The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP033102	Enterobacter hormaechei strain L51 chromosome, complete genome	5018729	1278874	1363731	5018729	integrase,head,tRNA,transposase,plate,tail	Burkholderia_virus(33.33%)	100	1286418:1286438	1364199:1364219
WP_157506957.1|1278874_1282087_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	36.5	1.5e-55
WP_016242197.1|1282118_1282712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096149208.1|1282713_1283328_-	hypothetical protein	NA	Q6QIB7	Burkholderia_phage	43.0	3.4e-25
WP_096149207.1|1283375_1283726_-	hypothetical protein	NA	A4JWM4	Burkholderia_virus	35.7	4.1e-07
WP_096149206.1|1283967_1284255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128299543.1|1284251_1284983_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	37.3	4.8e-10
WP_096149204.1|1285322_1286279_+	hypothetical protein	NA	J9RW58	Pseudomonas_phage	49.3	3.3e-59
1286418:1286438	attL	TATTTATCTCACGTCTAATCA	NA	NA	NA	NA
WP_157506960.1|1286477_1288694_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	39.0	2.8e-138
WP_022649006.1|1288690_1289320_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	55.9	7.9e-62
WP_022649005.1|1289312_1290092_+	dimethyl sulfoxide reductase subunit C	NA	NA	NA	NA	NA
WP_157506963.1|1290091_1290967_+	ferredoxin	NA	NA	NA	NA	NA
WP_003860625.1|1291091_1291523_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	7.4e-19
WP_003860623.1|1291670_1292837_+|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
WP_045621487.1|1293128_1294139_+	cytoskeleton protein RodZ	NA	NA	NA	NA	NA
WP_003860619.1|1294165_1295284_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_022649001.1|1295365_1296640_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_048966864.1|1296653_1297274_+	YfgM family protein	NA	NA	NA	NA	NA
WP_022648999.1|1297284_1298463_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_022648998.1|1298575_1300048_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_022651589.1|1300276_1301539_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	61.5	1.7e-148
WP_022651588.1|1301631_1302456_+	hypothetical protein	NA	A0A1W6JPD1	Morganella_phage	25.1	6.0e-09
WP_022651587.1|1302566_1302770_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_100167755.1|1302769_1303204_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	55.7	5.0e-31
WP_022651585.1|1303217_1303805_+	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	54.4	4.2e-49
WP_157508609.1|1303804_1304629_+	host cell division inhibitor Icd-like protein	NA	A0A1C9IHV9	Salmonella_phage	56.7	1.5e-20
WP_058648769.1|1304625_1304889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047724781.1|1304885_1305107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022651581.1|1305103_1305730_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	39.5	1.6e-25
WP_000628971.1|1305739_1306087_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	62.2	6.2e-32
WP_100167753.1|1306079_1308851_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.4	7.1e-296
WP_100167752.1|1309225_1309660_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_022651578.1|1309671_1309947_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_157506966.1|1310046_1310520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157506969.1|1310843_1311164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157506972.1|1311173_1314176_+|tail	tail protein (tape measure)	tail	B1GS57	Salmonella_phage	44.8	7.3e-129
WP_157506975.1|1314689_1315301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032645661.1|1315370_1315556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022651573.1|1315676_1316219_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_157506978.1|1316211_1316571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157506981.1|1317084_1318626_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.4	3.1e-160
WP_022648996.1|1318684_1318906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023300706.1|1318902_1319253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023306696.1|1319252_1320272_-	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_023300704.1|1320330_1321704_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	34.7	1.3e-40
WP_157506984.1|1321863_1323330_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.4	3.6e-89
WP_157506987.1|1323398_1324976_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_023300702.1|1325135_1325627_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_157506990.1|1325878_1326394_-	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_006811509.1|1326855_1327209_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_045285358.1|1328220_1328802_-	DNA-invertase Hin	NA	A0A0A7NPV4	Enterobacteria_phage	72.1	7.6e-67
WP_045285359.1|1329243_1329642_+|tail	tail fiber assembly protein	tail	S5FXM8	Shigella_phage	39.3	1.4e-08
WP_045285360.1|1329613_1330213_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	61.9	9.2e-68
WP_157506993.1|1330212_1331193_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	56.0	4.9e-66
WP_157506996.1|1331195_1331774_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	65.8	2.2e-66
WP_157507001.1|1331766_1332870_-|plate	baseplate protein	plate	A4JWL6	Burkholderia_virus	53.5	3.2e-106
WP_157507004.1|1332860_1333208_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	63.3	2.3e-34
WP_157507007.1|1333262_1333775_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	37.8	4.7e-20
WP_157507010.1|1333774_1334944_-	phage protein D	NA	Q6QIA2	Burkholderia_phage	48.9	1.3e-86
WP_011410692.1|1334931_1335147_-	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.6e-17
WP_157507013.1|1335143_1336028_-	hypothetical protein	NA	A4JWL1	Burkholderia_virus	45.4	1.5e-53
WP_157507016.1|1336027_1339402_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	38.2	3.9e-155
WP_001148841.1|1339494_1339632_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000084225.1|1339597_1339912_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_157507019.1|1340010_1340292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001062395.1|1340294_1340816_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	68.8	1.0e-67
WP_157507022.1|1340815_1342243_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	78.6	5.7e-217
WP_023229447.1|1342232_1342487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023304058.1|1342483_1342948_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	52.3	5.7e-41
WP_006687293.1|1342947_1343394_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	6.1e-32
WP_157507025.1|1343395_1343752_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_157507028.1|1343762_1344716_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.3	3.4e-64
WP_080781131.1|1344729_1345827_-	peptidase	NA	A4JWJ9	Burkholderia_virus	49.6	2.3e-96
WP_000135510.1|1346041_1346500_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	43.0	3.8e-29
WP_157507031.1|1346502_1347324_-|head	phage head morphogenesis protein	head	Q6QIB9	Burkholderia_phage	61.9	9.0e-98
WP_157507034.1|1347304_1348801_-	DUF935 family protein	NA	A4JWJ5	Burkholderia_virus	61.3	8.2e-174
WP_157507037.1|1348800_1350324_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.5	1.4e-184
WP_157507040.1|1350320_1350866_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	66.5	1.8e-57
WP_006122433.1|1350865_1351177_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	63.6	3.2e-32
WP_020803495.1|1351169_1351502_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	47.7	1.1e-17
WP_157507043.1|1351498_1352152_-	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	30.7	5.3e-08
WP_157507047.1|1352141_1352864_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.3	1.4e-62
WP_016191696.1|1352866_1353217_-	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.9	1.2e-22
WP_057057577.1|1353395_1353653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100246813.1|1353673_1354234_-	DUF2441 domain-containing protein	NA	NA	NA	NA	NA
WP_157507050.1|1354483_1355254_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	66.1	4.0e-100
WP_061496751.1|1355311_1355578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054181123.1|1355698_1356064_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_045285382.1|1356153_1356342_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	69.4	1.1e-16
WP_020803508.1|1356394_1356700_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	59.0	7.1e-24
WP_157507053.1|1356709_1357618_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	55.1	1.5e-74
WP_157507056.1|1357621_1359391_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	68.0	6.9e-228
WP_157507059.1|1359401_1360568_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	60.4	2.4e-120
