The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046429	Salmonella enterica strain R19.2839 chromosome, complete genome	4812688	12649	35846	4812688	transposase,integrase	Escherichia_phage(30.0%)	25	NA	NA
WP_001138064.1|12649_15616_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|15618_16179_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|16304_16655_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|16857_17871_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000703418.1|18028_18502_+	trimethoprim-resistant dihydrofolate reductase DfrA7	NA	A0A1B2IBQ4	Erwinia_phage	32.0	8.4e-16
WP_000679427.1|18731_19079_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|19072_19912_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_001067855.1|20145_20850_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001387387.1|20896_21298_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|21447_22308_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|22807_23512_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000480968.1|23572_24409_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|24408_25212_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_001043265.1|25272_26088_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000240536.1|26395_27247_-	replication protein	NA	NA	NA	NA	NA
WP_001067855.1|28002_28707_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001300294.1|30096_30765_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|30800_31037_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|31033_31396_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|31413_33108_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|33159_33582_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|33617_33893_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|33906_34257_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|34328_34763_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000427619.1|34841_35846_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP046429	Salmonella enterica strain R19.2839 chromosome, complete genome	4812688	765654	809357	4812688	bacteriocin,tRNA,transposase,protease	Acinetobacter_phage(25.0%)	48	NA	NA
WP_000421096.1|765654_765933_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_000768134.1|766175_766442_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_001141622.1|766438_766756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071525158.1|767876_768056_-	type VI secretion system protein	NA	NA	NA	NA	NA
WP_001681938.1|768405_768690_-	DUF4102 domain-containing protein	NA	A0A0P0IRB7	Acinetobacter_phage	35.2	3.2e-10
WP_000234466.1|769031_769739_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001049802.1|772349_773606_-	nucleoside permease	NA	NA	NA	NA	NA
WP_000976287.1|773822_774908_-	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
WP_000091706.1|775020_775296_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001148958.1|775323_776376_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000786887.1|776530_777250_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001107559.1|777249_777576_+	YggL family protein	NA	NA	NA	NA	NA
WP_000984827.1|777625_778345_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_000502119.1|778467_778926_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000394189.1|779244_780291_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000252198.1|780423_781431_+	DUF1202 domain-containing protein	NA	NA	NA	NA	NA
WP_001096530.1|781521_782658_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_001174773.1|782650_783244_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_001277205.1|783251_783542_-	YggU family protein	NA	NA	NA	NA	NA
WP_001094848.1|783538_784105_-	YggT family protein	NA	NA	NA	NA	NA
WP_000997790.1|784123_784828_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_001055657.1|784845_785826_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000098333.1|785955_786642_+	global regulatory protein	NA	NA	NA	NA	NA
WP_001285491.1|786688_787105_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001053167.1|787104_787668_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000593242.1|787883_788831_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001800534.1|788850_789582_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000286121.1|789658_790366_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_000856775.1|790461_790959_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_001113171.1|791037_792432_-	galactose/proton symporter	NA	NA	NA	NA	NA
WP_001062140.1|792924_794079_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
WP_001803086.1|794134_794434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077905074.1|794430_794595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000729109.1|794728_794860_+	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001278580.1|794868_796845_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_000105550.1|797072_797993_+	agmatinase	NA	NA	NA	NA	NA
WP_000701830.1|798093_798852_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000098658.1|799127_801119_+	transketolase	NA	NA	NA	NA	NA
WP_000502119.1|801307_801766_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000956919.1|801870_802527_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
WP_001775599.1|802520_803198_-	energy-coupling factor ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_000553254.1|803185_803893_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_000124001.1|803893_804472_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_000218564.1|804497_804923_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000218338.1|805296_806343_+	erythrose-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000111274.1|806364_807528_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_000034386.1|807629_808709_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001204111.1|808898_809357_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP046429	Salmonella enterica strain R19.2839 chromosome, complete genome	4812688	1074190	1140181	4812688	tail,tRNA	Salmonella_phage(41.18%)	53	NA	NA
