The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046381	Klebsiella pneumoniae strain BD_DM_782 chromosome, complete genome	5359736	443116	477118	5359736	head,integrase,tail,terminase,tRNA,capsid,portal,protease	uncultured_Caudovirales_phage(70.59%)	31	453135:453150	470705:470720
WP_004150007.1|443116_444064_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_004174081.1|444078_444588_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	1.5e-18
WP_002919139.1|444716_445841_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|445812_446286_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|446312_446855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|446859_447432_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_004181437.1|447435_448254_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|448250_448508_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|448483_449038_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
453135:453150	attL	AGCCCCGGTAAACGGC	NA	NA	NA	NA
WP_002919103.1|455009_455231_-	membrane protein	NA	NA	NA	NA	NA
WP_004144975.1|455523_458634_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|458646_459786_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|460164_460815_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
WP_048288915.1|461118_462342_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	96.8	1.2e-236
WP_075917478.1|462338_463184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156246496.1|463296_463506_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	95.7	1.4e-31
WP_156246498.1|463615_464239_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGN8	uncultured_Caudovirales_phage	52.3	1.4e-10
WP_156246407.1|464231_464444_+	aminotransferase	NA	A0A2H4JBA1	uncultured_Caudovirales_phage	82.5	1.5e-20
WP_032435122.1|464440_464809_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	78.7	9.4e-47
WP_156246409.1|464805_466941_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.1	1.3e-204
WP_064184075.1|467283_467619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032435116.1|467667_468180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156246410.1|468457_469618_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	94.0	7.7e-204
WP_016808183.1|469669_470230_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	94.1	1.0e-97
WP_156246411.1|470231_471467_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	95.4	7.1e-232
470705:470720	attR	GCCGTTTACCGGGGCT	NA	NA	NA	NA
WP_063106301.1|471463_471805_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	44.3	3.7e-21
WP_025861186.1|471797_472091_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	85.6	3.8e-43
WP_064184072.1|472090_472534_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	89.1	5.2e-76
WP_032435105.1|472807_473164_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	94.1	6.7e-58
WP_156246413.1|473147_474809_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	93.5	6.1e-311
WP_064184071.1|474820_477118_+	hypothetical protein	NA	A0A286S1S3	Klebsiella_phage	45.8	1.3e-154
>prophage 2
NZ_CP046381	Klebsiella pneumoniae strain BD_DM_782 chromosome, complete genome	5359736	1244648	1290883	5359736	head,lysis,integrase,tail,plate,terminase,coat,tRNA,capsid,portal	Salmonella_phage(83.33%)	59	1242942:1242988	1279509:1279555
1242942:1242988	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004151020.1|1244648_1245674_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
WP_004151019.1|1245676_1246306_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_001397669.1|1246428_1246671_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151018.1|1246703_1247213_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_004151017.1|1247220_1247421_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004144796.1|1247384_1247723_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151016.1|1247790_1248024_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004151014.1|1248023_1248251_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151013.1|1248247_1249099_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151012.1|1249095_1251480_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004151011.1|1251642_1251831_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151010.1|1251842_1252076_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151009.1|1252171_1252855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|1252841_1253921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151007.1|1253920_1254922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940854.1|1255443_1255713_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151006.1|1255769_1256813_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_019405037.1|1256812_1258576_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151004.1|1258716_1259550_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_004151003.1|1259566_1260619_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004134644.1|1260622_1261276_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151002.1|1261371_1261836_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004151001.1|1261835_1262039_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004134639.1|1262042_1262258_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151000.1|1262238_1262748_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004150999.1|1262752_1263136_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004150998.1|1263132_1263561_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_004150997.1|1263656_1264079_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150996.1|1264071_1264518_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150995.1|1264540_1265407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150994.1|1265501_1266074_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150993.1|1266070_1266433_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150992.1|1266419_1267328_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004152935.1|1267320_1267992_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150990.1|1267993_1269943_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004200602.1|1269952_1271071_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150988.1|1271122_1272196_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004150987.1|1272344_1273517_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150986.1|1273526_1274042_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150985.1|1274094_1274394_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_002896220.1|1274408_1274528_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150984.1|1274520_1277151_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