WP_000835317.1|1360570_1360840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020803510.1|1360857_1361469_+	DUF3164 family protein	NA	A0A2D1GNM4	Pseudomonas_phage	68.5	7.2e-76
WP_045621879.1|1361547_1361736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032636367.1|1361732_1362029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032636366.1|1362015_1362495_+	hypothetical protein	NA	A0A076G611	Escherichia_phage	61.0	2.1e-06
WP_032636365.1|1362491_1362722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057517839.1|1362711_1362927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020803523.1|1363341_1363731_+	DNA-binding protein RdgB	NA	Q6QIE8	Burkholderia_phage	52.5	6.5e-30
1364199:1364219	attR	TATTTATCTCACGTCTAATCA	NA	NA	NA	NA
>prophage 2
NZ_CP033102	Enterobacter hormaechei strain L51 chromosome, complete genome	5018729	1734469	1743320	5018729		Enterobacteria_phage(28.57%)	7	NA	NA
WP_038416360.1|1734469_1735534_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	4.9e-104
WP_032609646.1|1735549_1736416_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	2.8e-110
WP_038416359.1|1736428_1737319_+	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	31.0	5.3e-27
WP_023295000.1|1737329_1737878_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.4	9.1e-54
WP_023294999.1|1738013_1739420_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	5.2e-37
WP_032609644.1|1739673_1740840_+	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	53.5	1.2e-111
WP_157507256.1|1742315_1743320_-	SDR family NAD(P)-dependent oxidoreductase	NA	A0A2K9L4U8	Tupanvirus	29.0	1.9e-33
>prophage 3
NZ_CP033102	Enterobacter hormaechei strain L51 chromosome, complete genome	5018729	1967761	2020682	5018729	integrase,lysis,head,holin,terminase	Enterobacteria_phage(27.69%)	82	1969946:1969975	2018741:2018770
WP_003859784.1|1967761_1967992_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	7.0e-16
WP_157508616.1|1968129_1968501_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_045623248.1|1968502_1969372_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_022648464.1|1969388_1969727_+	YebY family protein	NA	NA	NA	NA	NA
1969946:1969975	attL	ACAGGAATCGTATTCGGTCTCTTTTTATCT	NA	NA	NA	NA
WP_157507326.1|1970048_1971134_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	68.1	8.1e-147
WP_023300430.1|1971102_1971375_-	hypothetical protein	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	64.4	2.9e-29
WP_157507328.1|1971533_1971749_-	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	52.4	2.8e-19
WP_032103556.1|1971758_1971998_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	74.4	2.8e-28
WP_044158833.1|1971975_1972314_-	DUF2591 domain-containing protein	NA	R9VYJ6	Serratia_phage	42.5	1.1e-14
WP_157507330.1|1972313_1972532_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	62.5	2.1e-17
WP_006176201.1|1972623_1972854_-	hypothetical protein	NA	S4TRP7	Salmonella_phage	39.7	1.3e-06
WP_045617910.1|1972850_1973069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157507332.1|1973065_1974226_-	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	78.6	1.2e-177
WP_157507334.1|1974222_1974882_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	95.0	6.5e-123
WP_157507336.1|1974878_1975361_-	SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.6	2.7e-70
WP_154849184.1|1975357_1975510_-	DUF1317 family protein	NA	NA	NA	NA	NA
WP_157507338.1|1975506_1975935_-	regulator	NA	M9NYX4	Enterobacteria_phage	93.7	6.4e-71
WP_157507340.1|1975931_1976612_-	exonuclease	NA	M9NZE1	Enterobacteria_phage	93.8	7.1e-125
WP_157507342.1|1976608_1977526_-	recombinase RecT	NA	M9NZA6	Enterobacteria_phage	90.2	2.3e-158
WP_047400417.1|1977535_1977814_-	host nuclease inhibitor GamL	NA	M9NZI3	Enterobacteria_phage	79.6	4.8e-35
WP_006809788.1|1977886_1978096_-	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	95.7	6.7e-34
WP_063926180.1|1978247_1978757_-	hypothetical protein	NA	G8C7T4	Escherichia_phage	97.0	2.8e-89
WP_157508617.1|1978919_1979357_-	hypothetical protein	NA	K7P7N6	Enterobacteria_phage	97.9	1.4e-76
WP_147206630.1|1980076_1980274_+	hypothetical protein	NA	G8C7T7	Escherichia_phage	93.8	3.5e-24
WP_044704990.1|1980407_1980647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046695767.1|1980648_1981128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044704986.1|1981137_1981551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023303585.1|1981663_1982374_-	helix-turn-helix domain-containing protein	NA	K7P8B2	Enterobacteria_phage	70.2	3.2e-91
WP_032619413.1|1982477_1982666_+	hypothetical protein	NA	A0A2R2Z333	Escherichia_phage	51.8	1.5e-08
WP_047353022.1|1982751_1983294_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	91.7	7.3e-88
WP_157507344.1|1983516_1984413_+	DNA replication protein	NA	F1C5C3	Cronobacter_phage	59.8	9.8e-98
WP_157508618.1|1984402_1985836_+	AAA family ATPase	NA	Q716D2	Shigella_phage	86.0	6.6e-229
WP_048702388.1|1985835_1986180_+	helix-turn-helix transcriptional regulator	NA	G8C7U7	Escherichia_phage	94.7	5.1e-55
WP_157507346.1|1986586_1986850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157507348.1|1986846_1987299_+	hypothetical protein	NA	K7P6V8	Enterobacteria_phage	51.2	6.0e-11
WP_157507350.1|1987301_1987481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157507352.1|1987484_1987889_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_157507353.1|1987898_1988135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157507355.1|1988157_1988406_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	85.0	1.7e-31
WP_129256432.1|1988402_1989026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157507357.1|1989205_1989661_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.1	5.6e-33
WP_048249410.1|1989653_1989824_+	prophage protein NinE	NA	G8C7V4	Escherichia_phage	80.4	1.9e-18
WP_157507359.1|1989816_1990428_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	69.0	5.7e-41
WP_063452511.1|1990424_1990649_+	hypothetical protein	NA	Q5G8R9	Enterobacteria_phage	80.6	4.8e-30
WP_045332081.1|1990645_1990786_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.0	2.0e-05
WP_157507361.1|1990782_1991472_+	antiterminator	NA	I6PDF8	Cronobacter_phage	50.2	4.9e-57
WP_122008274.1|1991919_1992225_+|holin	holin	holin	E7C9S8	Salmonella_phage	86.1	1.1e-43
WP_157507363.1|1992211_1992652_+	glycoside hydrolase family protein	NA	A0A0M4R365	Salmonella_phage	76.5	1.8e-57
WP_157507365.1|1992648_1993119_+|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	70.6	2.9e-48
WP_111971799.1|1993275_1993794_+	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	99.4	9.4e-93
WP_157507367.1|1993891_1994098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157507369.1|1994101_1994740_+	hypothetical protein	NA	I6S676	Salmonella_phage	92.0	1.1e-114
WP_157507371.1|1994771_1995227_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	80.7	8.9e-63
WP_045343423.1|1995223_1996471_+|terminase	terminase	terminase	I6RSK1	Salmonella_phage	97.3	3.0e-214
WP_017383021.1|1996533_1996707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017383020.1|1996762_1997296_+	endonuclease	NA	A0A1B1PE63	Salmonella_phage	39.0	2.4e-19
WP_157507373.1|1997292_1998642_+	DUF1073 domain-containing protein	NA	A0A1V0E5Q5	Salmonella_phage	88.0	7.1e-233
WP_157507375.1|1998601_1999528_+|head	phage head morphogenesis protein	head	Q5G8Y3	Enterobacteria_phage	92.5	2.6e-162
WP_157507377.1|1999530_2000796_+	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	89.8	5.1e-217
WP_032669780.1|2000808_2001258_+	hypothetical protein	NA	A0A1V0E5Q8	Salmonella_phage	86.6	7.1e-65
WP_063160755.1|2001275_2002352_+	hypothetical protein	NA	Q5G8Y0	Enterobacteria_phage	91.9	4.1e-191
WP_023296439.1|2002361_2002655_+	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	91.8	1.7e-43
WP_157507379.1|2002717_2003119_+	hypothetical protein	NA	G0ZNE1	Cronobacter_phage	78.2	4.6e-55
WP_157507380.1|2003118_2003292_+	50S ribosomal protein L13	NA	I6R0P9	Salmonella_phage	48.1	1.6e-09
WP_157507382.1|2003291_2003642_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	66.1	4.4e-38
WP_032667504.1|2003644_2004013_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	77.0	2.1e-46
WP_157507383.1|2004009_2004393_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	59.8	3.2e-37
WP_032667502.1|2004457_2005237_+	hypothetical protein	NA	F1C5E5	Cronobacter_phage	63.0	1.8e-55
WP_047359626.1|2005297_2005969_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	46.4	1.4e-48
WP_157507385.1|2006010_2008341_+	tape measure protein	NA	A0A1B1W284	Salmonella_phage	49.6	6.2e-144
WP_013095994.1|2008340_2008838_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	90.9	6.0e-89
WP_157507387.1|2008837_2009308_+	hypothetical protein	NA	F1C5F1	Cronobacter_phage	91.0	7.7e-78
WP_063843752.1|2009317_2009710_+	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	89.5	1.6e-65
