The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045190	Escherichia coli strain NT1F31 chromosome, complete genome	4710443	752283	809801	4710443	transposase,protease	Escherichia_phage(37.5%)	47	NA	NA
WP_010723085.1|752283_753300_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000984978.1|754420_755245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298770.1|755256_755817_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_024238462.1|755847_756918_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001300858.1|756914_757994_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000524972.1|758029_759202_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	4.2e-40
WP_124354204.1|759201_759450_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_001077166.1|759481_760396_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000262881.1|760392_762123_-	fatty acyl-AMP ligase	NA	NA	NA	NA	NA
WP_001300526.1|762490_763633_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001297764.1|763639_764404_-	transcriptional regulator GlcC	NA	NA	NA	NA	NA
WP_000026117.1|764654_766154_+	glycolate oxidase subunit GlcD	NA	NA	NA	NA	NA
WP_000943100.1|766153_767206_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_001194661.1|767216_768440_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_000853256.1|768444_768849_+	protein GlcG	NA	NA	NA	NA	NA
WP_000084131.1|768870_771042_+	malate synthase G	NA	NA	NA	NA	NA
WP_000259302.1|771396_773079_+	glycolate permease GlcA	NA	NA	NA	NA	NA
WP_156262349.1|773563_778132_+|protease	lipoprotein metalloprotease SslE	protease	NA	NA	NA	NA
WP_156262350.1|778329_779100_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_156262351.1|779841_780147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156262352.1|781512_782112_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_152914951.1|782214_782427_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_080025647.1|783083_783299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156262353.1|783320_783854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156262354.1|783950_784190_+	AlpA family phage regulatory protein	NA	A0A1V0E8E5	Vibrio_phage	42.6	1.5e-05
WP_156262355.1|784441_784867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010723085.1|786001_787018_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_156262356.1|787756_788947_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_156262357.1|788964_790110_+	LegC family aminotransferase	NA	NA	NA	NA	NA
WP_156262358.1|790122_791289_+	UDP-N-acetylglucosamine 2-epimerase (hydrolyzing)	NA	NA	NA	NA	NA
WP_156262359.1|791299_792373_+	N-acetylneuraminate synthase	NA	NA	NA	NA	NA
WP_156262360.1|792365_793013_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_156262361.1|793029_794094_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_156262362.1|794090_794777_+	acylneuraminate cytidylyltransferase family protein	NA	NA	NA	NA	NA
WP_156262363.1|794780_796034_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_156262364.1|796038_796956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156262365.1|797689_798712_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	49.5	7.3e-89
WP_156262366.1|798735_798924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156262508.1|800251_801196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156262367.1|801241_801898_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_156262368.1|801921_802971_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_156262369.1|803928_804750_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_156262370.1|804823_805639_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_010723085.1|806234_807251_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_156262371.1|807555_807852_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_034167512.1|807848_808193_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	48.5	3.1e-20
WP_156262372.1|808277_809801_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	38.9	6.0e-79
>prophage 2
NZ_CP045190	Escherichia coli strain NT1F31 chromosome, complete genome	4710443	1069659	1082842	4710443		Escherichia_phage(40.0%)	12	NA	NA
WP_001295182.1|1069659_1070421_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1070414_1071041_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272590.1|1071180_1072320_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1072382_1073375_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104429.1|1073468_1074833_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136918.1|1074921_1075698_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1075702_1076341_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590405.1|1076337_1077600_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.0	8.3e-135
WP_000847985.1|1077596_1078505_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001295181.1|1078700_1079468_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_001141323.1|1079518_1080175_-	protein-serine/threonine phosphatase	NA	K7P7V3	Enterobacteria_phage	45.8	3.3e-50
WP_001272928.1|1080280_1082842_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 3
NZ_CP045190	Escherichia coli strain NT1F31 chromosome, complete genome	4710443	1710143	1718452	4710443		Enterobacteria_phage(83.33%)	9	NA	NA
WP_000569316.1|1710143_1711070_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|1711074_1711806_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1711786_1711894_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1711953_1712685_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1712906_1714592_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1714588_1715308_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1715354_1715825_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001373589.1|1715865_1716327_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
WP_001423058.1|1716451_1718452_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
>prophage 4
NZ_CP045190	Escherichia coli strain NT1F31 chromosome, complete genome	4710443	1811968	1820500	4710443	transposase	Klebsiella_phage(16.67%)	6	NA	NA
WP_001570045.1|1811968_1813363_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	3.7e-19
WP_000999466.1|1813520_1814516_+	N-acetyl-alpha-D-glucosaminyl-diphospho-ditrans, octacis-undecaprenol 4-epimerase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_000183060.1|1814758_1815652_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_010723085.1|1816325_1817342_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_061351668.1|1817679_1819086_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	6.2e-38
WP_122056914.1|1819333_1820500_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.0	1.7e-113
>prophage 5
NZ_CP045190	Escherichia coli strain NT1F31 chromosome, complete genome	4710443	2255037	2291415	4710443	transposase,integrase,tail,protease	Escherichia_phage(50.0%)	38	2255003:2255062	2283014:2284211
2255003:2255062	attL	TAGGGAAGGTGCGAACAAGTCCCTGATATGAGATCATGTTTGTCATCTGGAGCCATAGAA	NA	NA	NA	NA