WP_000047238.1|1074190_1076821_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.3	3.5e-79
WP_000906486.1|1077055_1077241_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000271296.1|1078639_1079206_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	27.6	7.2e-14
WP_001279499.1|1079202_1079628_+	DedA family protein	NA	NA	NA	NA	NA
WP_000611827.1|1079704_1081261_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001130194.1|1081410_1081926_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_000645128.1|1082271_1083642_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_001187289.1|1083690_1085229_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_001275597.1|1085245_1086418_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_000378431.1|1086544_1087075_-	transcriptional repressor MprA	NA	NA	NA	NA	NA
WP_000165770.1|1087571_1088756_-	MFS transporter	NA	NA	NA	NA	NA
WP_001216613.1|1088920_1089916_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000775015.1|1089985_1091050_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_000777898.1|1092598_1093558_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.8	4.0e-129
WP_000201426.1|1093568_1095713_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	49.0	3.5e-194
WP_001275403.1|1095685_1096096_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	41.8	4.3e-16
WP_000028873.1|1096092_1096338_-	glutaredoxin-like protein NrdH	NA	NA	NA	NA	NA
WP_000209805.1|1096609_1097041_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_001519557.1|1098547_1098874_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000281304.1|1099035_1099386_+	YgaC family protein	NA	NA	NA	NA	NA
WP_000492647.1|1099420_1099870_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_001051100.1|1100568_1100970_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_000022010.1|1101318_1101846_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_000137417.1|1101855_1102155_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000508175.1|1102337_1102496_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000126152.1|1103066_1103744_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001095643.1|1105315_1106599_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	31.4	1.2e-32
WP_001176534.1|1106613_1108062_-	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000271916.1|1108083_1109352_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_000993092.1|1109377_1110355_-	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_000382024.1|1110657_1112172_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_001574835.1|1112182_1112617_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_000744418.1|1112628_1113438_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_001237936.1|1113592_1114267_+	transcriptional regulator TctD	NA	NA	NA	NA	NA
WP_000872343.1|1114253_1115669_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000947097.1|1115909_1116815_+	HoxN/HupN/NixA family nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000701509.1|1117536_1118433_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_000178741.1|1118726_1119656_-	VirK family antimicrobial peptide resistance protein	NA	NA	NA	NA	NA
WP_001801692.1|1120172_1121225_+	SPI-2 type III secretion system effector PipB2	NA	NA	NA	NA	NA
WP_001682025.1|1122246_1124427_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_000274373.1|1124486_1125404_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001239947.1|1125435_1126680_-	esterase family protein	NA	NA	NA	NA	NA
WP_001111827.1|1126789_1130446_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
WP_001221113.1|1130526_1131642_-	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_000905046.1|1132325_1132892_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.1e-86
WP_000046142.1|1133034_1134207_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
WP_001207656.1|1134216_1134732_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
WP_001280897.1|1134786_1135089_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
WP_000763311.1|1135103_1135223_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001282793.1|1135215_1138293_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
WP_000980381.1|1138289_1138775_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
WP_001011760.1|1138771_1139872_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
WP_000972389.1|1139962_1140181_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
>prophage 4
NZ_CP046429	Salmonella enterica strain R19.2839 chromosome, complete genome	4812688	1826603	1833915	4812688	integrase,protease	Dickeya_phage(16.67%)	7	1827854:1827868	1839033:1839047
WP_001201759.1|1826603_1827722_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
WP_000125880.1|1827718_1829665_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
1827854:1827868	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_000447499.1|1829794_1830016_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1830339_1830660_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934058.1|1830690_1832967_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
WP_001117984.1|1833178_1833376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001539594.1|1833537_1833915_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
1839033:1839047	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 5
NZ_CP046429	Salmonella enterica strain R19.2839 chromosome, complete genome	4812688	1905053	1979153	4812688	holin,transposase,head,protease,tail,terminase,integrase	Salmonella_phage(74.14%)	87	1887119:1887138	1957726:1957745
1887119:1887138	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_001262313.1|1905053_1906346_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	5.0e-252
