The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046374	Flavobacterium psychrophilum strain FPCH6, complete genome	2836981	1024082	1032201	2836981		Streptococcus_phage(16.67%)	6	NA	NA
WP_094141310.1|1024082_1026524_+	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	31.3	2.1e-17
WP_011963429.1|1026527_1027508_+	SDR family oxidoreductase	NA	A0A2K9L0I7	Tupanvirus	50.9	2.7e-85
WP_011963428.1|1027518_1028790_+	nucleotide sugar dehydrogenase	NA	A7IWZ0	Paramecium_bursaria_Chlorella_virus	26.4	6.2e-21
WP_011963427.1|1028821_1030198_+	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	31.6	4.7e-59
WP_011963426.1|1030204_1031251_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	50.5	1.3e-85
WP_011963425.1|1031319_1032201_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	60.8	6.0e-100
>prophage 2
NZ_CP046374	Flavobacterium psychrophilum strain FPCH6, complete genome	2836981	2027946	2076410	2836981	transposase,protease,integrase	Bacillus_phage(66.67%)	30	2056494:2056515	2082007:2082028
WP_051907069.1|2027946_2028273_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_117386929.1|2028305_2028575_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_011963053.1|2028738_2030046_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_011963052.1|2030042_2031503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011963636.1|2039139_2039829_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.9	4.1e-27
WP_011963637.1|2040490_2044555_+	type II CRISPR RNA-guided endonuclease Cas9	NA	NA	NA	NA	NA
WP_011963638.1|2044863_2045760_+	type II CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_011963639.1|2045752_2046100_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_016361983.1|2048832_2049144_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_117601869.1|2049152_2050040_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	24.6	1.8e-14
WP_011963640.1|2050054_2050894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011963641.1|2050897_2054137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011963642.1|2054133_2054781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011963643.1|2054750_2056091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011963644.1|2056109_2058104_-	hypothetical protein	NA	NA	NA	NA	NA
2056494:2056515	attL	AATATTTTCTTTTGGAATATCT	NA	NA	NA	NA
WP_011963645.1|2058105_2059266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011963646.1|2059267_2061454_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_011963647.1|2061466_2062324_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_011963648.1|2062323_2063124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011963649.1|2063307_2066577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011963650.1|2067349_2067976_-	ATPase	NA	NA	NA	NA	NA
WP_011963651.1|2068061_2068922_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_011963652.1|2068929_2069217_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011963653.1|2069328_2070177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011963654.1|2070638_2071862_-	MFS transporter	NA	NA	NA	NA	NA
WP_011963655.1|2071879_2072047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011963656.1|2072058_2073216_-	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_011963657.1|2073313_2074279_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011963658.1|2074285_2075125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016362010.1|2075165_2076410_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	34.1	9.3e-38
2082007:2082028	attR	AATATTTTCTTTTGGAATATCT	NA	NA	NA	NA
>prophage 3
NZ_CP046374	Flavobacterium psychrophilum strain FPCH6, complete genome	2836981	2697023	2765113	2836981	tRNA,transposase,integrase	Bacillus_phage(20.0%)	48	2692046:2692063	2762003:2762020
2692046:2692063	attL	TAAATGAAAATGATATTG	NA	NA	NA	NA
WP_016361985.1|2697023_2697917_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_011964220.1|2698529_2705768_-	cell surface protein SprA	NA	NA	NA	NA	NA
WP_011964221.1|2705771_2706353_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_011964222.1|2706426_2708742_-	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_011964223.1|2708805_2709732_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_011964224.1|2709802_2710825_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	23.8	3.7e-08
WP_011964225.1|2711033_2712479_+	amino acid permease	NA	NA	NA	NA	NA
WP_011964226.1|2712619_2714863_-	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_011964227.1|2714921_2715425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011964228.1|2715438_2716158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011964229.1|2716274_2716982_+	dipeptidase PepE	NA	NA	NA	NA	NA
WP_011964230.1|2717371_2717803_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011964231.1|2717812_2719513_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_011964232.1|2719501_2720212_-	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_038503360.1|2720452_2721970_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_011964234.1|2722326_2723370_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	35.6	1.3e-32
WP_094167886.1|2724468_2725233_+	Eco47II family restriction endonuclease	NA	NA	NA	NA	NA
WP_094167885.1|2725208_2726447_-	DNA (cytosine-5-)-methyltransferase	NA	F2Y148	Organic_Lake_phycodnavirus	45.6	3.6e-82
WP_034100201.1|2729345_2730581_+	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_011964235.1|2731711_2733976_+	N-6 DNA methylase	NA	A0A2H4JBT5	uncultured_Caudovirales_phage	26.0	3.3e-33
WP_011964245.1|2734123_2734351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011964246.1|2734604_2735501_+	type II restriction endonuclease	NA	NA	NA	NA	NA
WP_011964247.1|2735487_2736495_+	DNA cytosine methyltransferase	NA	Q6DMX0	Streptococcus_phage	62.7	5.3e-108
WP_011964248.1|2737528_2738254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034100474.1|2739472_2739937_+	SocA family protein	NA	I6R0L8	Salmonella_phage	37.9	6.3e-16
WP_123640105.1|2740031_2740307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038509097.1|2740633_2742415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094141337.1|2742607_2742946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034100177.1|2742938_2743283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034100176.1|2743423_2743933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034100174.1|2744289_2744550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034100172.1|2744756_2744975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123952866.1|2745208_2746462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034100168.1|2747541_2748510_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_155273284.1|2748857_2748998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034100164.1|2748987_2749188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016361990.1|2750236_2751439_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	6.9e-46
WP_011964249.1|2751733_2752480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011964250.1|2753308_2754076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011964251.1|2754497_2755088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011964252.1|2755100_2755775_-	DUF2931 family protein	NA	NA	NA	NA	NA
WP_011964253.1|2756039_2756501_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_011964254.1|2756841_2757150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011964255.1|2757151_2757625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016361987.1|2758498_2759701_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	6.9e-46
WP_011964256.1|2759887_2761045_-	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	28.0	1.5e-13
WP_016361983.1|2763905_2764217_+|transposase	transposase	transposase	NA	NA	NA	NA
2762003:2762020	attR	CAATATCATTTTCATTTA	NA	NA	NA	NA
WP_117601869.1|2764225_2765113_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	24.6	1.8e-14