WP_010723085.1|2255037_2256054_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001303517.1|2256308_2256479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000276149.1|2256585_2256951_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_000046661.1|2256937_2257267_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_001260865.1|2257305_2258127_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2258226_2258310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743957.1|2258402_2258738_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|2259134_2260388_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019525.1|2260494_2261388_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225262.1|2261522_2262743_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2262867_2263563_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|2263515_2264808_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2264966_2265581_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_023281261.1|2265623_2266478_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2266479_2267097_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_072131186.1|2267107_2269531_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.5	4.8e-208
WP_122056936.1|2269591_2270758_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	46.9	1.6e-84
WP_001249854.1|2270947_2272306_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001018629.1|2272661_2273129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122057054.1|2273669_2273951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000199921.1|2273940_2274441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116835510.1|2274717_2275209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000152753.1|2275293_2276280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122056939.1|2277077_2278535_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	49.9	1.3e-120
WP_001300836.1|2278733_2279039_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_072131602.1|2279146_2279827_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2279859_2280420_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2280454_2280796_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2280930_2281257_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2281462_2282677_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_156262430.1|2282688_2283039_+	alcohol dehydrogenase catalytic domain-containing protein	NA	E3SJ82	Synechococcus_phage	40.0	1.6e-08
WP_010723085.1|2283048_2284065_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001360138.1|2284964_2285075_+	hypothetical protein	NA	NA	NA	NA	NA
2283014:2284211	attR	TAGGGAAGGTGCGAACAAGTCCCTGATATGAGATCATGTTTGTCATCTGGAGCCATAGAACAGGGTTCATCATGAGTCATCAACTTACCTTCGCCGACAGTGAATTCAGCAGTAAGCGCCGTCAGACCAGAAAAGAGATTTTCTTGTCCCGCATGGAGCAGATTCTGCCATGGCAAAACATGGTGGAAGTCATCGAGCCGTTTTACCCCAAGGCTGGTAATGGCCGGCGACCTTATCCGCTGGAAACCATGCTACGCATTCACTGCATGCAGCATTGGTACAACCTGAGCGATGGCGCGATGGAAGATGCTCTGTACGAAATCGCCTCCATGCGTCTGTTTGCCCGGTTATCCCTGGATAGCGCCTTGCCGGACCGCACCACCATCATGAATTTCCGCCACCTGCTGGAGCAGCATCAACTGGCCCGCCAATTGTTCAAGACCATCAATCGCTGGCTGGCCGAAGCAGGCGTCATGATGACTCAAGGCACCTTGGTCGATGCCACCATCATTGAGGCACCCAGCTCGACCAAGAACAAAGAGCAGCAACGCGATCCGGAGATGCATCAGACCAAGAAAGGCAATCAGTGGCACTTTGGCATGAAGGCCCACATTGGTGTCGATGCCAAGAGTGGCCTGACCCACAGCCTAGTCACCACCGCGGCCAACGAGCATGACCTCAATCAGCTGGGTAATCTGCTGCATGGAGAGGAGCAATTTGTCTCAGCCGATGCCGGCTACCAAGGGGCGCCACAGCGCGAGGAGCTGGCCGAGGTGGATGTGGACTGGCTGATCGCCGAGCGCCCCGGCAAGGTAAGAACCTTGAAACAGCATCCACGCAAGAACAAAACGGCCATCAACATCGAATACATGAAAGCCAGCATCCGGGCCAGGGTGGAGCACCCATTTCGCATCATCAAGCGACAGTTCGGCTTCGTGAAAGCCAGATACAAGGGGTTGCTGAAAAACGATAACCAACTGGCGATGTTATTCACGCTGGCCAACCTGTTTCGGGCGGACCAAATGATACGTCAGTGGGAGAGATCTCACTAAAAACTGGGGATAACGCCTTAAATGGCGAAGAAACGGTCTAAATAGGCTGATTCAAGGCATTTACGGGAGAAAAAATCGGCTCAAACATGAAGAAATGAAATGACTGAGTCAGCCGAGAAGAATTTCCCCGCTTATTCGCACCTTCC	NA	NA	NA	NA
WP_001296941.1|2286409_2286646_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_032216168.1|2286733_2289205_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	3.2e-58
WP_001083273.1|2289298_2289490_-	YebW family protein	NA	NA	NA	NA	NA
WP_085948316.1|2289575_2290848_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
WP_156262431.1|2290833_2291415_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	87.5	2.3e-95
>prophage 6
NZ_CP045190	Escherichia coli strain NT1F31 chromosome, complete genome	4710443	2489313	2558501	4710443	lysis,tRNA,integrase,tail,transposase	Escherichia_phage(45.28%)	69	2517689:2517705	2564099:2564115
WP_000837924.1|2489313_2490447_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001295593.1|2490587_2491022_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001157925.1|2491286_2491460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795384.1|2491799_2491913_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|2491981_2492215_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078178.1|2492531_2493122_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000839182.1|2493468_2493873_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	97.8	1.6e-68
WP_000612626.1|2493869_2494217_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_152914964.1|2494265_2495804_+|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	93.9	5.7e-279
WP_124038395.1|2496256_2499607_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	39.1	1.3e-12
WP_001233114.1|2499671_2500271_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.5	2.5e-105
WP_156262438.1|2500338_2503818_-	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	90.2	0.0e+00
WP_000741589.1|2503878_2504526_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
WP_000140750.1|2504423_2505167_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.9e-148
WP_000024051.1|2505869_2506208_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_156262439.1|2506200_2509434_-|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	34.2	1.4e-109
WP_012565075.1|2509907_2510267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947771.1|2510729_2511891_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_010723085.1|2512817_2513834_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000144678.1|2513866_2514259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024238973.1|2514255_2514636_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	5.0e-19
WP_024238974.1|2514636_2515020_-	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	3.7e-14
WP_000634211.1|2515019_2515415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000918487.1|2515637_2516777_-	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_000770042.1|2516875_2517640_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	6.9e-84
2517689:2517705	attL	GATCGCAGCAATAAAAA	NA	NA	NA	NA
WP_001351715.1|2517744_2518857_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	4.2e-114
WP_096177893.1|2518840_2520247_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	4.0e-186
WP_073387511.1|2521296_2522220_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	3.8e-177
WP_000089447.1|2522597_2523692_-	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	80.5	5.9e-113
WP_000126788.1|2523695_2523905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204037.1|2523882_2524815_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.4e-83
WP_001291094.1|2524807_2525599_-	transcriptional regulator	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_001097895.1|2525736_2527194_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001228688.1|2527390_2527576_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
WP_156262440.1|2528204_2529478_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	1.8e-169
WP_000839565.1|2529625_2529841_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001348108.1|2530092_2530467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000506936.1|2530638_2531067_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_122056958.1|2532111_2532654_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	1.7e-76
WP_000247763.1|2532650_2532941_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
WP_000940319.1|2532940_2533540_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000882656.1|2534008_2534221_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	75.7	3.0e-21