WP_004150983.1|1277147_1277633_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150982.1|1277629_1278724_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150981.1|1278790_1279009_+	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150980.1|1279036_1279414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|1280017_1280500_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1279509:1279555	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004188817.1|1280610_1281087_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914161.1|1281076_1281367_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1281433_1281775_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914159.1|1281922_1283584_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1283670_1284549_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|1284673_1285264_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|1285383_1286670_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1286689_1287481_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1287644_1289009_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1289268_1289517_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1289535_1290084_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|1290115_1290883_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP046381	Klebsiella pneumoniae strain BD_DM_782 chromosome, complete genome	5359736	1730739	1737644	5359736	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|1730739_1731603_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_023307294.1|1731613_1732387_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_002912636.1|1732627_1733521_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1733766_1735128_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|1735446_1736169_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|1736165_1737644_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 4
NZ_CP046381	Klebsiella pneumoniae strain BD_DM_782 chromosome, complete genome	5359736	2723201	2734088	5359736		Escherichia_phage(87.5%)	9	NA	NA
WP_004179756.1|2723201_2726309_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004176258.1|2726363_2727629_+	MFS transporter	NA	NA	NA	NA	NA
WP_004179755.1|2727659_2728748_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	3.0e-210
WP_004176262.1|2728834_2729095_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_004179754.1|2729392_2730253_+	class A beta-lactamase SHV-28	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
WP_002210513.1|2730273_2731035_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|2731295_2732198_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004179748.1|2732209_2733475_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	1.1e-232
WP_002210516.1|2733467_2734088_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 5
NZ_CP046381	Klebsiella pneumoniae strain BD_DM_782 chromosome, complete genome	5359736	2770527	2851784	5359736	head,integrase,tail,holin,terminase,capsid,portal,protease	Klebsiella_phage(47.92%)	91	2799783:2799799	2833047:2833063
WP_085806752.1|2770527_2771265_+|protease	serine protease	protease	NA	NA	NA	NA
WP_004224649.1|2771278_2771395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002903683.1|2771438_2771768_-	multidrug efflux SMR transporter subunit KpnF	NA	NA	NA	NA	NA
WP_004179723.1|2771754_2772117_-	multidrug efflux SMR transporter subunit KpnE	NA	NA	NA	NA	NA
WP_002903679.1|2772559_2773594_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_004176297.1|2773818_2775474_+	malonate decarboxylase subunit alpha	NA	NA	NA	NA	NA
WP_004143107.1|2775473_2776316_+	2-(5''-triphosphoribosyl)-3'-dephosphocoenzyme-A synthase	NA	NA	NA	NA	NA
WP_004143106.1|2776333_2776633_+	malonate decarboxylase acyl carrier protein	NA	NA	NA	NA	NA
WP_004143105.1|2776625_2777459_+	biotin-independent malonate decarboxylase subunit beta	NA	NA	NA	NA	NA
WP_004224637.1|2777458_2778259_+	biotin-independent malonate decarboxylase subunit gamma	NA	NA	NA	NA	NA
WP_004148291.1|2778395_2779355_+	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	2.7e-53
WP_004152239.1|2779358_2779976_+	malonate decarboxylase holo-ACP synthase	NA	NA	NA	NA	NA
WP_004179720.1|2779975_2780878_+	malonate decarboxylase subunit epsilon	NA	NA	NA	NA	NA
WP_002903632.1|2780867_2781794_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020324604.1|2781951_2783607_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_004179719.1|2783871_2784792_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_004179716.1|2784955_2785312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004179714.1|2785467_2787084_+	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
WP_004176303.1|2787080_2787800_+	two-component system response regulator DcuR	NA	NA	NA	NA	NA
WP_004179712.1|2787780_2788731_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_004179710.1|2788798_2791576_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.2	1.1e-65
WP_004148278.1|2792218_2793730_+	anion permease	NA	NA	NA	NA	NA
WP_004152246.1|2793784_2795437_+	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_004179708.1|2795599_2797216_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_004143067.1|2798260_2798650_-	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_004179700.1|2798642_2799407_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
WP_004179694.1|2799396_2800749_-	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
2799783:2799799	attL	CCCACTCCGCCTGCCAG	NA	NA	NA	NA
WP_004179693.1|2800758_2801961_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_004151559.1|2801971_2802628_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_002903522.1|2802638_2803325_-	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_004151560.1|2803494_2804301_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004143055.1|2804297_2804861_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_002903460.1|2804962_2805871_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004179692.1|2806037_2807348_+	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_004176321.1|2807347_2808793_+	amidohydrolase	NA	NA	NA	NA	NA
WP_017879817.1|2808912_2810031_+	transporter	NA	NA	NA	NA	NA
WP_004146386.1|2810159_2811260_+|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	56.8	2.9e-115
WP_148720230.1|2812631_2812979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156246451.1|2812971_2813418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156246452.1|2813459_2814290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156246454.1|2816392_2819470_-	kinase	NA	A0A286S259	Klebsiella_phage	62.4	0.0e+00
WP_004177128.1|2819466_2819847_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	80.2	1.6e-57
WP_004177130.1|2819859_2820336_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	65.8	4.8e-51
