870722_4871703_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
4871762:4871786	attL	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_001689686.1|4871895_4872333_-	DUF1640 domain-containing protein	NA	NA	NA	NA	NA
WP_000403439.1|4872433_4872934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001247210.1|4872936_4873875_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	51.5	5.1e-81
WP_000904674.1|4873963_4874272_-	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	52.1	8.7e-22
WP_085948178.1|4874587_4875801_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000917809.1|4875974_4876313_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	87.1	2.3e-52
WP_000158974.1|4876323_4876611_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	75.8	6.6e-32
WP_000514277.1|4876622_4876865_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021666.1|4876861_4876975_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	89.2	2.0e-08
WP_000644726.1|4877067_4877484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|4877507_4877711_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|4877707_4877974_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000104308.1|4877970_4878270_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	1.4e-40
WP_000013477.1|4878592_4878823_+	hypothetical protein	NA	A0A0A7NV48	Enterobacteria_phage	82.9	4.8e-25
WP_000564228.1|4878895_4879285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001001609.1|4879281_4882122_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	90.1	0.0e+00
WP_000708312.1|4882198_4883158_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	1.5e-176
WP_000211267.1|4883162_4883474_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	83.5	2.2e-41
WP_001594304.1|4883838_4884108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000087812.1|4884595_4885642_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000613768.1|4885641_4887393_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	99.8	0.0e+00
WP_001262673.1|4887547_4888384_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_001055118.1|4888406_4889459_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	100.0	6.8e-199
WP_000632347.1|4889504_4890305_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	92.5	1.6e-131
WP_000063103.1|4890406_4890901_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000864901.1|4890900_4891101_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104350.1|4891103_4891427_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|4891423_4891816_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780572.1|4891812_4892220_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	99.3	9.0e-67
WP_000920579.1|4892357_4892825_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	98.1	9.3e-84
WP_000356344.1|4892817_4893453_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	2.4e-114
WP_001271948.1|4893449_4894031_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	95.9	2.3e-100
WP_000213447.1|4894027_4894378_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111970.1|4894381_4895278_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	7.4e-154
WP_000071724.1|4895270_4895879_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	1.5e-86
WP_000217005.1|4895875_4897381_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	62.7	6.6e-155
WP_001008232.1|4897401_4897845_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	99.3	6.3e-82
WP_000368062.1|4897816_4898419_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.5	6.2e-96
WP_024185888.1|4898418_4898958_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	63.0	2.5e-56
WP_000905082.1|4898988_4899588_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	82.2	8.9e-87
WP_000979945.1|4899614_4900103_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000853421.1|4900115_4902923_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	95.6	0.0e+00
WP_000763327.1|4902909_4903038_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000665308.1|4903073_4903439_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000290466.1|4903493_4904006_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	96.5	3.3e-90
WP_000005394.1|4904005_4905190_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.2	3.6e-225
WP_000132850.1|4905347_4906457_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	93.0	1.1e-191
WP_000069998.1|4906609_4907215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302981.1|4907375_4907636_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|4907826_4907967_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001229265.1|4908272_4908572_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
4908231:4908255	attR	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_000672328.1|4908576_4910964_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018588.1|4910978_4911962_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|4912244_4912289_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
WP_000124850.1|4912411_4912768_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|4912820_4913018_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|4913114_4913657_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144201.1|4913660_4915589_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	9.4e-130
>prophage 14
NZ_CP046527	Escherichia coli strain RM19259 chromosome, complete genome	5511015	5174586	5316207	5511015	lysis,protease,tail,terminase,integrase,transposase,portal,head,holin,capsid	Stx2-converting_phage(35.25%)	159	5197379:5197438	5319270:5319285