WP_122056959.1|2534265_2534373_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	1.1e-08
WP_000957772.1|2536094_2536787_+	calcium transporter ChaC	NA	NA	NA	NA	NA
WP_000019009.1|2536783_2537665_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000625667.1|2537795_2539073_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001676522.1|2539136_2541134_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.2	3.3e-21
WP_001151151.1|2541474_2541897_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_001262352.1|2541937_2543008_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	64.6	4.7e-62
WP_000693836.1|2543079_2543505_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391949.1|2543488_2543770_-	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000362155.1|2543870_2544290_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000233809.1|2544544_2544679_+	phage protein	NA	NA	NA	NA	NA
WP_001169151.1|2544689_2544845_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001450958.1|2544841_2545123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001312793.1|2545905_2546394_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|2546834_2547056_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|2547055_2547226_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|2547300_2547576_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_024232464.1|2547677_2550278_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	3.9e-248
WP_000166319.1|2550270_2551080_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|2551136_2551331_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|2551323_2551533_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|2551611_2551827_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|2551828_2553064_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_001157407.1|2553115_2554051_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123737.1|2554179_2555553_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2556030_2557014_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628058.1|2557268_2558501_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2564099:2564115	attR	TTTTTATTGCTGCGATC	NA	NA	NA	NA
>prophage 7
NZ_CP045190	Escherichia coli strain NT1F31 chromosome, complete genome	4710443	3126442	3171134	4710443	holin,protease,capsid,portal,integrase,tail,terminase,head	Enterobacteria_phage(46.03%)	63	3148956:3148971	3172842:3172857
WP_156262453.1|3126442_3127774_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.6	3.4e-22
WP_112042808.1|3127847_3128432_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	2.0e-104
WP_156262454.1|3128431_3131710_-|tail	phage tail protein	tail	X2KTY7	Enterobacteria_phage	58.8	6.5e-06
WP_156262455.1|3131774_3132374_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	3.3e-110
WP_032318912.1|3132443_3135857_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.9	0.0e+00
WP_000090891.1|3135917_3136550_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_156262456.1|3136486_3137230_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	5.6e-147
WP_052945536.1|3137234_3137933_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	4.7e-132
WP_000847331.1|3137932_3138262_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_156262457.1|3138258_3140820_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.7	0.0e+00
WP_156262458.1|3140812_3141247_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	3.4e-64
WP_000479193.1|3141228_3141651_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	2.2e-60
WP_156262459.1|3141666_3142407_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	1.2e-128
WP_000683105.1|3142414_3142810_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001541219.1|3142806_3143385_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	7.8e-80
WP_000753001.1|3143396_3143750_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	4.4e-62
WP_152922594.1|3143761_3144157_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	1.0e-54
WP_024232991.1|3144198_3145224_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.1	7.6e-187
WP_012304872.1|3145279_3145612_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	96.4	4.6e-53
WP_032318907.1|3145621_3146941_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	2.4e-233
WP_152922593.1|3146921_3148523_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	4.9e-310
WP_053276504.1|3148519_3148726_-|tail	phage tail protein	tail	A0A2R9YJL2	Escherichia_phage	98.5	1.3e-29
WP_001027268.1|3148722_3150648_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
3148956:3148971	attL	GCTCTTCAGCAGTCAG	NA	NA	NA	NA
WP_000453611.1|3150622_3151168_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001415975.1|3151556_3151751_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_001028468.1|3152104_3152626_-	DNA-binding protein	NA	H6WRZ8	Salmonella_phage	99.4	7.2e-101
WP_001228702.1|3152870_3153077_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	5.3e-31
WP_066018917.1|3153293_3153770_-	glycoside hydrolase family protein	NA	A5VW81	Enterobacteria_phage	99.4	1.4e-87
WP_001570152.1|3153753_3154077_-|holin	phage holin, lambda family	holin	K7PH31	Enterobacteria_phage	99.1	1.1e-51
WP_000658765.1|3154529_3155042_-	HNH endonuclease	NA	K7PL52	Enterobacteria_phage	100.0	4.7e-97
WP_137544056.1|3155235_3155754_-	DUF1133 family protein	NA	A0A192Y911	Salmonella_phage	98.3	7.7e-95
WP_000994516.1|3155750_3155939_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008199.1|3155935_3156298_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
WP_097513664.1|3156294_3156585_-	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	96.9	1.2e-49
WP_097513663.1|3156584_3157310_-	DNA-binding protein	NA	A0A2I6PIF5	Escherichia_phage	98.8	3.5e-130
WP_097513662.1|3157302_3157512_-	protein ninF	NA	G9L691	Escherichia_phage	98.6	3.1e-31
WP_016063041.1|3157471_3157873_-	hypothetical protein	NA	K7PJK0	Enterobacteria_phage	100.0	2.4e-72
WP_001254220.1|3157875_3158052_-	NinE family protein	NA	K7PHE6	Enterobacteria_phage	100.0	2.7e-28
WP_089519465.1|3158048_3158576_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	3.6e-100
WP_109552319.1|3158572_3159013_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	99.3	7.7e-80
WP_089519463.1|3159287_3160664_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.1	1.1e-252
WP_001608293.1|3160660_3161482_-	replication protein	NA	K7PJZ3	Enterobacterial_phage	99.6	2.0e-153
WP_000442612.1|3161662_3161959_-	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000064149.1|3162097_3162331_-	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	98.7	2.3e-35
WP_112844291.1|3162444_3163149_+	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	100.0	2.5e-133
WP_112844290.1|3163285_3163573_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	98.9	2.3e-48
WP_112844289.1|3163569_3164226_+	transcriptional regulator	NA	A0A0P0ZCT8	Stx2-converting_phage	99.5	7.6e-116
WP_112844288.1|3164222_3164627_+	hypothetical protein	NA	A0A0P0ZDD3	Stx2-converting_phage	99.3	6.2e-68
WP_156262460.1|3165077_3165350_+	antitermination protein N	NA	A0A0N7C217	Escherichia_phage	98.9	1.7e-40
WP_001077327.1|3165353_3165578_+	hypothetical protein	NA	K7PJZ1	Enterobacterial_phage	100.0	8.0e-33
WP_080317411.1|3165640_3165823_+	hypothetical protein	NA	K7PLQ2	Enterobacteria_phage	98.3	7.2e-32
WP_001198866.1|3166054_3166195_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q9AZ26	Salmonella_phage	100.0	3.3e-21
WP_015966850.1|3166187_3166301_+	host cell division inhibitory peptide Kil	NA	K7PL44	Enterobacteria_phage	100.0	2.7e-13