WP_004177132.1|2820322_2820796_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.1	1.4e-55
WP_004177134.1|2820817_2824396_-|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	62.6	2.5e-245
WP_004177136.1|2824458_2824980_-	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	45.2	1.7e-09
WP_004177139.1|2825054_2825360_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
WP_029603010.1|2825362_2825767_-|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	56.2	3.2e-32
WP_004177142.1|2825797_2826502_-	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.9	1.5e-80
WP_004177145.1|2826558_2826906_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	60.2	8.9e-31
WP_004177147.1|2826902_2827352_-	hypothetical protein	NA	Q9MCS9	Enterobacteria_phage	83.2	3.9e-63
WP_032423080.1|2827348_2827687_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	74.1	8.3e-42
WP_004177149.1|2827698_2828025_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	69.4	6.2e-42
WP_032442228.1|2828024_2828258_-	hypothetical protein	NA	A0A1P8DTJ1	Proteus_phage	68.1	1.5e-10
WP_004177151.1|2828300_2829518_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.1	1.6e-196
WP_029603008.1|2829527_2830376_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	84.6	1.0e-128
WP_029603007.1|2830388_2831696_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	85.1	9.3e-214
WP_032423081.1|2831695_2833438_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.0	6.3e-141
2833047:2833063	attR	CCCACTCCGCCTGCCAG	NA	NA	NA	NA
WP_004177162.1|2833391_2833856_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	61.4	3.7e-48
WP_156246456.1|2834035_2834377_-	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	74.8	1.3e-47
WP_156246458.1|2834535_2834781_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	61.5	8.8e-17
WP_049124265.1|2835105_2835378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004177174.1|2835510_2835795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032409976.1|2835885_2836080_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	89.1	6.9e-25
WP_049257432.1|2836030_2836306_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	49.4	4.1e-15
WP_065519814.1|2836302_2836650_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	79.1	6.8e-39
WP_004177182.1|2836646_2837186_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.3	2.0e-101
WP_031280382.1|2837182_2837482_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	99.0	2.9e-46
WP_071717307.1|2838008_2838332_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_049123629.1|2838778_2839561_-	molecular chaperone	NA	F1C595	Cronobacter_phage	79.1	5.0e-114
WP_023317656.1|2839557_2840034_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	98.7	2.6e-89
WP_049257405.1|2840030_2840993_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_074422736.1|2840994_2842653_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|2843227_2843449_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|2843546_2844215_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|2844384_2844699_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|2844691_2844880_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|2845049_2845415_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_029602968.1|2845407_2845662_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	91.7	6.1e-37
WP_004177208.1|2845633_2845852_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_049257403.1|2845848_2846271_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.2	7.7e-53
WP_009309071.1|2846270_2846465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023304718.1|2846461_2847289_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	9.3e-111
WP_032422926.1|2847393_2847912_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.3	5.0e-94
WP_040244130.1|2847917_2848634_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	97.9	6.8e-126
WP_023313037.1|2848630_2849194_+	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	37.2	2.2e-26
WP_040244128.1|2849190_2849415_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	90.5	3.1e-29
WP_029602963.1|2849411_2849813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023313034.1|2849946_2850207_+	hypothetical protein	NA	A0A1L5C290	Pseudoalteromonas_phage	43.7	1.5e-11
WP_002903398.1|2850817_2850976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004176326.1|2851268_2851784_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.5	4.6e-23
>prophage 6
NZ_CP046381	Klebsiella pneumoniae strain BD_DM_782 chromosome, complete genome	5359736	3176437	3222107	5359736	head,integrase,tail,plate,terminase,tRNA,capsid,portal	Enterobacteria_phage(54.29%)	56	3181661:3181682	3218369:3218390
WP_004179374.1|3176437_3176938_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|3177054_3177501_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901073.1|3177484_3178276_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004148041.1|3178377_3179562_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004179371.1|3179593_3180286_-	CTP synthase	NA	NA	NA	NA	NA
WP_004150778.1|3180431_3180941_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004150779.1|3180927_3181284_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004179368.1|3181273_3181513_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
3181661:3181682	attL	CGCCCCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004213128.1|3181777_3182029_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
WP_020324077.1|3182072_3183212_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	70.5	3.0e-144
WP_020324084.1|3183366_3184539_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.5	1.1e-157
WP_004216461.1|3184538_3185054_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
WP_004131585.1|3185099_3185417_+	hypothetical protein	NA	B9A7B2	Serratia_phage	54.8	1.0e-17
WP_032440702.1|3185416_3185575_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
WP_020324072.1|3185561_3188537_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.6	1.8e-220
WP_032408799.1|3188552_3189044_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.7	2.1e-54
WP_020324073.1|3189288_3190647_+	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	28.7	7.5e-49
WP_020324070.1|3190800_3191898_-|tail	tail fiber protein	tail	G4KKN6	Yersinia_phage	47.8	5.2e-08
WP_020324108.1|3191897_3192110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020806131.1|3192106_3195133_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
WP_020324110.1|3195122_3196046_-|plate	baseplate J-like protein	plate	A0A0A7NPY5	Enterobacteria_phage	44.6	6.9e-54
WP_020324083.1|3196047_3196398_-	lysozyme	NA	A0A0A7NQ90	Enterobacteria_phage	54.8	9.3e-28
WP_009486481.1|3196394_3196982_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.5	6.9e-60
