The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046311	Lactobacillus crispatus strain FDAARGOS_743 chromosome, complete genome	2373487	3363	55367	2373487	transposase,protease,tRNA	Streptococcus_phage(25.0%)	45	NA	NA
WP_005718623.1|3363_3924_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_060785116.1|3986_5174_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005721518.1|5190_5571_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_005718620.1|5750_6779_+	lactonase family protein	NA	NA	NA	NA	NA
WP_005722622.1|7024_8266_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	3.4e-80
WP_005727342.1|9086_9944_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_060785160.1|10345_12121_-	oleate hydratase	NA	NA	NA	NA	NA
WP_005721520.1|12226_13132_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	31.0	4.0e-06
WP_005718616.1|13124_13928_-	NAD kinase	NA	NA	NA	NA	NA
WP_005718615.1|13924_14557_-	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_005728535.1|14633_15242_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_005718612.1|15328_15946_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_005718609.1|16872_17619_-	adaptor protein MecA	NA	NA	NA	NA	NA
WP_005718608.1|17723_18122_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_005727342.1|18252_19110_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_005727865.1|19318_21052_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_005718606.1|21051_21318_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_005718605.1|21430_21625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005721176.1|22034_23273_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	46.2	5.0e-84
WP_005718604.1|23578_25771_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	40.9	3.0e-124
WP_005728539.1|25916_26198_+	DUF1827 family protein	NA	NA	NA	NA	NA
WP_005722698.1|26261_27833_-	peptide chain release factor 3	NA	A0A2K9L2P9	Tupanvirus	28.3	1.7e-12
WP_005727867.1|27832_28699_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_005727868.1|28801_29263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005722693.1|29263_29746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005722691.1|29754_30567_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_035163382.1|30691_32080_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	D0R096	Streptococcus_phage	31.7	8.7e-61
WP_005721666.1|33452_34823_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_005722686.1|35213_35498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005727873.1|35636_37409_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	38.1	7.4e-89
WP_005727874.1|37328_39692_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_005725311.1|39688_40852_-	thiolase family protein	NA	NA	NA	NA	NA
WP_005727875.1|40969_41872_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	49.2	1.1e-75
WP_005725308.1|41932_42856_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_005725306.1|42864_43692_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_005718584.1|43904_44351_+	flavodoxin	NA	NA	NA	NA	NA
WP_005725304.1|44343_44871_+	GtrA family protein	NA	NA	NA	NA	NA
WP_005727876.1|44995_46366_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_005724265.1|46563_47706_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	29.9	1.2e-26
WP_005724266.1|47811_48000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060785119.1|48192_49521_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_005718576.1|49517_50753_-	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	28.7	3.9e-28
WP_155872453.1|51654_52815_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.7	1.1e-37
WP_005725298.1|52948_54250_+	amino acid permease	NA	NA	NA	NA	NA
WP_043884464.1|54332_55367_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.3	6.3e-40
>prophage 2
NZ_CP046311	Lactobacillus crispatus strain FDAARGOS_743 chromosome, complete genome	2373487	73401	141688	2373487	transposase,tRNA,bacteriocin	unidentified_phage(14.29%)	56	NA	NA
WP_005721528.1|73401_73761_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_005724276.1|73882_74710_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_005718534.1|74803_75529_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005718530.1|75528_76455_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_005724277.1|76536_78546_-	potassium transporter Kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	34.5	1.6e-63
WP_005724278.1|78677_79370_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_005724279.1|79369_80296_-	ribokinase	NA	NA	NA	NA	NA
WP_005728555.1|80385_81189_-	DUF4931 domain-containing protein	NA	NA	NA	NA	NA
WP_005724281.1|81352_82657_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005727876.1|82873_84244_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_005725292.1|84394_85795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005726900.1|85944_86442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005725290.1|86488_87409_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_005724282.1|87484_88138_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005725289.1|88155_88797_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005725286.1|88796_89615_-	transporter substrate-binding domain-containing protein	NA	E3T502	Cafeteria_roenbergensis_virus	28.3	3.6e-06
WP_005725284.1|89626_90367_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.9	1.2e-37
WP_005725279.1|91707_93099_-	MFS transporter	NA	NA	NA	NA	NA
WP_005728559.1|93209_93788_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_005728401.1|93967_95737_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.5	2.1e-51
WP_060785081.1|97457_97874_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005727342.1|97981_98839_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_005720831.1|99060_99879_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005728561.1|99920_100589_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_005720833.1|100750_102082_+	amino acid permease	NA	NA	NA	NA	NA
WP_005725270.1|103625_104429_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005720836.1|104523_105444_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_005720837.1|105531_107154_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	25.4	2.6e-48
WP_005728447.1|107247_108210_-	peptidase M42	NA	NA	NA	NA	NA
WP_043884464.1|108280_109315_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.3	6.3e-40
WP_005725263.1|110375_112136_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	38.1	7.3e-89
WP_005725261.1|112067_113537_-	MFS transporter	NA	NA	NA	NA	NA
WP_005725260.1|113821_114349_+	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_005725259.1|114358_115690_+	uracil transporter	NA	Q9KX94	Enterobacteria_phage	36.7	4.7e-64
WP_005727426.1|116294_117473_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.1	2.0e-37
WP_005728396.1|118348_119206_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_005728568.1|119946_120219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005725256.1|120300_121137_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	37.5	1.9e-47