WP_156262461.1|3166297_3166486_+	hypothetical protein	NA	G9L668	Escherichia_phage	98.4	3.8e-28
WP_015966849.1|3166494_3167175_+	AAA family ATPase	NA	K7PMI2	Enterobacteria_phage	100.0	5.8e-127
WP_047402678.1|3167171_3167759_+	hypothetical protein	NA	G9L666	Escherichia_phage	99.0	2.4e-105
WP_096941563.1|3167782_3168079_+	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	99.0	3.0e-51
WP_001576836.1|3168089_3168254_+	DUF2737 family protein	NA	K7P7M6	Enterobacteria_phage	100.0	5.5e-23
WP_156262462.1|3168250_3168733_+	hypothetical protein	NA	K7PJM1	Enterobacteria_phage	98.8	5.7e-84
WP_156262463.1|3168729_3169245_+	DUF551 domain-containing protein	NA	A5VWB3	Enterobacteria_phage	52.0	8.8e-43
WP_021529401.1|3169419_3169764_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	99.1	1.2e-59
WP_001303849.1|3169867_3170086_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533642.1|3170063_3171134_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
3172842:3172857	attR	GCTCTTCAGCAGTCAG	NA	NA	NA	NA
>prophage 8
NZ_CP045190	Escherichia coli strain NT1F31 chromosome, complete genome	4710443	3635648	3716867	4710443	terminase,holin,protease,lysis,portal,integrase,tail,transposase	Enterobacteria_phage(35.85%)	84	3642376:3642407	3726132:3726163
WP_000131044.1|3635648_3637682_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001335745.1|3637810_3638398_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089110.1|3638411_3639884_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_096178293.1|3639897_3641568_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_156262476.1|3641780_3642398_+	hypothetical protein	NA	NA	NA	NA	NA
3642376:3642407	attL	GGAAGGTGCGAACAAGTCCCTGATATGAGATC	NA	NA	NA	NA
WP_010723085.1|3642407_3643424_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001301257.1|3643820_3644363_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_024238329.1|3644437_3645025_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|3645082_3645751_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001310578.1|3648290_3649934_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301243.1|3649902_3650613_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001303809.1|3650925_3651255_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_024238330.1|3651266_3651497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001019920.1|3651501_3652116_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070679.1|3652532_3653222_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643325.1|3653218_3654175_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000121359.1|3656378_3657335_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_122057008.1|3657313_3657724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032318915.1|3658421_3659771_+	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	98.2	1.5e-259
WP_072148972.1|3660523_3661738_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.1	3.9e-33
WP_001288444.1|3661772_3663206_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.1	4.1e-106
WP_000355482.1|3663609_3664383_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	37.7	4.1e-36
WP_052978390.1|3664452_3665037_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.8	3.0e-103
WP_156262477.1|3665036_3668111_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	2.5e-68
WP_156262455.1|3668175_3668775_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	3.3e-110
WP_156262478.1|3668844_3672258_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	97.3	0.0e+00
WP_001309913.1|3672318_3672966_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	2.5e-111
WP_032151194.1|3672863_3673607_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	2.3e-148
WP_001152385.1|3673612_3674311_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_156262479.1|3674320_3674650_-|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	98.2	1.1e-59
WP_156262480.1|3674649_3677715_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.2	0.0e+00
WP_001161009.1|3677686_3678016_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3678024_3678411_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211088.1|3678471_3679215_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	99.6	3.0e-132
WP_001079398.1|3679226_3679628_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000677106.1|3679624_3680203_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_001283153.1|3680214_3680490_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3680482_3680806_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_077758915.1|3680892_3682920_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	99.4	0.0e+00
WP_000985939.1|3682864_3684373_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	1.0e-288
WP_001072973.1|3684372_3684585_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	98.6	7.1e-31
WP_052978308.1|3684581_3686684_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	99.6	0.0e+00
WP_000349509.1|3686683_3687175_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_000025003.1|3687509_3687830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001356226.1|3688210_3688654_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	77.9	7.1e-57
WP_021579192.1|3688650_3689148_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	98.8	2.9e-91
WP_000839596.1|3689147_3689363_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000799656.1|3689430_3690483_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000917724.1|3690633_3690837_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000357056.1|3691156_3692176_+	hypothetical protein	NA	A0A0R6PIZ6	Moraxella_phage	32.5	2.4e-39
WP_080086273.1|3692190_3692571_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	90.0	6.1e-57
WP_047928510.1|3692585_3693575_-	DUF968 domain-containing protein	NA	S5FV02	Shigella_phage	99.7	1.2e-194
WP_088224517.1|3693582_3694380_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	98.9	2.2e-149
WP_000767113.1|3694399_3694789_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_021518589.1|3694785_3695112_-	LexA repressor	NA	A0A291AWY9	Escherichia_phage	99.1	4.5e-53
WP_001332382.1|3695111_3695606_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	99.4	1.9e-87
WP_047928509.1|3695602_3696544_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.4	3.6e-143
WP_001250269.1|3696533_3696713_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_001434539.1|3696888_3697440_-	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	7.6e-101
WP_000205494.1|3697477_3697678_-	cell division protein	NA	NA	NA	NA	NA
WP_000450735.1|3697775_3698402_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
WP_000549623.1|3698649_3698856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016389.1|3698827_3699262_-	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_000008236.1|3699806_3700343_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242749.1|3700333_3700696_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|3700695_3701001_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_077941726.1|3700916_3701351_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	99.3	3.2e-78
WP_000051887.1|3701227_3702391_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893278.1|3702595_3703849_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_001285288.1|3703860_3704964_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749893.1|3705251_3706307_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	5.0e-117