WP_020324118.1|3196978_3197614_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.9	4.6e-57
WP_020324102.1|3197610_3198078_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.8	4.5e-46
WP_124046751.1|3198078_3198342_-	peptidase	NA	B6SD31	Bacteriophage	34.5	3.7e-05
WP_020324086.1|3198259_3198589_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_020324098.1|3198600_3199146_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	44.1	9.7e-32
WP_020324103.1|3199142_3199427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004131559.1|3199417_3199618_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
WP_020324071.1|3199617_3200133_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	49.4	3.1e-40
WP_020324091.1|3200237_3201104_-|terminase	phage small terminase subunit	terminase	A0A0A7NPX9	Enterobacteria_phage	57.3	8.4e-70
WP_020324085.1|3201153_3202188_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	8.1e-96
WP_020324109.1|3202198_3203038_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.9	1.6e-94
WP_020324092.1|3203194_3204922_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	68.1	6.9e-233
WP_044816202.1|3204915_3205977_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.4	1.0e-141
WP_020806129.1|3207518_3207671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020324074.1|3208126_3209134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020324106.1|3209126_3211073_-	DUF3696 domain-containing protein	NA	Q2P9X8	Enterobacteria_phage	39.6	3.4e-18
WP_020324090.1|3211330_3213478_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	63.6	2.4e-243
WP_020324116.1|3213515_3214451_-	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	55.9	1.9e-83
WP_032408797.1|3214683_3215250_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	9.5e-14
WP_020324115.1|3215246_3215471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020324111.1|3215548_3215812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020324119.1|3215827_3216205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004216643.1|3216220_3216439_-	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
WP_020806130.1|3216459_3216738_-	regulatory protein Cox	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
WP_004213095.1|3216858_3217158_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	6.5e-38
WP_004216842.1|3217273_3218257_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	80.1	6.4e-151
WP_004176549.1|3218521_3219535_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
3218369:3218390	attR	CGCCCCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004150782.1|3219592_3219694_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004213093.1|3219693_3219768_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|3219885_3220011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190891.1|3220070_3220334_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_020324076.1|3220464_3221103_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_008807690.1|3221192_3222107_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.0	3.2e-72
>prophage 7
NZ_CP046381	Klebsiella pneumoniae strain BD_DM_782 chromosome, complete genome	5359736	3501266	3510729	5359736	tRNA,protease	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_020323882.1|3501266_3502988_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	2.0e-14
WP_002898014.1|3503032_3503734_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3504087_3504306_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3504425_3506705_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3506735_3507053_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3507378_3507600_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3507676_3509617_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3509613_3510729_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 8
NZ_CP046381	Klebsiella pneumoniae strain BD_DM_782 chromosome, complete genome	5359736	3974765	4021304	5359736	terminase,tRNA,head,integrase	Enterobacteria_phage(24.14%)	70	3970700:3970745	4018376:4018421
3970700:3970745	attL	ATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_077267857.1|3974765_3975809_-	hypothetical protein	NA	A0A077KC23	Edwardsiella_phage	41.5	4.4e-17
WP_004196823.1|3975810_3976398_-	DUF2612 domain-containing protein	NA	A0A077K9U8	Edwardsiella_phage	43.4	3.8e-34
WP_156246482.1|3976390_3977623_-	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	51.2	1.8e-105
WP_001518114.1|3977630_3977987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064143289.1|3978049_3978337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086059675.1|3978434_3979463_-	hypothetical protein	NA	A0A0P0ZBT0	Stx2-converting_phage	69.8	8.9e-87
WP_064484068.1|3979479_3979647_-	Arc family DNA-binding protein	NA	G9L6D7	Escherichia_phage	69.8	7.3e-15
WP_077266083.1|3979772_3980126_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_064143291.1|3980139_3980928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064143292.1|3980927_3981515_-	hypothetical protein	NA	A0A077KAY0	Edwardsiella_phage	37.2	6.6e-26
WP_047671872.1|3981504_3982374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019725008.1|3982370_3982676_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	48.5	3.6e-20
WP_029497460.1|3982677_3983517_-	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	32.9	4.5e-28
WP_156246484.1|3983520_3985533_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	57.1	2.3e-38
WP_047671971.1|3985734_3986211_-	hypothetical protein	NA	A0A068CGG2	Acinetobacter_phage	30.5	8.5e-08
WP_088607471.1|3986263_3986518_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	76.2	1.4e-20
WP_043875683.1|3986520_3987276_-	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.8	2.8e-61
WP_023304864.1|3987456_3987900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103113570.1|3987899_3989381_-	DUF3383 domain-containing protein	NA	Q2NPD0	Xanthomonas_phage	34.6	2.3e-59
WP_103113571.1|3989384_3989936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048279608.1|3989917_3990286_-	hypothetical protein	NA	Q6UJ26	Burkholderia_virus	29.8	9.5e-07
WP_064190368.1|3990282_3990846_-	hypothetical protein	NA	H9C0W2	Aeromonas_phage	33.3	3.0e-20
WP_040218276.1|3990848_3991292_-	DUF4054 domain-containing protein	NA	E2GLV0	Acinetobacter_phage	41.7	1.3e-13
WP_040218278.1|3991291_3991618_-	hypothetical protein	NA	H9C0V9	Aeromonas_phage	41.6	4.8e-10
WP_009308036.1|3991619_3992657_-	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	50.3	6.5e-85
WP_040218280.1|3992656_3993139_-	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	49.7	1.7e-32
WP_087749015.1|3993140_3994310_-	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.3	5.8e-58