WP_001023407.1|5174586_5174856_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000268981.1|5174857_5176171_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	2.8e-77
WP_001230514.1|5176235_5176835_-	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_137056729.1|5176902_5180382_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.8	0.0e+00
WP_140415234.1|5180622_5181252_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	97.1	9.6e-108
WP_000194801.1|5181197_5181941_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_001151105.1|5181951_5182650_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847274.1|5182649_5182979_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_000082463.1|5182975_5185555_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_156292147.1|5185558_5185951_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.5e-42
WP_000479117.1|5185977_5186409_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|5186422_5187163_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|5187144_5187411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256723.1|5187468_5187816_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|5187852_5189358_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|5189347_5190940_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|5190936_5191143_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000235436.1|5193027_5193537_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001299328.1|5193931_5194156_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_001302690.1|5194237_5194552_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|5195078_5195264_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001280929.1|5195491_5195623_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001303555.1|5195635_5195818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992126.1|5195973_5196507_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_000731204.1|5196557_5196902_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000411809.1|5196906_5197113_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
5197379:5197438	attL	TGAACCGCCCCGGAAATCCTGGAGACTAAACTCCCTGAGAAAGAGGTAAACAGGATGACT	NA	NA	NA	NA
WP_085948178.1|5197432_5198645_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
5197379:5197438	attL	TGAACCGCCCCGGAAATCCTGGAGACTAAACTCCCTGAGAAAGAGGTAAACAGGATGACT	NA	NA	NA	NA
WP_000023257.1|5198727_5200578_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_001303558.1|5201055_5201484_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_001059369.1|5202117_5202807_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000904141.1|5202803_5203163_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001265075.1|5203175_5204225_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_001310296.1|5204226_5204505_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_000902687.1|5204672_5204885_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001278460.1|5205071_5205176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137954.1|5205285_5205849_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_000111243.1|5205975_5206287_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_001414276.1|5206283_5206436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290006.1|5206468_5206825_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_000702797.1|5206821_5207046_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_000450610.1|5207067_5207766_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000373320.1|5207800_5208223_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
WP_001262409.1|5208254_5209292_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000693816.1|5209360_5209786_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261752.1|5209782_5210010_-	cell division protein	NA	NA	NA	NA	NA
WP_000444607.1|5210107_5210752_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_000367376.1|5211026_5211179_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000449168.1|5211659_5211848_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199485.1|5211844_5212033_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034457.1|5212128_5214600_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000094838.1|5214658_5214862_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533601.1|5214861_5215941_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.2e-99
WP_001302302.1|5216132_5216930_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_134793145.1|5217419_5225402_+	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_000480501.1|5225663_5226716_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000378596.1|5227029_5228346_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060244.1|5228447_5229902_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532909.1|5230244_5230961_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_122989775.1|5231586_5233230_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_001011000.1|5233347_5234298_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011474.1|5234399_5235317_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_000986334.1|5235773_5236709_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001193830.1|5236770_5237850_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|5237861_5238605_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973176.1|5238601_5239147_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001171540.1|5239508_5239889_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|5239885_5240233_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998051.1|5240282_5241821_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_085948178.1|5242638_5243852_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000966626.1|5244581_5246729_+	TonB-dependent receptor	NA	NA	NA	NA	NA