WP_000174677.1|3706345_3706747_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189541.1|3706804_3708049_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|3708140_3708599_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_122057011.1|3708859_3710317_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001329160.1|3710373_3710910_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001321003.1|3710842_3711109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059847.1|3711342_3711795_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263493.1|3711804_3712203_-	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_000554757.1|3712205_3712499_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226164.1|3712550_3713606_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000636841.1|3713676_3714447_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_005136326.1|3714406_3716146_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000006255.1|3716369_3716867_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
3726132:3726163	attR	GGAAGGTGCGAACAAGTCCCTGATATGAGATC	NA	NA	NA	NA
>prophage 9
NZ_CP045190	Escherichia coli strain NT1F31 chromosome, complete genome	4710443	3726163	3798520	4710443	transposase,plate,protease,tRNA	Escherichia_phage(11.11%)	55	NA	NA
WP_010723085.1|3726163_3727180_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001404637.1|3731612_3733754_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.4e-25
WP_001142958.1|3733963_3734482_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_086624590.1|3735177_3735678_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|3735712_3735937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156262481.1|3735987_3737463_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611742.1|3737469_3737883_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_096178326.1|3737886_3739737_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|3739700_3740783_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113713.1|3740807_3742088_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|3742084_3742609_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246427.1|3742611_3743943_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343289.1|3743947_3744709_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614325.1|3744717_3747483_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
WP_000088852.1|3747479_3748223_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240525.1|3748227_3749640_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_156262510.1|3749748_3753183_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087741.1|3753193_3754546_+	membrane protein	NA	NA	NA	NA	NA
WP_001284199.1|3754569_3755052_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908052.1|3755095_3756010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236645.1|3756019_3756499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300756.1|3757956_3758688_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.1	1.3e-39
WP_000917883.1|3758752_3759220_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001295200.1|3759216_3759939_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052721.1|3759972_3760728_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|3760799_3762158_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_122057013.1|3762205_3762976_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|3763053_3763854_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648583.1|3764094_3765009_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001140174.1|3771661_3772234_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|3772421_3773453_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|3773445_3774099_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874226.1|3774138_3774954_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|3775071_3775476_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|3775472_3776180_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260712.1|3776290_3778009_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001301405.1|3778061_3778886_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000239183.1|3779085_3779796_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001741201.1|3779809_3780232_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185286.1|3780228_3780774_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|3780939_3781140_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|3781126_3781387_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_089639027.1|3781439_3782735_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|3782799_3783189_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020973.1|3783245_3785387_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|3785485_3786445_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294757.1|3786457_3789940_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|3789976_3790573_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_089639028.1|3790569_3791718_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|3791717_3792506_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|3792509_3792965_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139282.1|3793069_3794095_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|3794098_3794584_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|3794705_3797138_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001295561.1|3797167_3798520_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 10
NZ_CP045190	Escherichia coli strain NT1F31 chromosome, complete genome	4710443	4180211	4240137	4710443	transposase,integrase,protease,tRNA	Enterobacteria_phage(21.43%)	58	4233366:4233382	4247021:4247037
WP_000811566.1|4180211_4180487_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001295190.1|4180603_4182229_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_032257096.1|4182312_4183476_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	8.3e-81
WP_000101685.1|4183478_4184117_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|4184126_4184525_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012550.1|4184542_4185202_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511955.1|4185252_4185951_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|4185969_4186371_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|4186497_4187229_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_025670307.1|4187409_4189851_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	3.8e-67
WP_001177644.1|4189889_4190315_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4190519_4191818_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089296.1|4191921_4192119_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4192200_4193205_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_096178177.1|4193207_4194467_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|4194552_4195833_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|4195908_4196217_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_044860705.1|4196302_4197253_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_156262499.1|4197245_4199093_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	2.6e-60