WP_000065276.1|1906390_1906639_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001754984.1|1906679_1906919_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	96.2	9.7e-37
WP_010989138.1|1906924_1907806_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
WP_000034527.1|1907802_1908867_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
WP_000187053.1|1908944_1909625_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
WP_001764962.1|1909621_1910407_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
WP_000995349.1|1910412_1910709_-	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
WP_000186242.1|1910799_1911000_-	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
WP_001009036.1|1911288_1911693_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
WP_000869365.1|1911822_1912059_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	98.7	1.1e-37
WP_001574095.1|1912024_1912399_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_001681803.1|1912483_1913467_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
WP_000800010.1|1913469_1914219_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113623.1|1914229_1914577_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000065105.1|1914573_1915098_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
WP_000445792.1|1915097_1915571_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
WP_000208074.1|1915574_1916147_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
WP_000509711.1|1916992_1917172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000963896.1|1917182_1917680_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_001217670.1|1917864_1918104_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
WP_001804676.1|1918159_1918399_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	100.0	5.9e-42
WP_000929790.1|1918438_1919041_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_001096560.1|1919249_1919861_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
WP_001617856.1|1919857_1920004_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047634.1|1919993_1920791_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
WP_001534733.1|1921189_1921315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798706.1|1921450_1921900_-	lipoprotein	NA	NA	NA	NA	NA
WP_001294876.1|1922116_1922506_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
WP_000226307.1|1922492_1922774_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_001075998.1|1922773_1923388_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
WP_000495544.1|1923965_1924343_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
WP_001070544.1|1924439_1924667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001118118.1|1924756_1925509_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
WP_000204794.1|1925474_1926878_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
WP_000113511.1|1926877_1928347_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
WP_138010671.1|1928231_1928969_+|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	88.1	7.8e-101
WP_000873182.1|1928983_1930216_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
WP_000128060.1|1930220_1930718_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
WP_000627464.1|1930729_1931671_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
WP_001040702.1|1931712_1932081_+	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
WP_001125675.1|1932046_1932454_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
WP_000008737.1|1932450_1933005_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
WP_001142488.1|1932991_1933381_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
WP_000389379.1|1933355_1933919_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
WP_001135544.1|1933922_1935068_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
WP_000257259.1|1935079_1935520_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
WP_000389047.1|1935523_1935976_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
WP_000990867.1|1936153_1938106_+	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
WP_000346974.1|1938105_1938756_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
WP_000388505.1|1938759_1939062_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
WP_000042301.1|1939064_1940096_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
WP_000826019.1|1940092_1940428_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
WP_000050472.1|1940622_1941354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144794.1|1941353_1941782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001685627.1|1941840_1942596_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
WP_001270647.1|1942836_1943190_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
WP_001197092.1|1943190_1944390_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
WP_000049938.1|1944386_1945067_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
WP_001681975.1|1945066_1946578_+	hypothetical protein	NA	S4TP62	Salmonella_phage	59.4	1.5e-111
WP_000421106.1|1946592_1947111_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
WP_000480169.1|1948032_1948734_-	DUF1076 domain-containing protein	NA	NA	NA	NA	NA
WP_000193884.1|1949750_1952363_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
WP_000291724.1|1952570_1953581_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1953746_1954289_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224084.1|1954285_1955395_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086472.1|1955493_1957602_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