5243847:5245156	attR	AGTCATCCTGTTTACCTCTTTCTCAGGGAGTTTAGTCTCCAGGATTTCCGGGGCGGTTCAGATATATTCTGATATACTCCTTTTGCTAGACATAACCTTTCACCTGCTTGCAAAGCTTCTGTGTTCTGACATTGCCAAATTGTTGCAATTCTGTATCCAGCCTTCTTTCAGTCATAGCTTCGGGCCGCGATAAGACTCACTGATCTGACCCTGATTCCTCTTGCAGACTTTATAGACCAATTAAAATGCAGTTTCTGCAGGTCAACGTCTGACCATCATTGTCATCACTCTGGCCATTAGAGTAACCTTCTGCATTCATCCTTTTGTAAAAAGTTTATATTAGTATCAGCAATTAACCGGACCTGATACTGATATGAGTCTTACCGCATATACGGTCAATTTCAGCAATTAATTACATTATCCACGCCAAAGTATTTGTCATCACAATGATGGTACCTTCTTTCAGACACCATTTTTTCAACTCCGTTTTCCACGGACCGCACTCTTATGTCAAGAGTGCGGTCCGTGGATACAACCAGAGACCGACTGACACGAGTCAGAGGAAACGACGGATATGTTCAGTCGTAAAATATCTATCAAAAAACATGATTAAGGTCAAAAATGTTTGATATTTACAATTTATGAAGATGACAATAATTATAGATATATGAGAACATAAATGAAAATAATTATCATTACAGCAATCATTTGTACTTTGTATTAATGAGGGATGAAATGTTATATAATATACCTTGTCGAATTTATATCCTTTCCACTCTGTCATTATGCATTTCTGGGATAGTTTCTACTGCAACCGCAACTTCTTCAGAAACAAAAATCAGCAACGAAGAGACGCTCGTCGTGACCACGAATCGTTCGGCAAGCAACCTTTGGGAAAGCCCGGCGACTATACAGGTTATTGACCAACAAACATTGCAGAACTCCACCAATGCCTCCATAGCCGATAATTTGCAGGACATCCCCGGAGTAGAGATAACAGACAACTCCTTGGCAGGCCGTAAACAAATCCGCATTCGTGGCGAAGCATCCTCCCGTGTTTTAATTCTCATTGATGGTCAGGAGGTAACTTATCAGCGCGCCGGAGATAATTATGGTGTGGGACTGTTGATAGATGAGTCTGCGCTGGAGCGTGTTGAGGTAGTGAAAGGTCCATATTCCGTACTGTACGGTTCACAGGCAATTGGCGGTATTGTTAACTTCATCACCAAAAAGGGAGGTGACAAACTTGCATCTGGAGTTGTGAAAGCTGTTTATAATTCCGCAACAGCAGGCTGGGAAGAATCAATCGC	NA	NA	NA	NA
WP_061069249.1|5247010_5247865_+	hypothetical protein	NA	NA	NA	NA	NA
5243847:5245156	attR	AGTCATCCTGTTTACCTCTTTCTCAGGGAGTTTAGTCTCCAGGATTTCCGGGGCGGTTCAGATATATTCTGATATACTCCTTTTGCTAGACATAACCTTTCACCTGCTTGCAAAGCTTCTGTGTTCTGACATTGCCAAATTGTTGCAATTCTGTATCCAGCCTTCTTTCAGTCATAGCTTCGGGCCGCGATAAGACTCACTGATCTGACCCTGATTCCTCTTGCAGACTTTATAGACCAATTAAAATGCAGTTTCTGCAGGTCAACGTCTGACCATCATTGTCATCACTCTGGCCATTAGAGTAACCTTCTGCATTCATCCTTTTGTAAAAAGTTTATATTAGTATCAGCAATTAACCGGACCTGATACTGATATGAGTCTTACCGCATATACGGTCAATTTCAGCAATTAATTACATTATCCACGCCAAAGTATTTGTCATCACAATGATGGTACCTTCTTTCAGACACCATTTTTTCAACTCCGTTTTCCACGGACCGCACTCTTATGTCAAGAGTGCGGTCCGTGGATACAACCAGAGACCGACTGACACGAGTCAGAGGAAACGACGGATATGTTCAGTCGTAAAATATCTATCAAAAAACATGATTAAGGTCAAAAATGTTTGATATTTACAATTTATGAAGATGACAATAATTATAGATATATGAGAACATAAATGAAAATAATTATCATTACAGCAATCATTTGTACTTTGTATTAATGAGGGATGAAATGTTATATAATATACCTTGTCGAATTTATATCCTTTCCACTCTGTCATTATGCATTTCTGGGATAGTTTCTACTGCAACCGCAACTTCTTCAGAAACAAAAATCAGCAACGAAGAGACGCTCGTCGTGACCACGAATCGTTCGGCAAGCAACCTTTGGGAAAGCCCGGCGACTATACAGGTTATTGACCAACAAACATTGCAGAACTCCACCAATGCCTCCATAGCCGATAATTTGCAGGACATCCCCGGAGTAGAGATAACAGACAACTCCTTGGCAGGCCGTAAACAAATCCGCATTCGTGGCGAAGCATCCTCCCGTGTTTTAATTCTCATTGATGGTCAGGAGGTAACTTATCAGCGCGCCGGAGATAATTATGGTGTGGGACTGTTGATAGATGAGTCTGCGCTGGAGCGTGTTGAGGTAGTGAAAGGTCCATATTCCGTACTGTACGGTTCACAGGCAATTGGCGGTATTGTTAACTTCATCACCAAAAAGGGAGGTGACAAACTTGCATCTGGAGTTGTGAAAGCTGTTTATAATTCCGCAACAGCAGGCTGGGAAGAATCAATCGC	NA	NA	NA	NA
WP_000203545.1|5247861_5248767_+	chemotaxis protein	NA	NA	NA	NA	NA
WP_000102660.1|5248763_5249834_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000775497.1|5249969_5250653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000846711.1|5250668_5251079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234544.1|5251299_5252121_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000860080.1|5252202_5252682_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	5.2e-13
WP_001186192.1|5252696_5253173_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|5253235_5253457_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001285587.1|5253530_5253899_+	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000988600.1|5254357_5254552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|5254564_5254678_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001016346.1|5255166_5255349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450409.1|5255449_5255779_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_001202488.1|5255950_5257009_-	FUSC family protein	NA	NA	NA	NA	NA
WP_001105393.1|5257207_5257681_-	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001303036.1|5257799_5258966_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001121226.1|5260289_5260940_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_000458686.1|5261163_5262039_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.7	3.2e-162
WP_001023455.1|5262179_5262449_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_000268851.1|5262450_5263764_-|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	99.1	2.0e-83
WP_001230514.1|5263828_5264428_-	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000514828.1|5264495_5267975_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.0	0.0e+00
WP_122994717.1|5268213_5268846_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	99.0	3.1e-106
WP_000967278.1|5268791_5269529_-|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	98.8	3.8e-148
WP_001414206.1|5269583_5270507_-	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	99.3	3.2e-176
WP_001154345.1|5270577_5270751_-	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001302649.1|5270858_5271179_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_000807954.1|5271921_5272263_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212920.1|5272255_5275498_-|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	95.6	0.0e+00