WP_000990333.1|4199102_4200440_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|4200458_4200920_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_001355561.1|4200891_4202439_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001294219.1|4202437_4203577_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_010723271.1|4203559_4203613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|4204355_4204901_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041970.1|4204995_4206048_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_000934920.1|4206144_4207113_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_001236850.1|4207134_4210458_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_001300174.1|4210607_4212110_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000004771.1|4212328_4213306_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001192973.1|4213630_4215439_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829498.1|4215431_4216166_+	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001565385.1|4216176_4216572_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000609663.1|4216582_4216942_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_001460207.1|4217004_4218138_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001238379.1|4218226_4218763_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	3.6e-47
WP_000118483.1|4218756_4219074_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000239596.1|4219249_4219396_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000977757.1|4219506_4219632_-	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000257278.1|4219683_4220250_-	elongation factor P	NA	NA	NA	NA	NA
WP_156262500.1|4220291_4221320_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_096178178.1|4221714_4222584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001565383.1|4222776_4223130_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729117.1|4223267_4224914_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|4224957_4225251_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000015852.1|4225526_4226783_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001267445.1|4226798_4227275_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000069437.1|4227611_4229048_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000961959.1|4229165_4230467_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000883400.1|4230582_4230921_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000068902.1|4230896_4232594_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_001188520.1|4232630_4233206_+	transcriptional regulator	NA	NA	NA	NA	NA
4233366:4233382	attL	TTCGATTCCGAGTCCGG	NA	NA	NA	NA
WP_001218741.1|4233564_4234755_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.1	5.8e-122
WP_156262501.1|4234867_4235791_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.2	6.6e-166
WP_040062538.1|4235901_4236669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113772190.1|4237879_4237990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040064658.1|4238203_4238905_-	DUF4396 domain-containing protein	NA	NA	NA	NA	NA
WP_140044983.1|4239213_4240137_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.5	5.6e-165
4247021:4247037	attR	TTCGATTCCGAGTCCGG	NA	NA	NA	NA
>prophage 1
NZ_CP045191	Escherichia coli strain NT1F31 plasmid pNT1F31-113kb, complete sequence	113072	0	112751	113072	integrase,tail,terminase,tRNA	Salmonella_phage(88.89%)	114	22660:22679	31470:31489
WP_000105080.1|0_1095_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	45.4	1.3e-75
WP_001229345.1|1674_1887_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	3.4e-33
WP_032252468.1|1886_2222_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	84.7	1.6e-48
WP_023135695.1|2218_2398_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	81.4	1.6e-15
WP_023135696.1|2436_2712_-	hypothetical protein	NA	J9Q738	Salmonella_phage	91.2	1.1e-44
WP_156262513.1|3592_6610_-	DEAD/DEAH box helicase	NA	A0A220A398	Liberibacter_phage	25.2	2.3e-21
WP_156262514.1|6624_7788_-	DUF4268 domain-containing protein	NA	NA	NA	NA	NA
WP_156262515.1|7797_9129_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_032328847.1|9128_11558_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	28.1	7.9e-25
WP_001711109.1|11985_12186_-	membrane protein	NA	J9Q6J0	Salmonella_phage	54.5	1.8e-07
WP_156262516.1|12276_14616_-	recombinase RecA	NA	J9Q736	Salmonella_phage	85.1	1.8e-29
WP_000920224.1|14618_14885_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	77.3	2.6e-30
WP_001718062.1|14884_15829_-	5'-3' exonuclease SAM fold family protein	NA	J9Q7S6	Salmonella_phage	88.9	2.7e-162
WP_061158072.1|15889_16918_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	86.3	1.4e-143
WP_151164908.1|17035_17467_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	84.6	2.6e-64
WP_052988641.1|18006_18570_+	hypothetical protein	NA	J9Q7G7	Salmonella_phage	68.2	3.3e-67
WP_000066497.1|18899_19115_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	77.1	2.9e-24
WP_021520507.1|19418_22925_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	88.3	0.0e+00
22660:22679	attL	AATGATTCCATACATCTCAT	NA	NA	NA	NA
WP_156262517.1|23105_24341_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	81.0	1.5e-197
WP_073503566.1|24436_26545_-	cobalamin biosynthesis protein CobT	NA	J9Q7G6	Salmonella_phage	67.1	4.8e-228
WP_001098353.1|26643_26856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001282576.1|27107_27494_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000797845.1|27488_28592_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	33.8	1.3e-27
WP_000156433.1|28802_29048_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	44.9	4.5e-13
WP_025670480.1|29044_29395_-	hypothetical protein	NA	Q716B1	Shigella_phage	51.7	4.6e-27
WP_000067985.1|31048_31339_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	79.2	2.4e-37
WP_000636535.1|31484_31700_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	72.5	3.3e-20
31470:31489	attR	ATGAGATGTATGGAATCATT	NA	NA	NA	NA
WP_001755526.1|31696_33019_-	ATP-dependent DNA ligase	NA	J9Q7G5	Salmonella_phage	91.4	4.0e-241
WP_001718054.1|33015_33273_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	60.2	3.9e-15
WP_025670481.1|33553_34330_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	41.1	2.4e-52
WP_096179504.1|34405_35587_-	DNA primase	NA	J9Q720	Salmonella_phage	93.5	8.1e-209
WP_000137333.1|35668_37009_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	93.5	3.4e-235
WP_001717320.1|37052_37793_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	89.6	2.2e-127
WP_021547968.1|38075_38843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000062085.1|38895_39255_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.5e-44
WP_000161228.1|39254_39923_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	91.4	1.7e-110
WP_001351987.1|40241_40511_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_156262518.1|40518_41040_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000901559.1|41208_41460_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	75.6	2.0e-24
WP_000856757.1|41461_42154_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	94.3	6.2e-124
WP_042863551.1|42167_42491_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	97.2	8.0e-50
WP_128111718.1|42565_43354_-	receptor-recognizing protein	NA	E5DHZ0	Enterobacter_phage	61.6	1.0e-53
WP_156262519.1|47351_48035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156262520.1|48670_53398_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	74.0	0.0e+00
WP_001293195.1|53416_54010_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	90.9	2.0e-99
WP_000526939.1|53997_54795_-|tail	tail protein	tail	J9Q7R4	Salmonella_phage	93.6	1.3e-154
WP_001351970.1|54787_55519_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	96.6	1.5e-133
WP_000442112.1|55568_55904_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	87.3	8.0e-53
WP_156262521.1|55946_60494_-	tape measure protein	NA	J9Q712	Salmonella_phage	68.6	0.0e+00
WP_001351971.1|60501_60771_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	94.8	1.7e-34