WP_157507389.1|2009696_2012174_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	92.0	0.0e+00
WP_157507391.1|2012232_2014257_+	hypothetical protein	NA	F1C5A8	Cronobacter_phage	62.1	3.3e-40
WP_032104988.1|2014286_2015768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032673203.1|2015764_2016706_-	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	91.4	8.6e-161
WP_006808936.1|2016702_2017065_-	GtrA family protein	NA	U5P0S6	Shigella_phage	83.3	2.6e-49
WP_038416169.1|2017416_2017734_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.0	2.4e-22
WP_102750896.1|2017743_2018415_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.0	4.8e-81
WP_045623245.1|2018889_2019870_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
2018741:2018770	attR	ACAGGAATCGTATTCGGTCTCTTTTTATCT	NA	NA	NA	NA
WP_157507393.1|2020037_2020682_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.3	9.6e-55
>prophage 4
NZ_CP033102	Enterobacter hormaechei strain L51 chromosome, complete genome	5018729	2479465	2526898	5018729	transposase	uncultured_Caudovirales_phage(28.57%)	47	NA	NA
WP_001567368.1|2479465_2480869_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|2480897_2481530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012695466.1|2481649_2482573_+|transposase	IS5-like element IS903B family transposase	transposase	Q1MVF0	Enterobacteria_phage	98.7	4.6e-175
WP_000125668.1|2482792_2484196_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000130816.1|2484228_2484933_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.9	8.8e-86
WP_000941305.1|2485019_2485340_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	53.7	1.7e-20
WP_000922628.1|2485385_2486675_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	9.9e-168
WP_000065802.1|2486687_2487113_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
WP_001066652.1|2487172_2488000_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	37.2	4.9e-43
WP_000927306.1|2488018_2489497_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.4	7.3e-199
WP_000864986.1|2489988_2490264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371914.1|2490404_2490602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000637193.1|2491588_2491846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001005009.1|2491919_2492234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000975181.1|2492281_2493178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000464825.1|2493180_2493696_-	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000833380.1|2493910_2495338_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_000078513.1|2495588_2496908_+	DUF1173 family protein	NA	NA	NA	NA	NA
WP_000121164.1|2496920_2497124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001371952.1|2497187_2498393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193207.1|2498389_2499208_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000019951.1|2499673_2499946_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001572377.1|2500068_2501184_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000723070.1|2501441_2501876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004248839.1|2502093_2503440_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	8.8e-18
WP_001572374.1|2503523_2504447_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	2.4e-176
WP_001572373.1|2504635_2506255_+	phosphoethanolamine--lipid A transferase MCR-9.1	NA	NA	NA	NA	NA
WP_001572372.1|2506331_2506808_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_001067855.1|2506973_2507678_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_016338364.1|2507945_2508227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013279384.1|2508235_2508973_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_071562618.1|2509036_2509387_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_012561155.1|2509402_2509747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016338363.1|2509743_2510058_+	KikA	NA	NA	NA	NA	NA
WP_013279382.1|2510093_2510405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012561158.1|2510460_2511102_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_001749967.1|2511106_2511313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001288432.1|2511694_2513128_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_004098817.1|2513161_2514376_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_000480968.1|2515084_2515921_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|2515920_2516724_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_085959879.1|2516830_2517960_-|transposase	IS3-like element IS1133 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.1	1.6e-52
WP_000904906.1|2518024_2518639_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.3e-37
WP_001138082.1|2518764_2521650_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.9	1.1e-190
WP_000027057.1|2522125_2522986_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|2523168_2523726_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001556712.1|2523889_2526898_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.5	0.0e+00
>prophage 5
NZ_CP033102	Enterobacter hormaechei strain L51 chromosome, complete genome	5018729	2560107	2568417	5018729	tail	Burkholderia_virus(50.0%)	9	NA	NA
WP_128299543.1|2560107_2560839_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	37.3	4.8e-10
WP_096149206.1|2560835_2561123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096149207.1|2561364_2561715_+	hypothetical protein	NA	A4JWM4	Burkholderia_virus	35.7	4.1e-07
WP_096149208.1|2561762_2562377_+	hypothetical protein	NA	Q6QIB7	Burkholderia_phage	43.0	3.4e-25
WP_016242197.1|2562378_2562972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157506957.1|2563003_2566216_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	36.5	1.5e-55
WP_157507605.1|2566262_2566859_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_023300094.1|2566911_2567610_-	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	6.8e-14
WP_015570541.1|2567619_2568417_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A2R8FG22	Brazilian_cedratvirus	26.8	1.2e-11
>prophage 6
NZ_CP033102	Enterobacter hormaechei strain L51 chromosome, complete genome	5018729	2703816	2715180	5018729		Morganella_phage(33.33%)	12	NA	NA
WP_032622206.1|2703816_2705085_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	90.8	2.1e-226
WP_022647996.1|2705086_2705506_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	56.7	7.2e-35
WP_006808847.1|2705832_2706072_+	DinI family protein	NA	K7PKM2	Enterobacterial_phage	91.1	1.5e-32
WP_157507684.1|2706335_2707025_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.0	9.9e-82
WP_022647994.1|2707392_2707611_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	62.7	8.3e-19
WP_071881491.1|2708173_2708401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157507686.1|2709013_2711047_-	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	22.4	2.2e-20
WP_022647991.1|2711190_2711937_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_003857403.1|2712027_2712714_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023300013.1|2712749_2713181_-	hypothetical protein	NA	A0A1W6JNV4	Morganella_phage	35.2	1.5e-16
WP_003857405.1|2713468_2713672_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	56.7	4.4e-14
WP_157507688.1|2713716_2715180_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.3	6.4e-46
>prophage 7
NZ_CP033102	Enterobacter hormaechei strain L51 chromosome, complete genome	5018729	2791976	2842044	5018729	terminase,head,lysis,tail	Salmonella_phage(35.94%)	79	NA	NA
WP_045911179.1|2791976_2792294_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	48.0	8.4e-20
WP_157507734.1|2792632_2792875_+	DinI-like family protein	NA	Q6UAW0	Klebsiella_phage	77.9	6.4e-28
WP_157507736.1|2793011_2794148_-	hypothetical protein	NA	A0A2I6PID3	Escherichia_phage	37.9	6.1e-52
WP_157507739.1|2794209_2795175_-	hypothetical protein	NA	G1CSU0	Cronobacter_virus	40.5	1.1e-59
WP_157507741.1|2795176_2798962_-	DUF1983 domain-containing protein	NA	I6R9B3	Salmonella_phage	61.4	0.0e+00
WP_023296453.1|2798971_2799505_-|tail	tail assembly protein	tail	H6WRW3	Salmonella_phage	67.0	4.0e-54
WP_032668142.1|2799447_2800167_-	C40 family peptidase	NA	A0A1V0E5M9	Salmonella_phage	82.3	3.3e-120
WP_023303627.1|2800166_2800871_-|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	98.7	9.3e-136
WP_022651024.1|2801036_2801234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022651023.1|2801212_2801368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054829853.1|2801389_2801737_-|tail	phage tail protein	tail	H6WRV8	Salmonella_phage	93.9	1.3e-58
WP_058648091.1|2801820_2802060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157507743.1|2802083_2804396_-	hypothetical protein	NA	F1C5E9	Cronobacter_phage	40.8	3.4e-118