WP_001453698.1|5275549_5275759_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000133388.1|5277011_5277356_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|5277352_5277799_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007901.1|5277795_5278146_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|5278155_5278482_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001301679.1|5278561_5281063_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	97.2	0.0e+00
WP_001063099.1|5281008_5281230_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|5281274_5283212_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301438.1|5283275_5284937_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000958416.1|5284933_5285497_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279796.1|5285788_5286154_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000095736.1|5286195_5286423_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_001283921.1|5286885_5287143_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000839224.1|5287139_5287637_-	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_000092318.1|5287839_5288277_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000075132.1|5288273_5288771_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000284515.1|5288770_5288986_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_001290231.1|5289062_5289335_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|5289375_5289555_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001303568.1|5291873_5292197_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000738080.1|5292493_5292763_-	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_000649751.1|5292774_5293734_-	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000512807.1|5294383_5294872_-	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_001028858.1|5294862_5295534_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_001108004.1|5295530_5296136_-	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_000849633.1|5296928_5297609_-	phage antirepressor Ant	NA	Q8HA19	Enterobacteria_phage	100.0	1.1e-128
WP_000208502.1|5297864_5298623_-	ORF6N domain-containing protein	NA	B6ETC2	Enterobacteria_phage	100.0	2.0e-115
WP_001254256.1|5298897_5299080_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153268.1|5299076_5299604_-	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001303571.1|5299600_5300047_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_001449504.1|5300003_5300240_-	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_000103678.1|5300250_5300466_-	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001000130.1|5300598_5300877_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_001248388.1|5300947_5302324_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_000539354.1|5302320_5303142_-	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_000442612.1|5303322_5303619_-	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000067727.1|5303760_5303976_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|5304051_5304747_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001130059.1|5305248_5305770_+	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_000438343.1|5306338_5306521_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_000088203.1|5306498_5306771_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000394299.1|5306829_5307081_+	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000065362.1|5307263_5307632_+	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_001198861.1|5307704_5307869_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|5307837_5307981_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995486.1|5308055_5308352_+	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_001301718.1|5308357_5309143_+	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	99.6	2.4e-148
WP_085948178.1|5309437_5310651_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000682306.1|5311129_5311312_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000548544.1|5311284_5311476_+	DUF1382 family protein	NA	B6ETA2	Enterobacteria_phage	100.0	3.3e-27
WP_001444000.1|5311486_5311768_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763383.1|5311866_5312088_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_156292148.1|5312084_5313032_+	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	99.7	4.0e-182
WP_001356547.1|5313033_5313210_+	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_000207903.1|5313543_5313900_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_000610373.1|5313896_5314247_+	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_001281188.1|5314434_5314779_+	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000132739.1|5314856_5315048_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001007946.1|5315028_5316207_-|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
5319270:5319285	attR	AAAAAGAATAAAAAAA	NA	NA	NA	NA
>prophage 15
NZ_CP046527	Escherichia coli strain RM19259 chromosome, complete genome	5511015	5399430	5437497	5511015	lysis,tail,terminase,integrase,head,portal,holin,plate,tRNA,capsid	Escherichia_phage(63.64%)	49	5403730:5403757	5435690:5435717
WP_000675144.1|5399430_5400834_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
WP_000137884.1|5400830_5401553_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_001301848.1|5401743_5402076_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476014.1|5402223_5403585_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
5403730:5403757	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|5403858_5404077_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882933.1|5404158_5405322_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.4	1.7e-203