WP_103113572.1|3994313_3995012_-|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	50.0	5.4e-59
WP_117054210.1|3995064_3996585_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	45.4	5.2e-107
WP_088607467.1|3996585_3998262_-|terminase	phage terminase large subunit	terminase	H9C191	Pectobacterium_phage	74.3	3.9e-249
WP_019725076.1|3998263_3998749_-	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	79.5	4.1e-66
WP_086625994.1|3998780_3999416_-	hypothetical protein	NA	I6S676	Salmonella_phage	81.6	9.4e-103
WP_107326673.1|3999874_4000264_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	50.0	1.6e-25
WP_080876462.1|4000260_4000764_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	79.0	1.3e-75
WP_029884058.1|4000766_4001081_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	4.9e-44
WP_086625988.1|4001712_4002402_-	antiterminator	NA	I6PDF8	Cronobacter_phage	56.2	4.2e-64
WP_086625986.1|4002398_4002539_-	YlcG family protein	NA	NA	NA	NA	NA
WP_064147578.1|4002535_4002760_-	hypothetical protein	NA	Q76H69	Enterobacteria_phage	60.3	1.7e-22
WP_086625984.1|4002756_4003338_-	protein NinG	NA	E7C9S3	Salmonella_phage	50.2	4.9e-42
WP_086625982.1|4003330_4003501_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	75.0	1.5e-15
WP_004884220.1|4003500_4003956_-	dLP12 prophage	NA	K7P7B8	Enterobacteria_phage	69.5	1.0e-55
WP_032418538.1|4004215_4004455_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	51.7	8.6e-09
WP_080831306.1|4004447_4004753_-	hypothetical protein	NA	K7PJS3	Enterobacterial_phage	61.0	1.4e-27
WP_116431168.1|4004749_4005136_-	hypothetical protein	NA	V5UT79	Shigella_phage	38.0	5.6e-10
WP_117054208.1|4005308_4006085_-	ead/Ea22-like family protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	50.6	5.1e-34
WP_086625976.1|4006081_4006576_-	hypothetical protein	NA	A0A2H4J4Q4	uncultured_Caudovirales_phage	58.5	1.1e-45
WP_088607465.1|4006572_4007109_-	hypothetical protein	NA	Q5G8U6	Enterobacteria_phage	49.7	7.1e-27
WP_004151295.1|4007105_4007399_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_040182092.1|4007395_4008244_-	AAA family ATPase	NA	K7PLU3	Enterobacteria_phage	60.8	1.2e-89
WP_156246486.1|4008240_4009101_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	6.0e-60
WP_001548453.1|4009186_4009408_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201115.1|4009448_4009676_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_047671980.1|4009787_4010486_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	6.2e-108
WP_012542633.1|4010631_4011036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032717012.1|4011739_4011934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064162984.1|4012021_4013023_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	90.4	4.2e-65
WP_048986756.1|4013030_4013315_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_117054207.1|4013330_4014176_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	60.3	4.5e-68
WP_064162982.1|4014172_4014853_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	92.0	7.4e-122
WP_072056946.1|4014849_4015008_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	58.8	1.9e-09
WP_064162981.1|4015004_4015532_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.6	3.8e-57
WP_064162980.1|4015528_4016299_+	hypothetical protein	NA	D5LH17	Escherichia_phage	52.8	9.4e-65
WP_064162979.1|4016295_4016514_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	45.6	1.7e-08
WP_064162978.1|4016566_4016734_+	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	56.9	2.7e-09
WP_040186416.1|4016733_4016973_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	43.6	4.6e-10
WP_004223135.1|4016985_4017321_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_065807573.1|4017197_4018361_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.1	2.9e-203
WP_004143017.1|4018792_4019659_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
4018376:4018421	attR	ATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004143016.1|4019660_4019873_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|4019918_4021304_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 1
NZ_CP046384	Klebsiella pneumoniae strain BD_DM_782 plasmid pKP782, complete sequence	113102	11258	64601	113102	transposase,integrase	Enterobacteria_phage(25.0%)	52	NA	NA
WP_004152342.1|11258_12527_+|transposase	ISL3-like element ISKpn25 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
WP_004152341.1|12646_13120_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_011977773.1|13211_13442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152340.1|14333_15116_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	4.6e-51
WP_004152339.1|15115_15448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152338.1|15454_15811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152337.1|15878_16208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152336.1|16235_16544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153649.1|16589_16796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032445670.1|17429_18011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032445668.1|18171_19200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032445676.1|19493_20174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048991035.1|20645_21569_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.4	7.3e-173
WP_032445709.1|22035_22545_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_118842309.1|22789_23680_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_114699275.1|23786_25484_-	phosphoethanolamine--lipid A transferase MCR-8.1	NA	NA	NA	NA	NA
WP_072310977.1|25583_26279_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.0	1.7e-25
WP_072310978.1|26300_27530_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_118842310.1|27643_28033_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_152650732.1|28480_29380_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_072310981.1|29577_29787_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_072310982.1|29788_30322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072310983.1|30345_30702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077271821.1|30721_31747_-	serine hydrolase	NA	NA	NA	NA	NA
WP_072310988.1|31821_32628_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_072310984.1|33225_33696_+	DNA gyrase inhibitor	NA	NA	NA	NA	NA
WP_117252078.1|33982_35356_-	serine hydrolase	NA	V5R9Q0	Mycobacterium_phage	24.1	5.9e-09
WP_001567368.1|35785_37189_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|37217_37850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019725650.1|38269_38593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019725651.1|38665_39661_-	hypothetical protein	NA	A0A2H4UVR4	Bodo_saltans_virus	34.9	2.1e-32
WP_015065500.1|39957_40608_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.6	1.8e-77