WP_000163861.1|60851_61169_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	96.2	8.6e-49
WP_077136349.1|61224_61971_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	91.5	1.3e-119
WP_000469440.1|62045_62429_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	82.7	1.2e-57
WP_000523628.1|62430_62904_-	hypothetical protein	NA	J9Q711	Salmonella_phage	90.4	3.3e-76
WP_001027663.1|62894_63239_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	95.6	2.3e-55
WP_000057118.1|63318_64152_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	92.1	1.3e-141
WP_000801186.1|64151_64586_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	81.9	1.9e-59
WP_021520523.1|64630_65551_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	78.6	5.3e-123
WP_001130339.1|65624_66500_-	hypothetical protein	NA	J9Q710	Salmonella_phage	93.8	4.2e-154
WP_156262522.1|66525_67413_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	88.6	6.0e-132
WP_000422363.1|67434_69009_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	92.9	8.4e-286
WP_001007299.1|69035_70292_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	96.4	7.5e-245
WP_000215413.1|70291_70924_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	83.8	1.8e-90
WP_000176292.1|71120_71387_-	hypothetical protein	NA	J9Q757	Salmonella_phage	88.6	1.4e-36
WP_024181929.1|71396_72296_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	98.3	1.0e-166
WP_001113022.1|72292_72547_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	96.4	5.9e-40
WP_156262523.1|72539_73178_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.1	1.2e-110
WP_000161986.1|73174_73843_-	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	89.6	5.6e-106
WP_089546170.1|73842_74541_-	chromosome partitioning protein ParB	NA	J9Q756	Salmonella_phage	87.1	5.1e-110
WP_077127610.1|74605_76165_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.1	3.2e-277
WP_001291061.1|76167_76446_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	58.2	4.6e-22
WP_077127611.1|76478_77078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063091537.1|77380_77971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063091536.1|77970_78495_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	66.7	8.1e-52
WP_156262524.1|78810_79461_+	hypothetical protein	NA	J9Q754	Salmonella_phage	87.0	1.3e-102
WP_063091534.1|79511_79742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156262525.1|80366_80849_-	hypothetical protein	NA	J9Q805	Salmonella_phage	69.2	8.8e-61
WP_023145151.1|81053_81341_-	hypothetical protein	NA	J9Q753	Salmonella_phage	79.6	2.1e-38
WP_049076852.1|81670_82081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122057111.1|82162_82558_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	53.8	2.4e-32
WP_000749406.1|82684_82996_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	64.1	3.3e-29
WP_021533329.1|83149_83479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001405018.1|85052_85274_-	hypothetical protein	NA	J9Q750	Salmonella_phage	52.2	8.7e-16
WP_156262526.1|85513_87547_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	24.1	2.2e-44
WP_000004356.1|87704_88805_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_060460704.1|88842_89232_-	DNA repair protein	NA	A0A077SK24	Escherichia_phage	93.0	1.9e-66
WP_052988680.1|89418_89799_-	hypothetical protein	NA	J9Q801	Salmonella_phage	68.6	1.3e-27
WP_032217405.1|89798_90503_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	76.4	3.6e-87
WP_156262527.1|90564_92250_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	92.2	0.0e+00
WP_000467662.1|92353_92968_-	hypothetical protein	NA	A0A0E3GMH9	Enterobacteria_phage	82.8	1.2e-99
WP_000335122.1|93306_93876_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	61.4	1.4e-52
WP_021520148.1|94015_94174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000900261.1|94173_94599_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	78.7	5.7e-56
WP_001103988.1|94692_94881_-	hypothetical protein	NA	J9Q800	Salmonella_phage	53.2	7.2e-11
WP_156262528.1|94890_95385_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	51.2	2.2e-27
WP_156262529.1|95530_96124_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	83.2	4.8e-93
WP_000121543.1|96708_96939_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.2	5.9e-31
WP_000559568.1|97124_97718_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	86.3	2.0e-99
WP_021520509.1|97901_98711_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	53.6	8.9e-66
WP_156262530.1|98871_99426_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	78.1	6.3e-79
WP_104772246.1|99435_99855_-	hypothetical protein	NA	J9Q743	Salmonella_phage	72.7	5.0e-52
WP_000386470.1|99916_100561_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	81.8	4.6e-97
WP_000781810.1|100560_101037_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	90.5	2.0e-81
WP_022644975.1|101033_101447_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	85.4	3.6e-63
WP_156262531.1|101448_102579_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	93.7	5.0e-208
WP_001011859.1|102723_103593_-	hypothetical protein	NA	J9Q742	Salmonella_phage	81.0	3.1e-133
WP_000122502.1|103670_104813_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	88.7	2.6e-196
WP_156262532.1|104919_107235_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	84.4	0.0e+00
WP_000037962.1|107308_107878_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	86.8	1.1e-91
WP_000008655.1|107887_108631_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	47.2	2.0e-51
WP_156262533.1|108620_110537_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	72.9	4.2e-247
WP_089455004.1|110533_110725_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	76.2	3.7e-23
WP_000174803.1|110766_111852_-	exonuclease	NA	J9Q7S9	Salmonella_phage	87.5	8.0e-187
WP_000364573.1|112106_112751_-	hypothetical protein	NA	J9Q739	Salmonella_phage	86.3	2.9e-107
>prophage 1
NZ_CP045189	Escherichia coli strain NT1F31 plasmid pNT1F31-96kb, complete sequence	96046	11337	53574	96046	integrase,transposase	Escherichia_phage(21.43%)	43	9686:9703	52983:53000
9686:9703	attL	GCGGTACAGCAGGTTTTC	NA	NA	NA	NA
WP_000038336.1|11337_12276_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.4	2.7e-66
WP_001247862.1|12340_12607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000218863.1|12698_13133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000117622.1|13861_14362_-	antirestriction protein	NA	G9FHQ1	Rhodococcus_virus	27.3	4.2e-05
WP_001535708.1|14824_15421_-	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	61.9	3.1e-15
WP_001535709.1|16133_16568_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_000006012.1|18639_18873_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001276114.1|18930_19458_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.4	9.3e-48
WP_001303314.1|19809_20157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001027493.1|20228_20420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156262324.1|20416_20839_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_014653258.1|20885_21188_-	antirestriction protein	NA	NA	NA	NA	NA
WP_156262325.1|22549_23110_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_156262326.1|23219_23903_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.9e-29
WP_000273912.1|24286_25189_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000618111.1|25606_25855_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	49.3	1.1e-14
WP_000109072.1|25851_26289_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000457524.1|26288_27563_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.4	7.6e-144