WP_000053045.1|1957614_1959522_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1957726:1957745	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000333152.1|1959536_1960790_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433416.1|1960794_1962435_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1962431_1962995_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001764860.1|1963248_1963416_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1963515_1964034_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156455.1|1964102_1965863_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877174.1|1966048_1966501_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_010989142.1|1966572_1967625_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1967979_1968489_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202371.1|1968705_1969311_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950867.1|1969297_1971451_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1971469_1971916_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420526.1|1972039_1974094_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
WP_000424187.1|1974129_1974588_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1974682_1975345_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|1975518_1975932_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1975976_1976294_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140485.1|1976351_1977563_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000502118.1|1978694_1979153_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP046429	Salmonella enterica strain R19.2839 chromosome, complete genome	4812688	2425183	2498781	4812688	transposase,capsid,protease,tail,tRNA,plate,integrase	Burkholderia_virus(38.1%)	89	2415513:2415528	2471386:2471401
2415513:2415528	attL	GATTTTACCTGCCTTT	NA	NA	NA	NA
WP_000502118.1|2425183_2425642_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000431187.1|2425598_2425781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001766314.1|2426174_2426426_+	acid shock protein	NA	NA	NA	NA	NA
WP_000549642.1|2426694_2427516_+|protease	serine protease	protease	NA	NA	NA	NA
WP_001183821.1|2427550_2427880_-	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_000500278.1|2427866_2428229_-	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_001118268.1|2428645_2429680_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_000014056.1|2429854_2431243_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_001219360.1|2431253_2432783_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000769298.1|2433309_2434254_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001281695.1|2434435_2434825_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
WP_000988475.1|2434796_2435249_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
WP_010989166.1|2435238_2435454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000631816.1|2435443_2435674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131941.1|2435670_2436354_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
WP_153781233.1|2436350_2436551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001315283.1|2436558_2436942_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
WP_000197790.1|2436938_2437241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000632575.1|2437250_2437523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140134.1|2437811_2438342_-	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
WP_000843446.1|2438369_2438639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000960673.1|2438641_2439808_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
WP_000990529.1|2439818_2441588_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
WP_000567456.1|2441591_2441756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001765083.1|2441765_2442197_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.3	4.5e-32
WP_100208317.1|2442192_2442789_+	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000793143.1|2443032_2443383_+	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
WP_001104436.1|2443385_2444114_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	57.4	2.7e-61
WP_000264664.1|2444097_2444748_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
WP_000175097.1|2444744_2445071_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_000227700.1|2445070_2445382_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000124060.1|2445381_2445927_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
WP_029246253.1|2445986_2447519_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.0e-184
WP_000090679.1|2447518_2449015_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
WP_000117561.1|2448995_2449817_+|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
WP_000135517.1|2449819_2450278_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
WP_001273072.1|2450492_2451608_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
WP_001286905.1|2451622_2452576_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
WP_000537457.1|2452585_2452924_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_000271668.1|2452925_2453372_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_001101804.1|2453371_2453836_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_001789770.1|2453832_2454087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729859.1|2454076_2455504_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
WP_162828734.1|2455500_2456025_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.2	4.7e-68
WP_000110118.1|2456027_2456309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000084228.1|2456406_2456742_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001148841.1|2456686_2456824_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000135574.1|2456917_2459383_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	42.6	2.2e-168
WP_000458383.1|2459382_2460267_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.0	7.5e-50
WP_010989167.1|2460263_2460479_+	membrane protein	NA	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
WP_000808000.1|2460466_2461621_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