WP_001695382.1|40654_40996_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	50.0	3.4e-19
WP_001067855.1|41108_41813_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_011977766.1|42833_43169_-	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
WP_001568067.1|43341_43623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000176305.1|43676_44288_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001445937.1|44472_45429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|45809_46514_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000427619.1|48112_49117_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000954592.1|49298_49475_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001043260.1|49804_50620_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001082319.1|50680_51484_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|51483_52320_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001120891.1|52291_52831_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|53040_53901_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|54083_54641_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000239590.1|57498_58374_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|58420_58753_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_004153014.1|62081_62726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101455611.1|62775_63372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001118645.1|63677_64601_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.2	1.0e-166
>prophage 1
NZ_CP046382	Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed1, complete sequence	204070	63549	101442	204070	integrase,transposase	Escherichia_phage(35.71%)	28	65345:65404	94258:95081
WP_001067855.1|63549_64254_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|64443_65259_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
65345:65404	attL	AGGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGC	NA	NA	NA	NA
WP_001067855.1|65409_66114_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032492336.1|66456_67686_+	macrolide efflux MFS transporter Mef(B)	NA	A0A1B0RXG2	Streptococcus_phage	39.0	2.1e-74
WP_054377175.1|67831_68695_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_001354008.1|68732_68978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|69446_70238_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_000095725.1|71436_72696_-	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001261740.1|72957_73749_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001456218.1|73837_74680_-	alpha/beta fold putative hydrolase EstX	NA	NA	NA	NA	NA
WP_000845048.1|74846_75860_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|76062_76413_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001161490.1|76588_77149_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_156246508.1|81185_81692_+	MFS transporter	NA	NA	NA	NA	NA
WP_156246509.1|82414_83299_-	EamA family transporter	NA	NA	NA	NA	NA
WP_015065551.1|86470_87484_-	replication protein	NA	NA	NA	NA	NA
WP_022631532.1|87476_88028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014386216.1|88020_88098_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_022631531.1|88309_88579_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_015065550.1|88714_89266_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	31.7	1.8e-17
WP_015065549.1|89369_89678_-	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	40.4	1.7e-17
WP_001067855.1|94322_95027_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002063889.1|96220_96763_-	AAA family ATPase	NA	NA	NA	NA	NA
94258:95081	attR	AGGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCAA	NA	NA	NA	NA
WP_000557452.1|96775_97636_-	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
WP_001067855.1|97742_98447_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001334766.1|99078_99909_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|100039_100594_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|100737_101442_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
NZ_CP046382	Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed1, complete sequence	204070	115037	123023	204070	integrase,transposase	Escherichia_phage(42.86%)	8	113059:113074	123623:123638
113059:113074	attL	TTACCTCTGTTTCCGG	NA	NA	NA	NA
WP_001067855.1|115037_115742_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845048.1|116187_117201_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|117356_117830_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001144737.1|118050_118317_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_001389365.1|118459_119224_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004098817.1|119484_120699_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001288432.1|120732_122166_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_001067855.1|122318_123023_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
123623:123638	attR	TTACCTCTGTTTCCGG	NA	NA	NA	NA
>prophage 1
NZ_CP046383	Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed2, complete sequence	150248	0	71755	150248	tail,terminase,integrase	Salmonella_phage(87.72%)	64	8374:8390	43591:43607
WP_021313779.1|0_1098_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	49.7	2.1e-73
WP_014342074.1|1549_1762_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	80.0	4.3e-28
WP_021313780.1|1761_2097_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	66.7	1.0e-36
WP_040205269.1|2805_3882_-	recombinase	NA	J9Q736	Salmonella_phage	96.1	8.5e-197
WP_019704549.1|3884_4151_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	84.1	1.7e-34
WP_023279491.1|4150_5095_-	hypothetical protein	NA	J9Q7S6	Salmonella_phage	93.0	3.1e-171
WP_023279490.1|5155_6163_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	87.6	2.3e-143
WP_023279489.1|6282_6714_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	90.9	3.1e-65
WP_023279488.1|7063_7279_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	80.0	4.5e-25
WP_032414135.1|7431_7875_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	82.3	2.2e-58
WP_023279486.1|7871_11390_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	93.3	0.0e+00
8374:8390	attL	GCCATGCGAGTCATCAG	NA	NA	NA	NA
WP_019704545.1|11570_12803_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	86.6	1.3e-212
WP_023279485.1|12899_15179_-	hypothetical protein	NA	J9Q7G6	Salmonella_phage	61.9	1.0e-244
WP_014342091.1|15781_16162_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_032414134.1|16156_17257_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	30.0	9.4e-18
WP_052951219.1|17607_17967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117286227.1|18031_18442_-	toxin YafO	NA	NA	NA	NA	NA