WP_001278818.1|27564_27981_-	recombinase	NA	NA	NA	NA	NA
WP_000688514.1|27973_28954_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	51.4	1.7e-79
WP_000030199.1|29366_29675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001144036.1|29761_30406_-	ParA family protein	NA	NA	NA	NA	NA
WP_001535715.1|30585_31365_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.6	4.0e-55
WP_001535716.1|31366_31780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001535717.1|32579_32870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000542418.1|32869_34000_-	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_001127573.1|34029_35133_-	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_000371888.1|35461_35719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194553.1|35718_36309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000818359.1|36573_38130_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001535718.1|38324_38942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|40674_41379_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_156262327.1|41938_42343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112777917.1|42359_43229_-	23S ribosomal RNA methyltransferase Erm	NA	NA	NA	NA	NA
WP_112929415.1|43513_44008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156262328.1|44328_45579_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067858.1|45631_46336_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000907873.1|47390_48422_-	replication initiation protein	NA	NA	NA	NA	NA
WP_001324596.1|49394_49658_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	54.0	6.1e-08
WP_000483804.1|49626_49863_+	conjugal transfer protein TraA	NA	NA	NA	NA	NA
WP_001303319.1|50304_50838_+	transcription termination factor NusG	NA	NA	NA	NA	NA
WP_000213857.1|51091_51775_+	conjugal transfer protein TraC	NA	NA	NA	NA	NA
WP_085947917.1|52301_53574_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
52983:53000	attR	GAAAACCTGCTGTACCGC	NA	NA	NA	NA
>prophage 1
NZ_CP045188	Escherichia coli strain NT1F31 plasmid pNT1F31-tetX4, complete sequence	115253	4892	82143	115253	integrase,transposase	Escherichia_phage(17.14%)	62	78566:78625	81387:82207
WP_001531602.1|4892_7898_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.9	0.0e+00
WP_001235713.1|8061_8619_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|8801_9662_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_077141251.1|9772_10267_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000336323.1|11562_11730_-	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	68.0	1.6e-14
WP_025989258.1|11848_13768_-	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A2K5B2A5	Erysipelothrix_phage	96.4	0.0e+00
WP_012386611.1|13783_13870_-	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_001067855.1|15253_15958_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001516695.1|16118_16775_-	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_001067858.1|17476_18181_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000105383.1|18447_19884_+	glutathione synthase	NA	NA	NA	NA	NA
WP_000565612.1|21355_21439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000203396.1|21593_22238_-	resolvase	NA	A0A1V0E035	Clostridioides_phage	28.3	3.4e-07
WP_000516402.1|22618_23281_+	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
WP_001185482.1|23378_23660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024245156.1|23684_24662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000456533.1|24658_25015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001050931.1|25637_26474_-	replication initiation protein	NA	NA	NA	NA	NA
WP_000121743.1|27707_27959_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_000220560.1|27948_28230_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	62.4	3.8e-24
WP_105278499.1|29147_29405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156262321.1|29441_30365_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.5	7.8e-167
WP_000843497.1|30753_30951_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_001398208.1|30991_33469_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.4	2.9e-83
WP_000758229.1|33566_34007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020219104.1|34093_37240_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.4	2.1e-62
WP_001381488.1|37250_38543_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_001246155.1|38656_39010_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_000475512.1|39037_40423_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_000697969.1|40612_41293_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.1e-31
WP_000555737.1|41285_42761_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_000790483.1|43011_43443_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_000694953.1|43586_43937_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	54.3	1.9e-20
WP_085948316.1|45659_46932_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
WP_001148756.1|47205_48180_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_000796235.1|49109_49781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022631000.1|49800_50589_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.5e-52
WP_001326966.1|50646_50838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001254932.1|51788_52940_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000639434.1|53317_53599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021512928.1|54507_55833_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	6.5e-114
WP_000612626.1|56766_57114_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000817038.1|62647_63619_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	1.4e-150
WP_000523812.1|63618_64785_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	3.0e-224
WP_000200070.1|65525_66536_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	54.3	3.0e-87
WP_139570044.1|66774_67698_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	1.1e-176
WP_033548869.1|67864_68281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001039462.1|68865_69201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001515192.1|69209_69401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000807690.1|70528_71284_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	4.5e-136
WP_001067855.1|72643_73348_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032492336.1|73475_74705_+	macrolide efflux MFS transporter Mef(B)	NA	A0A1B0RXG2	Streptococcus_phage	39.0	2.1e-74
WP_054377175.1|74850_75714_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_001354008.1|75751_75997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|76465_77257_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_109023896.1|77259_77535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156262322.1|77557_77920_+	hypothetical protein	NA	A0A0K2CZ57	Paenibacillus_phage	41.0	5.8e-17
WP_156262323.1|78016_78193_+	hypothetical protein	NA	NA	NA	NA	NA
78566:78625	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067858.1|78617_79322_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000845048.1|79467_80481_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001317507.1|80636_81110_+	trimethoprim-resistant dihydrofolate reductase DfrA5	NA	G3MBI7	Bacillus_virus	27.7	1.0e-13
WP_001067858.1|81438_82143_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
81387:82207	attR	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGTTGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGTGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCC	NA	NA	NA	NA