WP_000978913.1|5405321_5405801_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_000069957.1|5405815_5408263_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.3	0.0e+00
WP_001496926.1|5408255_5408375_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	1.4e-15
WP_001031303.1|5408407_5408683_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|5408739_5409258_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286706.1|5409270_5410461_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	6.9e-224
WP_000905094.1|5410520_5411114_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.5	2.1e-104
WP_001145592.1|5411144_5411555_+	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	98.4	5.9e-66
WP_001008233.1|5411575_5412019_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	99.3	4.9e-82
WP_001057694.1|5411990_5412593_-|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	91.0	1.5e-97
WP_000217052.1|5412592_5413912_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	68.5	1.2e-179
WP_001285352.1|5413908_5414520_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_001121479.1|5414512_5415421_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	7.5e-162
WP_000127154.1|5415425_5415773_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	6.5e-58
WP_001093728.1|5415769_5416405_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.9e-112
WP_001001810.1|5416471_5416924_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	97.3	2.2e-74
WP_000917144.1|5416916_5417384_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	2.5e-81
WP_001300730.1|5417346_5417520_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000040644.1|5417491_5417917_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	94.3	2.0e-64
WP_000736555.1|5417904_5418330_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	98.6	1.2e-61
WP_001144101.1|5418344_5418842_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|5418841_5419123_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846406.1|5419126_5419330_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
WP_000988633.1|5419329_5419839_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000203418.1|5419938_5420682_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	97.6	7.3e-123
WP_001248594.1|5420685_5421759_-|capsid	phage major capsid protein, P2 family	capsid	Q83VT1	Escherichia_phage	99.2	1.6e-200
WP_001085952.1|5421817_5422672_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_000156848.1|5422845_5424618_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.7	0.0e+00
WP_000038161.1|5424617_5425652_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_000844437.1|5425969_5427937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302413.1|5427936_5428389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000063136.1|5428435_5429659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268574.1|5429748_5432031_-	replication endonuclease	NA	M1SV59	Escherichia_phage	91.3	0.0e+00
WP_000027664.1|5432020_5432296_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113265.1|5432292_5432517_-	hypothetical protein	NA	S4TRY6	Salmonella_phage	98.6	3.2e-34
WP_001277898.1|5432519_5432819_-	hypothetical protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_000557698.1|5432818_5433043_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_000217670.1|5433106_5433607_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001081582.1|5433784_5434060_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000020919.1|5434181_5434481_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_000985260.1|5434596_5435610_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_001303579.1|5435874_5436192_-	hypothetical protein	NA	NA	NA	NA	NA
5435690:5435717	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000807362.1|5436597_5437497_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 16
NZ_CP046527	Escherichia coli strain RM19259 chromosome, complete genome	5511015	5482052	5510471	5511015	tail,protease,portal,terminase	Enterobacteria_phage(88.89%)	28	NA	NA
WP_001301655.1|5482052_5483189_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_001087225.1|5483185_5485189_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001295429.1|5485313_5485775_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|5485816_5486287_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|5486333_5487053_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_071782030.1|5487049_5488666_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.1e-293
WP_001261937.1|5489250_5489499_+	DinI family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001023381.1|5489866_5490136_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	1.0e-42
WP_156292149.1|5490137_5491451_-|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	99.5	2.2e-77
WP_001228302.1|5491515_5492115_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	99.5	1.3e-109
WP_156292150.1|5492182_5495656_-	DUF1983 domain-containing protein	NA	A0A0P0ZBW1	Stx2-converting_phage	89.8	0.0e+00
WP_072147834.1|5495896_5496526_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_000194798.1|5496471_5497215_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_001302134.1|5497225_5497924_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	98.3	5.2e-131
WP_000847298.1|5497923_5498253_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000918238.1|5498249_5500895_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	94.4	0.0e+00