WP_156246515.1|18451_19069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026005930.1|19163_19409_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	47.4	5.3e-14
WP_114267418.1|19538_20384_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	65.8	8.4e-91
WP_156246517.1|20531_22070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019704538.1|22996_23413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023279477.1|23560_23776_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	78.6	8.5e-24
WP_101972435.1|23878_25201_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	86.1	1.8e-228
WP_094818860.1|25200_25668_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	64.1	1.3e-48
WP_156246519.1|25747_26536_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	50.4	2.9e-69
WP_032443551.1|28039_29158_-	hypothetical protein	NA	J9Q720	Salmonella_phage	91.3	1.4e-202
WP_032440528.1|29311_30652_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	96.0	5.4e-241
WP_023279420.1|30716_31442_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	88.8	2.5e-128
WP_156246521.1|31615_33334_-	hypothetical protein	NA	X2KLG0	Campylobacter_phage	28.4	1.4e-12
WP_004110193.1|33375_33738_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.2e-43
WP_021313115.1|33737_34403_-	P-loop NTPase	NA	J9Q7R7	Salmonella_phage	83.7	2.9e-102
WP_023279422.1|34722_35280_+	hypothetical protein	NA	A0A2H4J5U3	uncultured_Caudovirales_phage	43.2	4.0e-33
WP_023279424.1|35476_35728_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	72.3	7.6e-24
WP_023279425.1|35730_36423_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	89.1	9.2e-120
WP_004109805.1|36436_36760_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	95.3	2.3e-49
WP_044531948.1|36850_38296_-|tail	tail fiber domain-containing protein	tail	A0A0H4TGH1	Klebsiella_phage	38.6	1.0e-40
WP_023279427.1|38418_50520_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	60.7	3.1e-29
43591:43607	attR	GCCATGCGAGTCATCAG	NA	NA	NA	NA
WP_019704527.1|50536_51148_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	72.1	1.1e-76
WP_004109817.1|51135_51933_-|tail	tail protein	tail	J9Q7R4	Salmonella_phage	85.3	5.4e-140
WP_004109820.1|51925_52624_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	87.4	1.2e-122
WP_004109823.1|52710_53046_-|tail	tail protein	tail	J9Q6E1	Salmonella_phage	84.5	3.4e-51
WP_023279429.1|53089_57625_-	tape measure protein	NA	J9Q712	Salmonella_phage	70.0	0.0e+00
WP_004109830.1|57632_57866_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	93.5	3.4e-34
WP_004109835.1|57982_58300_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	93.3	1.8e-46
WP_023279430.1|58361_59108_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	82.6	8.1e-106
WP_023279431.1|59175_59568_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	68.3	5.9e-47
WP_021313126.1|59569_60043_-	hypothetical protein	NA	J9Q711	Salmonella_phage	93.6	1.9e-76
WP_004109848.1|60033_60378_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	92.1	7.4e-54
WP_023279432.1|60475_61309_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	83.4	2.4e-130
WP_023279433.1|61308_61743_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	84.0	2.9e-63
WP_023279434.1|61790_62219_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	70.6	1.8e-28
WP_004109857.1|62297_63176_-	hypothetical protein	NA	J9Q710	Salmonella_phage	94.2	4.7e-153
WP_023279435.1|63202_64102_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	82.6	6.1e-124
WP_094307870.1|64124_65714_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	88.7	1.8e-275
WP_004109863.1|65731_66988_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	97.4	9.4e-248
WP_004109866.1|66990_67632_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	88.2	5.0e-96
WP_004109869.1|67807_68074_-	hypothetical protein	NA	J9Q757	Salmonella_phage	90.9	1.3e-37
WP_004109872.1|68083_68974_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	97.0	5.4e-165
WP_023279436.1|68970_69522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023279437.1|69511_70153_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	97.2	2.3e-109
WP_023279438.1|70149_70818_-	hypothetical protein	NA	J9Q6L1	Salmonella_phage	91.9	6.6e-107
WP_032414131.1|70817_71498_-	chromosome partitioning protein ParB	NA	J9Q756	Salmonella_phage	89.3	1.0e-107
WP_156246523.1|71581_71755_+	hypothetical protein	NA	J9Q7I4	Salmonella_phage	86.8	5.6e-18
>prophage 2
NZ_CP046383	Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed2, complete sequence	150248	76009	118364	150248	holin,protease,terminase,portal,tail,capsid,head	Klebsiella_phage(58.93%)	66	NA	NA
WP_156246528.1|76009_77527_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	43.7	2.7e-71
WP_156246530.1|78098_81167_-	kinase	NA	A0A286S259	Klebsiella_phage	97.9	0.0e+00
WP_040244194.1|81163_81544_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	97.6	9.6e-71
WP_156246532.1|81553_82036_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	96.2	2.8e-83
WP_156246533.1|82022_82502_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.1	1.5e-92
WP_156246534.1|82501_84949_-|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	66.3	5.9e-278
WP_064153924.1|84993_85461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004143895.1|85526_85790_-	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	98.8	5.9e-43
WP_001177591.1|85822_86176_-|tail	phage tail assembly protein	tail	A0A286S1N4	Klebsiella_phage	99.1	4.9e-61
WP_000115125.1|86219_86711_-	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	100.0	2.3e-88
WP_064153923.1|86767_87133_-	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	93.4	7.8e-62
WP_064153922.1|87129_87669_-	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	95.5	1.1e-91
WP_004184710.1|87661_87994_-|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	100.0	3.1e-57
WP_004143899.1|87995_88193_-	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	100.0	1.7e-26
WP_017880223.1|88253_88580_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	100.0	7.5e-56
WP_044067369.1|88527_88770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042346268.1|88806_89970_-|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	99.0	1.5e-210
WP_004216821.1|89981_90662_-|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	100.0	1.6e-124
WP_017880221.1|90667_91945_-|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	100.0	6.2e-247
WP_104456236.1|91947_93480_-|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	99.8	5.1e-296
WP_004143905.1|93489_93924_-	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	100.0	6.2e-74
WP_032447782.1|94045_94255_-	hypothetical protein	NA	A0A286N2R4	Klebsiella_phage	82.6	1.4e-23
WP_047663025.1|94267_94558_-	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	96.9	2.0e-52