WP_000148263.1|2461617_2462145_+|plate	phage baseplate assembly protein V	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
WP_000859114.1|2462201_2462549_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
WP_001219103.1|2462539_2463643_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
WP_000852584.1|2463635_2464214_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
WP_001775322.1|2464216_2465170_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	51.8	1.2e-58
WP_024131173.1|2465180_2465654_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	53.0	4.3e-36
WP_024131174.1|2465664_2466141_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	56.4	1.9e-44
WP_001057643.1|2466147_2466765_-|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
WP_001802272.1|2466764_2467268_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	54.0	2.3e-43
WP_024131175.1|2467278_2467812_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	58.8	2.8e-44
WP_001165548.1|2467883_2468456_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
WP_000412353.1|2468736_2470119_+	amino acid permease	NA	NA	NA	NA	NA
WP_000524877.1|2470180_2470516_-	GlpM family protein	NA	NA	NA	NA	NA
WP_001080045.1|2470642_2471374_+	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_000924582.1|2471438_2471738_-	hypothetical protein	NA	NA	NA	NA	NA
2471386:2471401	attR	GATTTTACCTGCCTTT	NA	NA	NA	NA
WP_000824321.1|2471854_2473006_+	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
WP_000928668.1|2473158_2474865_+	amidohydrolase	NA	NA	NA	NA	NA
WP_001681605.1|2474975_2476277_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
WP_000092483.1|2476352_2477282_+	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_000259129.1|2477278_2478682_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_000066606.1|2478849_2480496_-	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_001170615.1|2480695_2481871_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000753325.1|2481973_2483482_+	YdgA family protein	NA	NA	NA	NA	NA
WP_000565566.1|2484187_2485189_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_000998242.1|2485262_2486303_-	oxidoreductase	NA	NA	NA	NA	NA
WP_031608772.1|2486510_2486636_+	division septum protein Blr	NA	NA	NA	NA	NA
WP_000217946.1|2486934_2487150_+	transcription modulator YdgT	NA	NA	NA	NA	NA
WP_000214061.1|2487238_2487679_+	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_000133179.1|2487755_2488337_+	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_001092600.1|2488336_2488915_+	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_000915581.1|2488907_2490929_+	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_000231887.1|2490929_2491988_+	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
WP_000920820.1|2491991_2492612_+	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_001289628.1|2492614_2493307_+	electron transport complex subunit E	NA	NA	NA	NA	NA
WP_001030324.1|2493306_2493942_+	endonuclease III	NA	NA	NA	NA	NA
WP_000100913.1|2494542_2496048_+	dipeptide/tripeptide permease DtpA	NA	NA	NA	NA	NA
WP_000765713.1|2496152_2496758_+	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_000168626.1|2497506_2498781_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 7
NZ_CP046429	Salmonella enterica strain R19.2839 chromosome, complete genome	4812688	2679818	2684230	4812688		Escherichia_phage(50.0%)	7	NA	NA
WP_000497459.1|2679818_2680058_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
WP_001036668.1|2680269_2680434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001529135.1|2680930_2681740_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
WP_001277616.1|2681812_2682190_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_000158843.1|2682337_2682880_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
WP_001766395.1|2683071_2683800_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
WP_000281950.1|2683816_2684230_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 8
NZ_CP046429	Salmonella enterica strain R19.2839 chromosome, complete genome	4812688	2888084	2895318	4812688		Morganella_phage(33.33%)	8	NA	NA
WP_001157299.1|2888084_2889515_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377043.1|2889588_2890284_-	phosphohydrolase	NA	S4W232	Pandoravirus	27.5	2.1e-07
WP_000107435.1|2890363_2890675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080666.1|2891325_2892510_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
WP_024131163.1|2892770_2892959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208507.1|2892969_2893182_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
WP_000457648.1|2893627_2894896_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
WP_000394197.1|2894898_2895318_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 9
NZ_CP046429	Salmonella enterica strain R19.2839 chromosome, complete genome	4812688	3001618	3012125	4812688		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126347.1|3001618_3002932_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565909.1|3002958_3004038_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
WP_000648783.1|3004042_3004816_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018220.1|3004831_3005806_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973711.1|3005811_3006363_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
WP_000857536.1|3006363_3007242_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
WP_001023656.1|3007289_3008189_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
WP_000697846.1|3008188_3009274_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_000981469.1|3009650_3010544_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111852.1|3010721_3012125_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 10
NZ_CP046429	Salmonella enterica strain R19.2839 chromosome, complete genome	4812688	3088016	3097187	4812688	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195338.1|3088016_3090050_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