WP_023303623.1|2804453_2804924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023303622.1|2804920_2805250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032676270.1|2805392_2806166_-	ORF6N domain-containing protein	NA	H6WRU9	Salmonella_phage	62.7	9.1e-76
WP_023303620.1|2806250_2806892_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	84.0	4.9e-99
WP_002462729.1|2806965_2807133_-	hypothetical protein	NA	G9L6D7	Escherichia_phage	70.9	1.1e-15
WP_023303619.1|2807259_2807703_+	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	61.1	1.0e-31
WP_063154607.1|2807712_2808366_-	hypothetical protein	NA	I6R0Q2	Salmonella_phage	90.3	2.3e-112
WP_063154609.1|2808406_2809141_-	hypothetical protein	NA	A0A1V0E5P2	Salmonella_phage	86.4	2.5e-115
WP_045339753.1|2809156_2809543_-	hypothetical protein	NA	Q5G8X4	Enterobacteria_phage	92.2	8.9e-64
WP_049132822.1|2809539_2809938_-	hypothetical protein	NA	Q5G8X5	Enterobacteria_phage	92.4	1.2e-63
WP_049132823.1|2809945_2810308_-	hypothetical protein	NA	A0A1V0E5P3	Salmonella_phage	90.0	5.6e-60
WP_049132825.1|2810300_2810480_-	DUF551 domain-containing protein	NA	Q5G8X7	Enterobacteria_phage	89.8	2.6e-26
WP_049132827.1|2810479_2810881_-	hypothetical protein	NA	I6S619	Salmonella_phage	79.7	1.5e-58
WP_157507745.1|2810943_2811237_-	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	88.7	7.2e-42
WP_063160755.1|2811246_2812323_-	hypothetical protein	NA	Q5G8Y0	Enterobacteria_phage	91.9	4.1e-191
WP_032669780.1|2812340_2812790_-	hypothetical protein	NA	A0A1V0E5Q8	Salmonella_phage	86.6	7.1e-65
WP_063160754.1|2812802_2814065_-	hypothetical protein	NA	H6WRT2	Salmonella_phage	92.6	3.6e-223
WP_063135925.1|2814068_2814998_-|head	phage head morphogenesis protein	head	H6WRT1	Salmonella_phage	81.8	4.2e-136
WP_157507747.1|2814951_2816304_-	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	78.0	3.9e-207
WP_150319032.1|2816318_2817566_-|terminase	PBSX family phage terminase large subunit	terminase	I6RSK1	Salmonella_phage	98.6	5.9e-218
WP_157507749.1|2817562_2818018_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	81.3	3.0e-63
WP_048248430.1|2818049_2818688_-	hypothetical protein	NA	I6S676	Salmonella_phage	92.5	2.8e-115
WP_023303625.1|2819049_2819211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006811069.1|2819348_2820035_-	Rha family transcriptional regulator	NA	I6R9D7	Salmonella_phage	99.1	8.0e-124
WP_100167724.1|2820239_2820704_-|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	65.6	2.6e-46
WP_154816351.1|2820700_2820874_-	hypothetical protein	NA	A0A289ZTW9	Serratia_phage	66.7	8.6e-11
WP_100167723.1|2820999_2821494_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	97.6	9.2e-90
WP_100167722.1|2821471_2821696_-|lysis	lysis protein	lysis	M9NZI9	Enterobacteria_phage	90.5	2.0e-31
WP_063857929.1|2821986_2822487_-	antiterminator	NA	G8C7V7	Escherichia_phage	97.0	1.1e-90
WP_094166857.1|2822486_2822603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129008868.1|2822599_2823244_-	hypothetical protein	NA	S4TSR3	Salmonella_phage	69.2	2.7e-73
WP_157507751.1|2823237_2823738_-	HNH endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	52.0	2.0e-36
WP_157507753.1|2823701_2823872_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	88.7	1.9e-18
WP_157507755.1|2823871_2824327_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.2	1.2e-59
WP_059291148.1|2824510_2824792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059291161.1|2824834_2825032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157507757.1|2825141_2825903_-	hypothetical protein	NA	Q8HAA7	Salmonella_phage	40.9	1.3e-29
WP_157507759.1|2825899_2826508_-	hypothetical protein	NA	Q5G8U8	Enterobacteria_phage	48.5	1.8e-10
WP_157507761.1|2826504_2826708_-	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
WP_157507763.1|2826704_2827001_-	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	64.1	1.9e-29
WP_150189072.1|2826997_2827312_-	protein ren	NA	M1FPD5	Enterobacteria_phage	51.6	1.9e-16
WP_157507765.1|2827301_2828675_-	AAA family ATPase	NA	E5AGF0	Erwinia_phage	64.0	8.9e-167
WP_157507767.1|2828671_2829757_-	DNA replication protein	NA	E5AGE9	Erwinia_phage	45.6	1.4e-85
WP_001514165.1|2829999_2830566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016042179.1|2830595_2830823_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	100.0	4.1e-37
WP_016042178.1|2830933_2831623_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	100.0	2.2e-126
WP_044704986.1|2831785_2832199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046695767.1|2832208_2832688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044704990.1|2832689_2832929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147206630.1|2833062_2833260_-	hypothetical protein	NA	G8C7T7	Escherichia_phage	93.8	3.5e-24
WP_157508617.1|2833979_2834417_+	hypothetical protein	NA	K7P7N6	Enterobacteria_phage	97.9	1.4e-76
WP_063926180.1|2834579_2835089_+	hypothetical protein	NA	G8C7T4	Escherichia_phage	97.0	2.8e-89
WP_006809788.1|2835240_2835450_+	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	95.7	6.7e-34
WP_047400417.1|2835522_2835801_+	host nuclease inhibitor GamL	NA	M9NZI3	Enterobacteria_phage	79.6	4.8e-35
WP_157507342.1|2835810_2836728_+	recombinase RecT	NA	M9NZA6	Enterobacteria_phage	90.2	2.3e-158
WP_157507769.1|2836724_2837405_+	exonuclease	NA	M9NZE1	Enterobacteria_phage	95.1	7.6e-127
WP_094948504.1|2837401_2837830_+	regulator	NA	M9NYX4	Enterobacteria_phage	93.7	1.7e-71
WP_157507771.1|2837990_2838542_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	58.9	9.7e-56
WP_023313983.1|2838538_2838757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157507773.1|2838753_2839095_+	DUF551 domain-containing protein	NA	U5P092	Shigella_phage	50.6	7.2e-17
WP_157507774.1|2839186_2839405_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	63.9	1.1e-18
WP_157507776.1|2839404_2839788_+	DUF2591 domain-containing protein	NA	A0A2D1GLI3	Escherichia_phage	43.3	2.7e-12
WP_157507778.1|2839750_2839990_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	50.0	1.8e-11
WP_060614548.1|2839999_2840374_+	hypothetical protein	NA	A0A2I6PID6	Escherichia_phage	58.8	1.6e-33
WP_022650951.1|2840482_2840731_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	8.3e-15
WP_022650950.1|2840763_2842044_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	50.9	1.1e-123
>prophage 8
NZ_CP033102	Enterobacter hormaechei strain L51 chromosome, complete genome	5018729	3029093	3067184	5018729	portal,integrase,tRNA,plate,tail,capsid,holin,terminase	Enterobacteria_phage(47.22%)	46	3034454:3034471	3069731:3069748
WP_063958592.1|3029093_3029477_-	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	58.3	1.7e-38
WP_064767481.1|3029602_3029851_-	hypothetical protein	NA	Q858U4	Yersinia_virus	50.0	4.0e-09
WP_063958593.1|3029890_3031027_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	75.2	1.4e-160
WP_063958594.1|3031179_3032361_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	76.5	2.2e-174
WP_063958595.1|3032361_3032877_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	65.3	1.8e-59
WP_063958596.1|3032925_3033243_+|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	55.1	9.9e-21
WP_032424037.1|3033248_3033404_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	2.7e-11
WP_157507885.1|3033390_3036372_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	48.3	6.3e-226
3034454:3034471	attL	TGCGCGGGAGTATCGCCG	NA	NA	NA	NA
WP_063958597.1|3036385_3036874_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	74.1	3.2e-66
WP_148735455.1|3037027_3037432_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	47.8	2.9e-25
WP_157507887.1|3037443_3039627_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	81.0	5.7e-91
WP_063147929.1|3039638_3040166_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	73.9	6.4e-73
WP_063147930.1|3040158_3041055_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	66.8	2.0e-103
WP_063153988.1|3041041_3041410_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	64.3	1.3e-35
WP_063153987.1|3041406_3041988_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	68.4	4.1e-73
WP_063153985.1|3041984_3042623_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	53.6	2.7e-57
WP_063958600.1|3042615_3043086_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	67.5	2.9e-61
WP_063958601.1|3043090_3043627_-	DUF2514 domain-containing protein	NA	A0A0M4S5V1	Salmonella_phage	80.4	2.1e-26
WP_063958602.1|3043623_3044064_-	lysozyme	NA	A0A0M5M782	Salmonella_phage	84.2	1.4e-65
WP_063147938.1|3044050_3044383_-|holin	phage holin, lambda family	holin	A0A0M3ULH4	Salmonella_phage	90.9	5.9e-48
WP_063958603.1|3044392_3044593_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	76.9	4.3e-22