WP_000532073.1|5500938_5501247_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479062.1|5501273_5501696_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_000235090.1|5501709_5502462_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|5502469_5502868_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974960.1|5502880_5503504_-	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	99.5	2.5e-100
WP_001281350.1|5503506_5503788_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|5503780_5504107_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114424.1|5504194_5506219_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_000974564.1|5506163_5507666_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102414.1|5507665_5507878_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_001077625.1|5507874_5509998_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000348565.1|5509994_5510471_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
>prophage 1
NZ_CP046526	Escherichia coli strain RM19259 plasmid pRM19259, complete sequence	98304	10009	71123	98304	transposase,protease,integrase	Macacine_betaherpesvirus(26.32%)	55	3165:3179	73950:73964
3165:3179	attL	CGACAACAGCTGCAA	NA	NA	NA	NA
WP_001066920.1|10009_10750_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|11034_12012_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_000708307.1|12419_12620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|12616_13237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|13233_13917_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|14375_14594_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001458194.1|14547_14682_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	89.7	5.8e-07
WP_085949318.1|14647_15861_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	6.5e-169
WP_027868286.1|15914_16214_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016989.1|16214_17021_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_077631973.1|17697_17778_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.5e-07
WP_085948178.1|17743_18957_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000852148.1|19032_19788_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	99.6	1.1e-142
WP_000772446.1|20375_21542_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|21541_22513_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000273919.1|23207_24110_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_010891292.1|24113_24419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085945.1|24495_25179_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
WP_001104869.1|25179_25401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358893.1|25294_25849_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_010891293.1|26978_27281_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271685.1|27327_27750_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001027495.1|27746_27938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303399.1|28056_28446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000218642.1|28933_29164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000199442.1|29215_30577_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_001302171.1|30623_31187_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	36.7	1.0e-20
WP_001451816.1|31272_31722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000290823.1|32023_32476_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	59.3	4.4e-46
WP_000005995.1|32532_32766_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_000117168.1|32831_34790_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.7	1.8e-19
WP_000845908.1|34844_35279_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276250.1|35275_36037_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001302184.1|36268_36427_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001453090.1|38649_39081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000581721.1|40867_50377_+	toxin B	NA	NA	NA	NA	NA
WP_000205762.1|52635_53382_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	6.4e-10
WP_000704522.1|53440_54301_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	2.3e-11
WP_000840472.1|54403_54964_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001302189.1|55096_55309_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001233856.1|55553_56015_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	9.4e-20
WP_001302200.1|56060_56270_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_000766796.1|56307_56646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000083831.1|56885_57140_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001370046.1|57375_57450_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000130945.1|57442_58300_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001178089.1|59211_59496_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000421248.1|59495_59771_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001105064.1|59865_60072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302179.1|61412_61598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000592771.1|61774_63985_+	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_001172748.1|64028_64418_+	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_085950648.1|65428_65524_+	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.8e-07
WP_001034100.1|65643_69546_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_071525077.1|70943_71123_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
73950:73964	attR	TTGCAGCTGTTGTCG	NA	NA	NA	NA