WP_000703137.1|3090290_3090749_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197951.1|3090920_3091451_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|3091507_3091975_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598632.1|3092021_3092741_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272853.1|3092737_3094423_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
WP_001240415.1|3094645_3095377_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|3095436_3095544_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|3095524_3096256_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|3096239_3097187_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 11
NZ_CP046429	Salmonella enterica strain R19.2839 chromosome, complete genome	4812688	3331696	3337727	4812688		Salmonella_virus(50.0%)	6	NA	NA
WP_000377769.1|3331696_3332638_+	membrane protein	NA	E7DYY8	Enterobacteria_phage	88.2	2.4e-147
WP_001682026.1|3333880_3334270_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	91.5	6.9e-56
WP_000703599.1|3334238_3334493_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_044790602.1|3334509_3336432_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.0	3.6e-299
WP_106417236.1|3337421_3337565_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	87.8	9.0e-14
WP_106417237.1|3337580_3337727_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	73.9	1.1e-14
>prophage 12
NZ_CP046429	Salmonella enterica strain R19.2839 chromosome, complete genome	4812688	3996793	4006558	4812688	integrase	Enterobacteria_phage(50.0%)	11	3993364:3993377	4004767:4004780
3993364:3993377	attL	CGAAGGCCGGACTC	NA	NA	NA	NA
WP_015701354.1|3996793_3997345_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.1e-30
WP_000556589.1|3997277_3997601_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
WP_071525138.1|3997672_3997858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001779443.1|3998140_3998884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000468230.1|3998887_3999127_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
WP_000214423.1|3999142_3999709_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
WP_000493739.1|3999984_4001148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000700163.1|4001137_4002196_+	serine/threonine protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	4.9e-56
WP_000573583.1|4002192_4003269_+	serine/threonine protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
WP_000772672.1|4003331_4004597_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	1.6e-74
WP_000152561.1|4005067_4006558_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	36.1	4.0e-11
4004767:4004780	attR	CGAAGGCCGGACTC	NA	NA	NA	NA
>prophage 13
NZ_CP046429	Salmonella enterica strain R19.2839 chromosome, complete genome	4812688	4145521	4220057	4812688	capsid,head,plate,lysis,portal,tail,terminase,integrase	Salmonella_phage(82.98%)	80	4175859:4175874	4198862:4198877
WP_000954536.1|4145521_4146781_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
WP_000975154.1|4147091_4148375_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_000511749.1|4149355_4150138_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_162009227.1|4150407_4150602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193665.1|4150994_4151216_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
WP_000246267.1|4151212_4151674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989301.1|4152220_4153894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989300.1|4153974_4156260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024131240.1|4156563_4156815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000434168.1|4156896_4157349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000622308.1|4157528_4158017_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001143724.1|4158013_4158307_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_000449622.1|4158733_4159747_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000488995.1|4159910_4161500_-	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001120833.1|4161483_4162995_-	ATP-dependent helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
WP_001210944.1|4163848_4164388_+	Vi polysaccharide biosynthesis regulator TviA	NA	NA	NA	NA	NA
WP_000466893.1|4164632_4165910_+	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
WP_000127915.1|4165912_4166959_+	Vi polysaccharide biosynthesis UDP-N-acetylglucosaminuronic acid C-4 epimerase TviC	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
WP_010989299.1|4166982_4169478_+	Vi polysaccharide biosynthesis protein TviD	NA	NA	NA	NA	NA
WP_000632616.1|4169477_4171214_+	Vi polysaccharide biosynthesis glycosyltransferase TviE	NA	NA	NA	NA	NA
WP_000720235.1|4171258_4172326_+	Vi polysaccharide ABC transporter protein VexA	NA	NA	NA	NA	NA
WP_001023498.1|4172335_4173130_+	Vi polysaccharide ABC transporter inner membrane protein VexB	NA	NA	NA	NA	NA
WP_000467404.1|4173155_4173851_+	Vi polysaccharide ABC transporter ATP-binding protein VexC	NA	NA	NA	NA	NA
WP_000431675.1|4173873_4175178_+	Vi polysaccharide ABC transporter inner membrane protein VexD	NA	NA	NA	NA	NA
WP_000052242.1|4175197_4177168_+	Vi polysaccharide transport protein VexE	NA	NA	NA	NA	NA
4175859:4175874	attL	CGCTGTGCGCTGTCGG	NA	NA	NA	NA
WP_000354257.1|4177469_4178216_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001681808.1|4178215_4179106_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001681810.1|4179116_4179374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000027757.1|4180480_4181506_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
WP_000052560.1|4181509_4182142_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
WP_000102106.1|4182258_4182501_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
WP_000460852.1|4182533_4183043_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