WP_157507889.1|3044592_3045117_-|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	53.5	4.8e-44
WP_157507891.1|3045215_3046073_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	59.9	2.4e-69
WP_157507894.1|3046118_3047168_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	52.2	7.4e-105
WP_148735444.1|3047191_3048028_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	68.3	8.0e-102
WP_157507896.1|3048187_3049918_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	75.8	1.6e-266
WP_157507898.1|3049917_3050976_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	70.8	1.8e-143
WP_157507900.1|3051433_3051793_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_157507902.1|3051789_3052065_-	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_157507904.1|3052134_3052374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157507906.1|3052366_3053071_-	DNA adenine methylase	NA	A0A0M4S5U3	Salmonella_phage	73.8	6.7e-94
WP_157508625.1|3053270_3055670_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	62.1	4.4e-262
WP_157507908.1|3055779_3056181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157507910.1|3056300_3057215_-	DNA cytosine methyltransferase	NA	A0A0M3ULA1	Salmonella_phage	53.5	3.2e-96
WP_157508626.1|3058119_3058695_-	3'-5' exonuclease	NA	A0A218M4G8	Erwinia_phage	59.0	1.5e-59
WP_157507912.1|3058825_3059047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063958614.1|3059115_3059388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063958615.1|3059408_3059636_-	hypothetical protein	NA	A0A0M4S6M9	Salmonella_phage	69.3	7.3e-26
WP_063958616.1|3059811_3060072_-	DUF4761 family protein	NA	A0A0M5M1I3	Salmonella_phage	50.8	8.4e-10
WP_063958617.1|3060118_3060463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063958618.1|3060550_3060853_+	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	58.6	1.3e-25
WP_157507914.1|3060935_3061913_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	45.8	3.1e-81
WP_023299885.1|3062097_3062844_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_006809140.1|3063276_3065211_+	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_032676323.1|3065300_3066584_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	28.3	1.1e-09
WP_023299826.1|3066683_3067184_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
3069731:3069748	attR	TGCGCGGGAGTATCGCCG	NA	NA	NA	NA
>prophage 9
NZ_CP033102	Enterobacter hormaechei strain L51 chromosome, complete genome	5018729	3075778	3128066	5018729	portal,integrase,head,tRNA,protease,capsid,tail,holin,terminase	Enterobacterial_phage(26.92%)	70	3069132:3069146	3126147:3126161
3069132:3069146	attL	ACGCTGCGCAACGGC	NA	NA	NA	NA
WP_045621398.1|3075778_3076807_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	32.6	3.8e-13
WP_015570793.1|3076852_3076951_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_071785224.1|3076951_3077026_+	protein YoaJ	NA	NA	NA	NA	NA
WP_022647775.1|3077079_3077328_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_071524166.1|3077698_3077791_+	stress response membrane protein YncL	NA	NA	NA	NA	NA
WP_105322651.1|3077914_3079414_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_022647773.1|3079418_3079664_-	YmjA family protein	NA	NA	NA	NA	NA
WP_023337139.1|3079740_3079905_-	isocitrate dehydrogenase (NADP(+))	NA	Q77Z09	Phage_21	94.4	7.9e-22
WP_127348507.1|3080038_3080335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058658043.1|3080482_3080803_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	98.1	7.4e-56
WP_058658041.1|3081128_3081392_+	DinI family protein	NA	K7PKM2	Enterobacterial_phage	92.0	1.7e-37
WP_072202928.1|3081433_3081634_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	79.4	3.1e-20
WP_072202972.1|3081843_3082197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157507919.1|3082450_3083587_-	hypothetical protein	NA	A0A2I6PID3	Escherichia_phage	36.9	5.7e-50
WP_157507739.1|3083648_3084614_-	hypothetical protein	NA	G1CSU0	Cronobacter_virus	40.5	1.1e-59
WP_157507921.1|3084615_3088443_-	DUF1983 domain-containing protein	NA	Q9MCR7	Enterobacteria_phage	82.7	0.0e+00
WP_045895700.1|3088496_3089102_-|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	96.0	7.1e-100
WP_157507923.1|3089145_3089487_-	hypothetical protein	NA	K7PLP0	Enterobacteria_phage	88.5	6.9e-52
WP_063863768.1|3089516_3090227_-	peptidase P60	NA	K7PGV2	Enterobacterial_phage	97.9	2.2e-145
WP_057102415.1|3090228_3090987_-|tail	phage minor tail protein L	tail	G8C7J7	Escherichia_phage	95.2	1.4e-142
WP_048243857.1|3090983_3091322_-|tail	phage tail protein	tail	K7PHL4	Enterobacterial_phage	98.2	1.9e-62
WP_157507925.1|3091324_3094828_-|tail	phage tail tape measure protein	tail	K7P7L6	Enterobacteria_phage	68.1	0.0e+00
WP_022648884.1|3094874_3095210_-	hypothetical protein	NA	S4TR42	Salmonella_phage	92.8	3.4e-51
WP_032619858.1|3095265_3095544_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	95.7	1.8e-42
WP_001549114.1|3095552_3095936_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	93.7	4.4e-63
WP_045350809.1|3095944_3096388_-	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	93.8	3.5e-72
WP_157507927.1|3096447_3096795_-	DUF3168 domain-containing protein	NA	K7PM93	Enterobacterial_phage	94.8	2.7e-56
WP_006809157.1|3096791_3097241_-	HK97 gp10 family phage protein	NA	K7P6X4	Enterobacteria_phage	100.0	2.0e-75
WP_157507929.1|3097237_3097576_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	71.4	1.1e-38
WP_023330767.1|3097585_3097912_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	84.3	8.9e-49
WP_023296252.1|3097954_3099166_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	87.9	9.5e-197
WP_047717738.1|3099175_3100024_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	92.1	2.4e-138
WP_157507931.1|3100037_3101342_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	93.8	2.8e-234
WP_157507933.1|3101341_3103078_-|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	99.0	0.0e+00
WP_047731779.1|3103077_3103551_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	98.1	3.8e-85
WP_157507936.1|3103708_3104059_-	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	81.0	7.8e-51
WP_157507938.1|3104058_3104637_-	hypothetical protein	NA	S4TR53	Salmonella_phage	71.1	1.8e-76
WP_152908911.1|3104630_3105380_-	hypothetical protein	NA	A0A1W6DXY0	Salmonella_phage	37.0	1.9e-14
WP_032665926.1|3106765_3106999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100167799.1|3107001_3107808_-	DUF1983 domain-containing protein	NA	S4TNN5	Salmonella_phage	54.2	5.2e-58
WP_154819351.1|3107820_3107994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023303626.1|3108254_3108719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023303625.1|3108701_3108863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039270116.1|3109304_3109856_+|protease	Clp protease	protease	NA	NA	NA	NA
WP_039272084.1|3110069_3110345_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	66.7	1.9e-23
WP_039270113.1|3110352_3110982_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	95.2	1.9e-111
WP_023306758.1|3110981_3111260_-|holin	phage holin family protein	holin	G8C7V9	Escherichia_phage	87.4	9.6e-36
WP_023306759.1|3111249_3111639_-	phage membrane protein	NA	G8C7V8	Escherichia_phage	94.5	2.3e-59
WP_157507940.1|3111794_3112373_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	52.2	1.6e-45
WP_157507942.1|3112386_3113376_-	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	92.7	5.8e-184
WP_157507944.1|3113383_3114187_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	72.8	6.3e-104
WP_157507946.1|3114257_3114665_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	83.5	2.1e-55
WP_157507948.1|3114924_3115368_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	37.7	1.1e-20
WP_157507951.1|3115364_3116333_-	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	75.4	5.2e-129
WP_157507953.1|3116316_3116502_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	65.4	1.7e-12
WP_023293903.1|3116742_3117213_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	98.1	1.2e-78
WP_016530206.1|3117238_3117436_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	66.1	2.7e-16
WP_157508627.1|3117540_3118188_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	63.0	4.9e-75
WP_045336988.1|3119804_3120635_+	hypothetical protein	NA	K7PKM7	Enterobacterial_phage	89.5	5.5e-127
WP_045337024.1|3120661_3120934_+	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	63.1	1.1e-23
WP_157507955.1|3121358_3121571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157507958.1|3121567_3122278_+	DUF551 domain-containing protein	NA	K7P7E3	Enterobacteria_phage	35.2	4.4e-24
WP_157508628.1|3122277_3122562_+	DUF4752 family protein	NA	K7PHN1	Enterobacterial_phage	44.9	2.0e-20
WP_157507960.1|3122628_3122898_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	95.5	2.4e-44