WP_064153921.1|94626_95181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064153920.1|95250_95496_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	92.6	9.7e-32
WP_064279261.1|95600_95885_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	70.2	5.8e-28
WP_064153918.1|95881_96076_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	81.2	1.9e-22
WP_031591484.1|96026_96302_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	44.4	4.7e-11
WP_023304728.1|96309_96939_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	90.9	6.9e-106
WP_019705280.1|96938_97220_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
WP_017145563.1|97206_97602_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
WP_031280381.1|98164_98611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004184721.1|98516_98774_-	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	100.0	1.3e-42
WP_032439906.1|98927_99710_-	molecular chaperone	NA	F1C595	Cronobacter_phage	77.1	2.7e-112
WP_032439905.1|99706_100183_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	99.4	3.1e-90
WP_049245617.1|100179_101142_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	99.1	8.1e-183
WP_074192665.1|101143_102802_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.4	0.0e+00
WP_049245616.1|103520_103754_-	transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	63.9	2.2e-17
WP_023304723.1|103894_104569_+	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	78.6	8.7e-99
WP_023304722.1|104732_105146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032442236.1|105328_105553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023304721.1|105553_105919_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	97.5	5.8e-57
WP_029602968.1|105911_106166_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	91.7	6.1e-37
WP_004177208.1|106137_106356_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_049257403.1|106352_106775_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.2	7.7e-53
WP_009309071.1|106774_106969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023304718.1|106965_107793_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	9.3e-111
WP_032422926.1|107897_108416_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.3	5.0e-94
WP_040244130.1|108421_109138_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	97.9	6.8e-126
WP_023313037.1|109134_109698_+	hypothetical protein	NA	A0A2I7QNC9	Vibrio_phage	24.9	1.2e-08
WP_040244128.1|109694_109919_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	90.5	3.1e-29
WP_029602963.1|109915_110317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023313034.1|110450_110711_+	hypothetical protein	NA	S5MQM5	Escherichia_phage	51.8	4.2e-17
WP_156246536.1|110836_112267_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.9	2.2e-256
WP_004109887.1|112269_112545_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	68.1	3.1e-26
WP_004109889.1|112595_113033_-	hypothetical protein	NA	A0A1V0E8D6	Vibrio_phage	37.0	9.5e-14
WP_014342147.1|113188_113719_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	84.5	3.5e-71
WP_123827665.1|113728_114028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004109892.1|114352_115003_+	hypothetical protein	NA	J9Q754	Salmonella_phage	91.7	8.4e-107
WP_004109904.1|115053_115257_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	95.5	4.1e-28
WP_023279442.1|115849_116332_-	hypothetical protein	NA	J9Q805	Salmonella_phage	70.0	3.8e-64
WP_021313141.1|116537_116819_-	ABC transporter	NA	J9Q753	Salmonella_phage	84.9	2.4e-42
WP_004109918.1|116945_117353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023279444.1|117472_117784_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	67.0	2.3e-30
WP_023279445.1|117920_118133_-	hypothetical protein	NA	J9Q804	Salmonella_phage	77.9	4.4e-25
WP_023279446.1|118145_118364_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	80.6	1.1e-26
>prophage 3
NZ_CP046383	Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed2, complete sequence	150248	122309	149927	150248		Salmonella_phage(81.48%)	28	NA	NA
WP_023279448.1|122309_123866_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.5	2.5e-104
WP_032414129.1|123862_125038_+	restriction endonuclease subunit S	NA	E3T4D5	Cafeteria_roenbergensis_virus	33.3	3.7e-12
WP_032414139.1|125051_126371_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_023279511.1|126363_129477_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	23.7	9.2e-26
WP_021313148.1|129538_129754_-	hypothetical protein	NA	J9Q747	Salmonella_phage	69.8	1.2e-14
WP_023279510.1|129882_130461_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	56.5	1.1e-54
WP_014342167.1|130588_130744_-	hypothetical protein	NA	H6WZJ7	Escherichia_phage	61.2	1.7e-05
WP_019704567.1|130743_131169_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	80.9	9.8e-56
WP_023279509.1|131469_132009_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	47.1	5.8e-29
WP_077255474.1|132105_132753_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	80.1	6.4e-91
WP_023279508.1|133325_133559_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.0	7.8e-31
WP_023279507.1|133756_134350_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	85.3	5.9e-99
WP_023279506.1|134534_135368_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	56.4	5.1e-64
WP_023279505.1|135493_136051_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	84.2	1.4e-86
WP_023279504.1|136060_136480_-	hypothetical protein	NA	J9Q743	Salmonella_phage	74.1	6.5e-52
WP_023279503.1|136543_137188_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	77.6	4.7e-94
WP_023279502.1|137187_137664_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	79.6	4.9e-72
WP_023279501.1|137660_138074_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	77.4	4.7e-55
WP_023279500.1|138075_139179_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	80.1	6.7e-181
WP_023279499.1|139372_140248_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	J9Q742	Salmonella_phage	85.1	1.2e-140
WP_014342181.1|140325_141468_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	95.8	9.0e-213
WP_023279498.1|141598_143902_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	90.9	0.0e+00
WP_021313773.1|143977_144547_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	89.9	1.1e-94
WP_023279497.1|144556_145303_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	61.7	2.9e-79
WP_032440510.1|145292_147209_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	84.5	2.1e-299
WP_021313776.1|147438_148524_-	exonuclease	NA	J9Q7S9	Salmonella_phage	84.8	1.1e-183
WP_021313777.1|148712_149207_-	GNAT family N-acetyltransferase	NA	J9Q6J3	Salmonella_phage	67.1	1.0e-59
WP_023279495.1|149282_149927_-	hypothetical protein	NA	J9Q739	Salmonella_phage	80.7	2.2e-99