WP_000956167.1|4183050_4183251_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
WP_000963479.1|4183214_4183556_+	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
WP_001244240.1|4183623_4183857_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
WP_000785510.1|4183856_4184084_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
WP_001090717.1|4184080_4184665_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
WP_000104130.1|4184661_4185522_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
WP_001154438.1|4188075_4188264_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	96.8	7.9e-26
WP_001217561.1|4188275_4188509_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	92.2	2.2e-33
WP_000835188.1|4188604_4188823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000829584.1|4188832_4189897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789323.1|4189893_4190958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080839.1|4190977_4191673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001681813.1|4191721_4192765_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
WP_001098453.1|4192764_4194531_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
WP_000216272.1|4194673_4195507_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
WP_000730751.1|4195523_4196588_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
WP_000059175.1|4196591_4197242_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
WP_000673540.1|4197335_4197800_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
WP_000868184.1|4197799_4198003_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171566.1|4198006_4198222_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
WP_001097942.1|4198202_4198712_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.0	1.3e-91
WP_000731034.1|4198716_4199094_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
4198862:4198877	attR	CGCTGTGCGCTGTCGG	NA	NA	NA	NA
WP_024131238.1|4199090_4199519_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	97.9	3.3e-67
WP_001039966.1|4199614_4200046_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
WP_000343944.1|4200038_4200485_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
WP_000993749.1|4200553_4201132_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
WP_000177408.1|4201128_4201488_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
WP_000268327.1|4201474_4202383_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
WP_001086816.1|4202375_4202981_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
WP_000104806.1|4202977_4204597_+|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
WP_000006337.1|4204603_4205011_+|tail	tail assembly protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
WP_000161708.1|4205208_4205931_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000388790.1|4206144_4206363_+	Hin recombinase	NA	A0A1S6L009	Salmonella_phage	90.3	1.4e-29
WP_000046101.1|4206465_4207638_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
WP_001207653.1|4207647_4208163_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
WP_001280965.1|4208217_4208520_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
WP_000763315.1|4208534_4208654_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	94.9	1.2e-14
WP_161976233.1|4208880_4211427_+|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	42.7	1.2e-113
WP_000980405.1|4211426_4211912_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
WP_001011750.1|4211908_4213009_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
WP_001775272.1|4213076_4213295_+	positive regulator of late gene transcription	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
WP_001039750.1|4213381_4213759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000457555.1|4213978_4215253_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
WP_001222413.1|4215384_4215654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000911568.1|4215753_4216080_-	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_000022216.1|4216154_4217054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881183.1|4217127_4218036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097965.1|4218107_4220057_-	DUF1738 domain-containing protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
>prophage 14
NZ_CP046429	Salmonella enterica strain R19.2839 chromosome, complete genome	4812688	4669682	4707740	4812688	capsid,transposase,head,plate,lysis,portal,tail,terminase,integrase	Salmonella_phage(76.74%)	49	4664646:4664660	4676812:4676826
4664646:4664660	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
WP_001012560.1|4669682_4671329_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
WP_001311244.1|4671468_4671567_-	ilv operon leader peptide	NA	NA	NA	NA	NA
WP_000290950.1|4672192_4673245_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
WP_000900883.1|4673433_4673625_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_001047327.1|4673640_4674210_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
WP_001247706.1|4674335_4674557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|4674589_4675099_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956176.1|4675106_4675403_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	4.9e-22
WP_000996717.1|4675520_4675862_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_001244218.1|4675929_4676163_+	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
WP_000752613.1|4676162_4676390_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000104152.1|4676386_4677244_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
4676812:4676826	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
WP_000017503.1|4677240_4679655_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_001580533.1|4679808_4679997_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
WP_000822803.1|4680064_4680364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001251692.1|4680472_4681351_-	hypothetical protein	NA	A0A2H4J8D6	uncultured_Caudovirales_phage	49.4	6.1e-52