WP_047174693.1|3122928_3123165_+	excisionase	NA	NA	NA	NA	NA
WP_157507963.1|3123154_3124288_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	77.1	5.8e-164
WP_003857898.1|3124409_3125660_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	7.9e-21
WP_063137559.1|3125777_3126440_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
3126147:3126161	attR	ACGCTGCGCAACGGC	NA	NA	NA	NA
WP_063137560.1|3126439_3126913_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_032103856.1|3126953_3128066_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP033102	Enterobacter hormaechei strain L51 chromosome, complete genome	5018729	3991843	4000267	5018729	holin,terminase	Salmonella_phage(25.0%)	9	NA	NA
WP_157508344.1|3991843_3992206_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	48.7	1.0e-16
WP_157508346.1|3992202_3992742_-	glycoside hydrolase family protein	NA	H6WRZ4	Salmonella_phage	85.4	6.5e-89
WP_038415426.1|3992728_3992953_-|holin	holin	holin	A5LH82	Enterobacteria_phage	71.0	2.8e-22
WP_038415424.1|3993102_3993465_+	GtrA family protein	NA	B9UDL8	Salmonella_phage	75.8	3.5e-46
WP_038415422.1|3993461_3994385_+	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	92.8	5.8e-162
WP_063844676.1|3994377_3995850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157508348.1|3995892_3998298_-	hypothetical protein	NA	A0A0F6TJC8	Escherichia_coli_O157_typing_phage	42.6	5.0e-56
WP_157508350.1|3998318_3999929_-|terminase	phage terminase large subunit	terminase	A0A2H4JCA3	uncultured_Caudovirales_phage	69.9	2.7e-223
WP_038415416.1|3999925_4000267_-	hypothetical protein	NA	A0A2H4J7H0	uncultured_Caudovirales_phage	51.8	3.7e-21
>prophage 11
NZ_CP033102	Enterobacter hormaechei strain L51 chromosome, complete genome	5018729	4073996	4150401	5018729	portal,head,tRNA,protease,tail,capsid,terminase	uncultured_Caudovirales_phage(53.85%)	74	NA	NA
WP_157508387.1|4073996_4075349_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_023299368.1|4075360_4076218_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003856176.1|4076230_4076989_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	43.0	1.4e-25
WP_023299367.1|4077174_4078374_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_003856180.1|4078466_4079024_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_008501910.1|4079191_4079917_-	UMP kinase	NA	NA	NA	NA	NA
WP_015572722.1|4080066_4080918_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_022647105.1|4081035_4081761_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_022647104.1|4082082_4082877_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_032625600.1|4082939_4085615_+	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_003856214.1|4085647_4086472_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_022647102.1|4086583_4086973_+	DUF3461 family protein	NA	NA	NA	NA	NA
WP_003856217.1|4087062_4088220_-	CdaR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022647101.1|4088366_4089800_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.2	2.5e-26
WP_023299363.1|4089932_4091447_-	dGTPase	NA	NA	NA	NA	NA
WP_003856223.1|4091529_4092228_+	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_022647099.1|4092220_4093030_+	vitamin B12 ABC transporter substrate-binding protein BtuF	NA	NA	NA	NA	NA
WP_003856227.1|4093053_4093677_+	TRIC cation channel family protein	NA	NA	NA	NA	NA
WP_003856230.1|4093734_4094079_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
WP_022647097.1|4094164_4095565_-	H(+)/Cl(-) exchange transporter ClcA	NA	NA	NA	NA	NA
WP_157508389.1|4095742_4097023_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_157508392.1|4097553_4099536_-	Fe(3+)-hydroxamate ABC transporter permease FhuB	NA	NA	NA	NA	NA
WP_023299359.1|4099532_4100423_-	Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD	NA	NA	NA	NA	NA
WP_157508394.1|4100422_4101220_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	2.7e-14
WP_157508396.1|4101270_4103481_-	ferrichrome porin FhuA	NA	NA	NA	NA	NA
WP_063146440.1|4103718_4106241_-	bifunctional glycosyl transferase/transpeptidase	NA	NA	NA	NA	NA
WP_157508398.1|4106438_4108868_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.6	9.0e-37
WP_003856249.1|4108941_4109496_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_032625548.1|4109485_4110190_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155232.1|4110366_4110822_+	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
WP_022647088.1|4110881_4111772_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_086527962.1|4111787_4113212_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.5	1.6e-25
WP_032625542.1|4113208_4113688_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_022647086.1|4113811_4114603_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_022647085.1|4114614_4115466_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_022647084.1|4115497_4115878_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_023299349.1|4116202_4116814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063853352.1|4116899_4117643_+	fimbrial chaperone	NA	NA	NA	NA	NA
WP_023299348.1|4117724_4120319_+	outer membrane usher protein	NA	NA	NA	NA	NA
WP_157508640.1|4120357_4120927_+	fimbrial protein	NA	NA	NA	NA	NA
WP_023299346.1|4120953_4121517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038415358.1|4121531_4122134_+	fimbrial protein	NA	NA	NA	NA	NA
WP_050581694.1|4122154_4123240_+	fimbrial protein	NA	NA	NA	NA	NA
WP_032670914.1|4123243_4124491_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_063148780.1|4124554_4124995_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_063148779.1|4125168_4126539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022647074.1|4126580_4127351_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_157508400.1|4127347_4128274_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.3	5.3e-22
WP_003856301.1|4128381_4129044_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_157508403.1|4129108_4129645_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	32.5	8.7e-17
WP_045341223.1|4130053_4130392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045341216.1|4130400_4131003_-|tail	tail assembly protein	tail	K7PH91	Enterobacterial_phage	67.9	1.8e-63
WP_157508406.1|4131016_4132678_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.4	0.0e+00
WP_000113647.1|4132661_4133018_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_157508408.1|4133293_4133737_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	89.1	2.3e-76
WP_001549740.1|4133736_4134030_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	81.4	9.4e-42
WP_023304516.1|4134022_4134361_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	48.6	5.1e-23
WP_134214851.1|4134357_4135593_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	97.8	1.9e-237
WP_000848270.1|4135594_4136155_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	98.4	7.7e-101
WP_157508411.1|4136206_4137373_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	99.2	3.4e-215
WP_039671529.1|4137661_4138132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023309421.1|4138179_4138515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157508413.1|4138857_4140993_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	56.0	3.4e-205
WP_157508415.1|4140992_4141358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157508417.1|4141354_4141723_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	96.7	1.9e-60
WP_157508419.1|4141719_4141947_-	aminotransferase	NA	A0A2H4JBA1	uncultured_Caudovirales_phage	89.2	1.6e-28
WP_157508421.1|4141939_4142125_-	hypothetical protein	NA	A0A2H4JFH8	uncultured_Caudovirales_phage	86.9	2.9e-20
WP_157508423.1|4142117_4142843_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGN8	uncultured_Caudovirales_phage	28.9	1.0e-12
WP_063930682.1|4142832_4143423_-	hypothetical protein	NA	A0A1X9SFL9	Acinetobacter_phage	45.7	3.5e-19
WP_063923649.1|4143443_4143728_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_125125320.1|4143822_4144641_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	28.6	6.1e-22
WP_157508424.1|4144733_4145960_-	DUF4102 domain-containing protein	NA	A0A2H4JB45	uncultured_Caudovirales_phage	58.8	1.9e-136
WP_023299340.1|4146364_4148755_+	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_038415353.1|4148841_4150401_-	multicopper oxidase CueO	NA	L8AYM3	Mamastrovirus	55.6	1.0e-17
>prophage 1
NZ_CP033103	Enterobacter hormaechei strain L51 plasmid pEHZJ1, complete sequence	343918	59136	95015	343918	integrase,protease,transposase	Escherichia_phage(37.5%)	37	57439:57452	75351:75364
57439:57452	attL	AAAAAGTTACTTTT	NA	NA	NA	NA
WP_000795949.1|59136_60312_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001285422.1|60481_60694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001232447.1|61054_62137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284318.1|62302_63802_-	kinase	NA	NA	NA	NA	NA
