The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046378	Shewanella algae strain RQs-106 chromosome, complete genome	4990025	1663456	1674393	4990025	tRNA	uncultured_Mediterranean_phage(33.33%)	8	NA	NA
WP_096142738.1|1663456_1664203_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.8	8.5e-71
WP_028781519.1|1664199_1664835_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.2	7.6e-36
WP_062793901.1|1664889_1665801_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_025889143.1|1665879_1666836_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	36.3	3.1e-33
WP_144165928.1|1666922_1669490_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	23.3	2.1e-31
WP_025011663.1|1669797_1670862_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.6	3.4e-113
WP_156019239.1|1670873_1671305_+	recombinase RecX	NA	NA	NA	NA	NA
WP_156019241.1|1671768_1674393_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.2	9.3e-80
>prophage 2
NZ_CP046378	Shewanella algae strain RQs-106 chromosome, complete genome	4990025	1803846	1813847	4990025		Faustovirus(14.29%)	10	NA	NA
WP_025011490.1|1803846_1805061_+	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	32.6	1.8e-33
WP_025011491.1|1805093_1805477_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.4	5.4e-53
WP_025011492.1|1805491_1805815_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	43.0	1.2e-21
WP_025011493.1|1805838_1806363_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_144190712.1|1806446_1808309_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	40.0	3.8e-104
WP_025011494.1|1808317_1808653_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_156019315.1|1808785_1809685_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	33.3	9.4e-40
WP_025011496.1|1809766_1809964_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_025011497.1|1810357_1810789_+	nucleoside-diphosphate kinase	NA	L7Y4C4	Megavirus	40.2	4.8e-18
WP_045282650.1|1811177_1813847_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	29.7	7.0e-83
>prophage 3
NZ_CP046378	Shewanella algae strain RQs-106 chromosome, complete genome	4990025	3491349	3498667	4990025		Staphylococcus_phage(50.0%)	7	NA	NA
WP_025009431.1|3491349_3491826_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.3	1.1e-31
WP_156020017.1|3491945_3493052_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	38.1	2.3e-64
WP_156020018.1|3493133_3493790_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	33.7	8.7e-27
WP_109248318.1|3493790_3494915_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.2	3.1e-48
WP_025009434.1|3494955_3495408_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_025009435.1|3495517_3496771_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.1	3.2e-102
WP_156020019.1|3496999_3498667_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	28.6	1.7e-39
>prophage 4
NZ_CP046378	Shewanella algae strain RQs-106 chromosome, complete genome	4990025	4698315	4732140	4990025	capsid,tail,portal,terminase,integrase,head	Aeromonas_virus(32.14%)	42	4699480:4699500	4733607:4733627
WP_025012047.1|4698315_4698867_-	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	28.9	3.3e-11
WP_025012048.1|4698875_4699256_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
4699480:4699500	attL	AAAAAAGGAAGCCGAAGCTTC	NA	NA	NA	NA
WP_156020506.1|4699664_4700624_-|integrase	tyrosine-type recombinase/integrase	integrase	U5N0A8	Enterobacteria_phage	47.2	1.2e-80
WP_156020508.1|4700620_4701106_-	hypothetical protein	NA	G8GWB1	Rhodobacter_phage	29.3	1.2e-09
WP_045284056.1|4701311_4701947_-	helix-turn-helix transcriptional regulator	NA	A5X9F5	Aeromonas_virus	31.0	5.3e-21
WP_082052809.1|4702155_4702383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045284057.1|4702379_4702625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156020509.1|4702807_4703029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146509270.1|4703083_4703326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156020511.1|4703337_4703946_+	3'-5' exonuclease	NA	A0A1D9C9N8	Salinivibrio_phage	47.5	2.2e-37
WP_156020513.1|4703942_4704119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156020515.1|4704111_4706472_+	replication endonuclease	NA	A0A2P1CKY6	Pseudoalteromonas_phage	43.3	1.6e-78
WP_144128823.1|4706446_4706707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045284062.1|4706697_4706949_+	hypothetical protein	NA	R9TNQ2	Vibrio_phage	39.8	2.3e-12
WP_156020517.1|4707026_4707194_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_156020519.1|4707162_4708212_+	site-specific DNA-methyltransferase	NA	Q6UAT0	Klebsiella_phage	61.0	4.8e-104
WP_156020521.1|4708444_4709515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156020523.1|4709927_4711352_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.8	2.0e-15
WP_054745613.1|4711555_4711918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156020525.1|4711947_4712976_-|portal	phage portal protein	portal	A0A1D9C9P9	Salinivibrio_phage	48.9	9.9e-86
WP_156020527.1|4712960_4714727_-|terminase	terminase	terminase	A0A1L5C295	Pseudoalteromonas_phage	51.6	6.7e-175
WP_156020528.1|4714890_4715820_+	hypothetical protein	NA	A0A077K9W8	Ralstonia_phage	37.9	1.8e-22
WP_156020530.1|4715819_4717007_+|capsid	phage major capsid protein, P2 family	capsid	A0A1D9C9Q5	Salinivibrio_phage	55.5	4.9e-97
WP_156020532.1|4717010_4717685_+|terminase	terminase	terminase	A0A1D9C9Q9	Salinivibrio_phage	36.7	5.8e-34
WP_156020534.1|4717787_4718246_+|head	head protein	head	F1BUL8	Cronobacter_phage	39.0	1.0e-18
WP_156020536.1|4718242_4718746_+	hypothetical protein	NA	U3PIL4	Vibrio_phage	27.7	1.8e-11
WP_156020538.1|4718735_4719386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156020539.1|4719388_4720531_+	DUF2586 family protein	NA	A5X9I0	Aeromonas_virus	51.2	2.8e-97
WP_045284070.1|4720541_4720991_+	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	44.2	9.1e-28
WP_156020541.1|4720990_4721470_+	glycoside hydrolase family protein	NA	H9C148	Vibrio_phage	40.0	4.8e-27
WP_156020544.1|4721459_4721969_+	hypothetical protein	NA	A0A1D9CA16	Salinivibrio_phage	48.4	3.5e-15
WP_045284073.1|4721965_4722253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054745633.1|4722249_4722510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156020546.1|4722542_4722698_+	hypothetical protein	NA	A5X9I8	Aeromonas_virus	53.2	5.2e-07
WP_156020548.1|4722698_4725110_+|tail	phage tail tape measure protein	tail	A0A1L5C2B2	Pseudoalteromonas_phage	26.2	2.1e-33
WP_144438453.1|4725102_4725426_+	DUF2590 family protein	NA	A5X9J0	Aeromonas_virus	51.5	1.1e-19
WP_144438452.1|4725422_4726610_+	hypothetical protein	NA	A5X9J1	Aeromonas_virus	44.6	1.4e-91
WP_045284090.1|4726650_4727184_+	hypothetical protein	NA	A5X9J2	Aeromonas_virus	56.5	5.9e-50
WP_156020550.1|4727180_4729394_+	hypothetical protein	NA	A5X9J3	Aeromonas_virus	42.7	5.9e-51
WP_156020552.1|4729393_4730014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052679020.1|4730063_4730549_+	hypothetical protein	NA	R9TPX7	Vibrio_phage	40.2	1.6e-17
WP_156020554.1|4730562_4732140_+	hypothetical protein	NA	A5X9J8	Aeromonas_virus	34.2	6.4e-76
4733607:4733627	attR	AAAAAAGGAAGCCGAAGCTTC	NA	NA	NA	NA