WP_001146827.1|4681964_4682879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185757.1|4682875_4683616_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_000518064.1|4683650_4684688_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
WP_001098422.1|4684687_4686454_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000216244.1|4686596_4687430_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
WP_000742518.1|4687446_4688505_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
WP_000059191.1|4688508_4689159_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000673504.1|4689254_4689719_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.4e-76
WP_000868175.1|4689718_4689922_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|4689925_4690141_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001069905.1|4690121_4690634_+	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	3.1e-88
WP_000727853.1|4690635_4691013_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
WP_001080928.1|4691009_4691438_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	77.3	2.2e-47
WP_001039939.1|4691533_4691965_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
WP_000829146.1|4691957_4692404_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
WP_000993754.1|4692472_4693051_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
WP_000177595.1|4693047_4693407_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
WP_000268271.1|4693393_4694302_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
WP_001086816.1|4694294_4694900_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
WP_000104804.1|4694896_4696411_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
WP_000805568.1|4696410_4697004_+|tail	tail assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
WP_001174915.1|4696975_4697416_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
WP_072075000.1|4697418_4697817_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	37.5	1.3e-12
WP_000905046.1|4697844_4698411_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.1e-86
WP_000046142.1|4698553_4699726_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
WP_001207656.1|4699735_4700251_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
WP_001280897.1|4700305_4700608_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
WP_000763311.1|4700622_4700742_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001282793.1|4700734_4703812_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
WP_000980381.1|4703808_4704294_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
WP_001011760.1|4704290_4705391_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
WP_000972391.1|4705481_4705700_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_000502114.1|4707281_4707740_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP046430	Salmonella enterica strain R19.2839 plasmid pR19.2839_83k, complete sequence	83365	3928	57502	83365	integrase,transposase,protease,holin	Escherichia_phage(21.43%)	36	NA	NA
WP_001067855.1|3928_4633_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000427619.1|6529_7534_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000954592.1|7715_7892_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001043260.1|8221_9037_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001082319.1|9097_9901_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|9900_10737_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001120891.1|10708_11248_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|11457_12318_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|12500_13058_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000239590.1|14006_14882_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|14928_15261_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_001516695.1|19522_20179_+	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_001493761.1|20958_22350_-|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
WP_001493762.1|22386_22959_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_012477564.1|23095_23686_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_000534857.1|23936_24176_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	2.0e-18
WP_005032116.1|24556_26554_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	2.2e-20
WP_000625667.1|26617_27895_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001764183.1|28108_28798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067852.1|29141_29846_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
WP_000969996.1|32292_32574_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_021546940.1|32570_32840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012600012.1|34229_34409_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	60.3	6.8e-11
WP_032156934.1|34632_34950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021546939.1|35057_35945_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_001021938.1|35954_36554_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_000645940.1|36550_37135_+	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_000687847.1|37153_40831_+	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_021546938.1|40847_42611_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_021546937.1|42626_46256_+	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
WP_004011547.1|46255_48913_+	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_048659818.1|48974_51020_+|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_021546935.1|51695_52700_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|54595_55300_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_048230589.1|55276_56179_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	7.9e-156
WP_000600827.1|56524_57502_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	34.9	1.1e-06