WP_000081059.1|63827_65465_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001253656.1|65464_66505_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001253658.1|66589_67228_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116681.1|67227_67869_-	tellurium resistance protein TerX	NA	NA	NA	NA	NA
WP_001253657.1|67891_68530_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|68992_69460_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_011152964.1|69477_70686_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_011152965.1|70696_71653_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_001585166.1|71652_72732_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
WP_001040058.1|72733_73507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001280115.1|73499_74642_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	34.5	6.5e-30
WP_012695441.1|74651_75710_-	hypothetical protein	NA	NA	NA	NA	NA
75351:75364	attR	AAAAGTAACTTTTT	NA	NA	NA	NA
WP_000254137.1|76030_76612_+	tellurium resistance-associated protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054786.1|76611_77769_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007449.1|77791_78247_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|78269_79310_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116680.1|79358_79937_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000301247.1|80005_80581_+	tellurium resistance protein TerE	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053340.1|81009_82251_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_000374058.1|82341_82797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000398479.1|83037_83229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151572.1|83320_83662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000880375.1|84648_84903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|85562_86567_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000184001.1|86794_88000_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|88010_88316_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|88542_89307_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|89799_90384_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|90383_91622_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|91618_92524_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|92645_93350_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063945302.1|93340_93700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000462754.1|94358_95015_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP033103	Enterobacter hormaechei strain L51 plasmid pEHZJ1, complete sequence	343918	101298	149823	343918	transposase,integrase	Enterobacteria_phage(27.27%)	48	122422:122460	143877:143915
WP_157506525.1|101298_102222_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.5	3.5e-167
WP_000405672.1|102788_103223_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001287661.1|103308_105714_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	46.1	1.0e-141
WP_000118563.1|105710_106787_+	signal peptidase II	NA	NA	NA	NA	NA
WP_000993245.1|106795_107008_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001446012.1|106970_107090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087807.1|107073_107310_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277466.1|107306_107672_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000209296.1|107689_109375_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_000522996.1|109413_109839_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|109866_110142_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294656.1|110157_110523_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|110594_111050_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000278471.1|111727_112153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001224686.1|112701_113010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000784387.1|113025_113883_+	HNH endonuclease	NA	G0X580	Salmonella_phage	34.2	3.9e-11
WP_001287391.1|114489_114894_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001100635.1|115071_115365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000175475.1|115390_115627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000916941.1|115667_116123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000490638.1|116182_116848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371925.1|116905_117286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000027057.1|117615_118476_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|118658_119216_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001556712.1|119379_122388_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.5	0.0e+00
122422:122460	attL	CTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCT	NA	NA	NA	NA
WP_001067855.1|126439_127144_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_124060921.1|127120_127696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002008781.1|127961_128462_+	hypothetical protein	NA	A0A1V0SB21	Catovirus	31.7	3.3e-10
WP_000019304.1|128461_129031_+	trimethoprim-resistant dihydrofolate reductase DfrA19	NA	A0A1V0SD48	Indivirus	27.2	3.5e-08
WP_048228299.1|129041_129647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002075255.1|129633_130647_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_060614779.1|130799_131540_+	subclass B1 metallo-beta-lactamase IMP-26	NA	NA	NA	NA	NA
WP_048336621.1|131629_132979_-	group II intron reverse transcriptase/maturase	NA	H7BV81	unidentified_phage	28.3	3.3e-12
WP_000679427.1|133651_133999_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|133992_134832_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376623.1|134959_135460_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152787.1|135442_135583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|135966_136731_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004098817.1|136991_138206_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001288432.1|138239_139673_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_001749967.1|140054_140261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001339197.1|140588_141797_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_012579083.1|142658_143078_-	fosfomycin resistance glutathione transferase FosA5	NA	Q2LI91	Bacillus_phage	30.2	7.8e-05
WP_001143760.1|143910_146916_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
143877:143915	attR	AGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAG	NA	NA	NA	NA
WP_001556711.1|147079_147652_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	89.0	2.0e-83
WP_004118313.1|147660_148065_+	arsenic transporter ATPase	NA	NA	NA	NA	NA
WP_000065758.1|148095_148521_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.2e-50
WP_000922630.1|148533_149823_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	2.5e-171
>prophage 3
NZ_CP033103	Enterobacter hormaechei strain L51 plasmid pEHZJ1, complete sequence	343918	161642	201439	343918	transposase	Salmonella_phage(20.0%)	37	NA	NA
WP_000427623.1|161642_162647_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_003100881.1|162725_165692_-|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
WP_001247892.1|165766_166057_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001293886.1|166053_166455_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_000215515.1|166444_166801_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000091613.1|167055_167370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194048.1|167796_168978_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	64.2	1.9e-120
WP_000509966.1|169637_170243_-	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_023307208.1|170337_173235_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	5.5e-182
WP_008502228.1|174111_174813_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_006687059.1|174878_175985_-	alkene reductase	NA	NA	NA	NA	NA
WP_008502229.1|176197_176527_+	thioredoxin family protein	NA	V9SJ74	Achromobacter_phage	34.7	9.7e-11
WP_000888080.1|176556_176895_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_023304048.1|176899_177481_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000108589.1|177622_178180_-	OsmC family protein	NA	NA	NA	NA	NA
WP_032627141.1|179550_180507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157508651.1|180654_181635_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	5.2e-185
WP_023304011.1|181675_182968_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_157508652.1|183031_185029_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.4	1.5e-21
WP_032242306.1|185736_186105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153247013.1|186253_186421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000677445.1|186797_187433_-	type 3 fimbria minor subunit MrkF	NA	NA	NA	NA	NA
WP_157508653.1|187446_188442_-	type 3 fimbria adhesin subunit MrkD	NA	NA	NA	NA	NA
WP_000813718.1|188432_190919_-	type 3 fimbria usher protein MrkC	NA	NA	NA	NA	NA
WP_000820818.1|190930_191632_-	type 3 fimbria chaperone MrkB	NA	NA	NA	NA	NA
WP_002916128.1|191727_192336_-	type 3 fimbria major subunit MrkA	NA	NA	NA	NA	NA
WP_157508654.1|192441_192972_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_096147877.1|193173_194294_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_032676095.1|194726_195299_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	47.2	7.8e-40
WP_157508655.1|195307_196126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080339306.1|196196_197540_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000785965.1|197764_198082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100610.1|198104_198410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000285959.1|198454_199126_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_001371904.1|199583_199991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000900745.1|200041_200359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_119505882.1|200524_201439_-|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	98.7	9.5e-173
>prophage 4
NZ_CP033103	Enterobacter hormaechei strain L51 plasmid pEHZJ1, complete sequence	343918	244594	307905	343918	transposase,integrase	Escherichia_phage(50.0%)	69	262690:262749	303404:304761
WP_000219087.1|244594_245833_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	23.1	2.5e-11
WP_000589001.1|246254_247595_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_085949440.1|247769_249139_-|transposase	IS3-like element ISKpn8 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	95.5	9.4e-108
WP_000137794.1|249471_250077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000703842.1|250293_250575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633161.1|250950_251262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000814953.1|251484_251685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000551490.1|251724_251949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000781547.1|252003_252207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371932.1|252759_253251_-	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_001165367.1|253255_253567_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000071366.1|254083_254404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371935.1|254582_254813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000252081.1|254984_255878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|256187_256892_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000842134.1|257381_258491_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	2.8e-33
WP_001039466.1|258585_259770_-	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
WP_000113282.1|259865_260522_+	tetracycline resistance transcriptional repressor TetR(D)	NA	NA	NA	NA	NA
WP_001067855.1|260533_261238_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001011939.1|261381_262023_-	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
WP_001239317.1|262172_262673_-	hypothetical protein	NA	NA	NA	NA	NA
262690:262749	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|262752_263457_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001044210.1|263462_263603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001446887.1|264088_264826_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000743213.1|264822_265047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000954592.1|265168_265345_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_000427619.1|265526_266531_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_042863651.1|266609_269576_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.8	0.0e+00
WP_001067855.1|269696_270401_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002904004.1|270537_271398_+	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|271418_272180_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|272441_273344_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_157508656.1|274600_275032_+	hypothetical protein	NA	A0A077SK32	Escherichia_phage	97.3	2.2e-55
WP_157508657.1|274977_275682_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	2.0e-138
WP_000376623.1|275757_276258_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|276385_277225_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_052238321.1|277218_277554_-	ethidium bromide resistance protein	NA	NA	NA	NA	NA
WP_025999322.1|277446_277812_+	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_004193231.1|277815_278691_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004236386.1|278801_279941_+	class C beta-lactamase DHA-1	NA	NA	NA	NA	NA
WP_004193241.1|281291_281522_-	phage shock protein PspD	NA	NA	NA	NA	NA
WP_004193243.1|281530_281890_-	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_004193245.1|281889_282114_-	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_003020532.1|282168_282837_-	phage shock protein PspA	NA	NA	NA	NA	NA
WP_004193248.1|283007_283982_+	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_017900990.1|284064_284709_+	quinolone resistance pentapeptide repeat protein QnrB4	NA	NA	NA	NA	NA
WP_004193260.1|284804_285713_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	53.0	4.3e-77
WP_004193262.1|285889_286468_-	2-oxo-tetronate isomerase	NA	B5TK85	Pseudomonas_phage	34.0	2.0e-19
WP_004193264.1|286415_286862_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_004193267.1|286871_287375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193269.1|287506_287899_+	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_004193272.1|288199_289843_+	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
WP_004193276.1|289839_290805_+	peptide ABC transporter permease SapB	NA	NA	NA	NA	NA
WP_000050481.1|291480_293022_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|293426_294266_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|294259_294607_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_012695487.1|295916_296348_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_012695486.1|296710_297124_-	NAD(+)--rifampin ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_012695485.1|297251_298061_-	AAC(3)-II family aminoglycoside N-acetyltransferase	NA	O64018	Bacillus_phage	29.3	1.2e-17
WP_006473457.1|298302_299658_-|transposase	IS1380-like element IS1247 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.7	2.2e-45
WP_012695484.1|300145_300727_-	aminoglycoside N-acetyltransferase AAC(6')-IIc	NA	NA	NA	NA	NA
WP_002075255.1|300889_301903_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_001044210.1|302549_302690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|302695_303400_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000159617.1|303915_304110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172888.1|304106_304418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001180999.1|304480_304720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000140246.1|306535_306865_-	hypothetical protein	NA	NA	NA	NA	NA
303404:304761	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCATTTCTTTTCTCATTCCTTCAACACTAAAAGCTCCTTTAAAAAGGTTGCAGGGGGCGCATGATGGAAATAAGTTTTCTATAGCATGCAGTTCAGGGTGCATAACCTTACCCGTACTTCGGGCAACATGAGTTACGCCGCTGCCGACAGGGGCTCTCACCAGTTCAAAGTCGCGTCGAACAGGCTCAACATGATCGGCATGCCACCCTTTTTCAGGAAGCTTGCAACCACAATAGGCACAACGCCCCCCAAATTTCATTCGCAGCTCAGCTCGCTGTATTTTAGAGATCTTATTTTTAGGTTTTGAGAACCTACCATCAGGTGATTCAGCTTTGGATAACTTTGCTGAGGGCTCAGGTAATTCAACTAAATTCCCGTTGATATTTATCACCTTGACCATATCATTTTCCGCCTTTACTAAGCTCACGGGCACAGGAACTGGCTTAAGTAACCGCTAAAGATAACAGCCACTGACTGCATCTACCCAGACCTTCTGTTTATACTCAATAGGCCACCCCTCTTTATCTGCCCGGATGACGCAATCATTTACCGTGGTGCGTGACCGGATACGAACATCAAGCGGAAGCGAATCGTTATCCACACGAGCCTGTGCCTCATTTAAAATGCGTAAAAACATCTCTTTGGTCATTCAGATACCCCCTCAACTTTGCGAATTTTGATCAGATGAGGGCGACTCAGTTTACAAAGTTGTTCTGTCGCTTCATCAATCGAATTGAACCGATGAGCCTCTTCGATATTTAAAGTCCAGTATTTCGCTTTCCCTTCTCCCAGATCGGACTCAAAATAATTTCGCTTTACATCCATTTTTTTAGGCCTGCCATTTATCTTGACGACATTATGTCTGTCATCAAAAAGAAATTCGTCCCCCTCAAAAGTGATTAATACAAATGGCCCCTCAGGCTTGGAAGTCCGGGAACTTTCCATTTTCAAAGTCATACTTCAGCCTCTCGATAGAACTCATGAAACGTCAAATTAAAATGGACTCACACCACACTGATTCAGTATTCCTCCTGAACCCCATTAGGCTCTGTTGTGATTTCATATTTAATTCCGCCAGGTGCTCCCACAGCGTCCGCGACCGACTCACACAGCAGCGAGAGATCGTTGAGGGTCATTGGGTGTTCAATGTCCAGCGTGAAGAGTTTCCCGGCTTGCTTGGCGGCTGTCTTGTCAGCATGTTCGGCATTAAAAAGGTATACGGTGTGTTTTTCCTGAGCGGGTGTATTTTGATTTTGCATTGATGATCCTTTTGTTTAGTTCCCCGATTCCGGGGGTGAGT	NA	NA	NA	NA
WP_022646498.1|306981_307905_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	3.8e-177