WP_005720850.1|121300_121771_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005728128.1|121971_123150_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.7	6.7e-38
WP_005725254.1|123337_124522_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_005728570.1|124728_126501_-	oleate hydratase	NA	NA	NA	NA	NA
WP_005725250.1|126606_127119_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005725248.1|127164_128628_-	MFS transporter	NA	NA	NA	NA	NA
WP_005720949.1|129115_129616_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005725246.1|129618_130968_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	48.7	4.4e-118
WP_005725245.1|131051_132086_-	serine hydrolase	NA	NA	NA	NA	NA
WP_043884464.1|132346_133381_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.3	6.3e-40
WP_005725243.1|133803_135177_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_005725241.1|135261_136296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005725239.1|136270_136618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005725237.1|136780_137491_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_005725235.1|137560_138481_-	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	26.2	1.2e-18
WP_005725233.1|138505_139936_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_005725231.1|139940_141380_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_005720935.1|141379_141688_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP046311	Lactobacillus crispatus strain FDAARGOS_743 chromosome, complete genome	2373487	154882	212556	2373487	transposase	Bacillus_virus(16.67%)	52	NA	NA
WP_005725224.1|154882_156034_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	C1KFS0	Lactobacillus_virus	42.4	1.2e-79
WP_005720922.1|156393_157224_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	50.7	4.9e-67
WP_005722468.1|157220_158699_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	45.2	1.4e-109
WP_005725221.1|158785_159877_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_005728574.1|159887_160619_-	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_005720918.1|160745_161132_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	42.2	1.9e-18
WP_005720917.1|161179_161881_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005725216.1|161968_163084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101883408.1|163194_163452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005728577.1|163494_164811_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005725212.1|165304_166672_-	NAD(FAD)-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_005724327.1|166878_167127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005724328.1|167123_167444_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_005720909.1|167594_169070_-	surface layer protein HAP50	NA	NA	NA	NA	NA
WP_005720908.1|169398_170232_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005720907.1|170384_171068_+	ribose-5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_005720906.1|171054_172044_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_005720905.1|172098_173271_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_005720903.1|173343_173685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005720902.1|173684_176372_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	25.4	9.9e-45
WP_005726627.1|177403_178090_-	glycerophosphoryl diester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	31.5	1.8e-14
WP_005720900.1|178136_178796_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_005720899.1|178864_179455_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_005720898.1|179461_180037_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	35.5	3.1e-20
WP_005720897.1|180112_181177_-	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
WP_005720889.1|182165_182396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005720890.1|182442_182643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005720891.1|182785_183658_+	serine/threonine protein phosphatase	NA	A8E2N0	Enterococcus_phage	31.1	7.0e-16
WP_005720892.1|183709_183826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005720894.1|184815_185367_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_005720896.1|185734_186406_+	hypothetical protein	NA	A0A0E3XCL7	Enterococcus_phage	80.6	1.8e-24
WP_005727398.1|186515_187373_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_005727342.1|187510_188368_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_005720887.1|188523_188919_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_005722486.1|188970_189573_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_005720884.1|189713_190121_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_005724368.1|190495_191254_-	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005722489.1|191305_192556_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	32.2	1.3e-36
WP_005720881.1|192779_193157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060464054.1|193188_195420_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_005725205.1|195431_196760_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_005727342.1|197670_198528_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_005725199.1|199773_201432_+	phosphoenolpyruvate carboxykinase (ATP)	NA	NA	NA	NA	NA
WP_005720874.1|201522_203142_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005720873.1|203530_204385_+	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005722491.1|204530_204944_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_005720871.1|205095_205323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005720867.1|206299_207469_-	mannitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_005720866.1|207471_207924_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_005720865.1|207939_209721_-	PTS mannitol transporter subunit IICBA	NA	NA	NA	NA	NA
WP_035458603.1|210674_211949_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A2K9VD29	Lactobacillus_phage	26.2	1.7e-23
WP_005728427.1|211890_212556_-|transposase	IS607 family transposase	transposase	Q331V0	Clostridium_botulinum_C_phage	52.3	1.3e-57
>prophage 4
NZ_CP046311	Lactobacillus crispatus strain FDAARGOS_743 chromosome, complete genome	2373487	231356	278323	2373487	transposase,tRNA	Streptococcus_phage(30.77%)	44	NA	NA
WP_005728108.1|231356_232583_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	49.4	2.3e-97
WP_005721179.1|232848_233556_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	40.2	4.8e-39
WP_005727316.1|234402_235260_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_005729126.1|235652_236687_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_005729124.1|236712_238047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005727317.1|238297_238642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080592495.1|238692_239181_-	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_005723964.1|239329_240637_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.1	2.4e-92
WP_005727319.1|240867_241419_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005722611.1|241418_242024_-	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	38.5	3.3e-33
WP_005727320.1|242181_242976_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005727322.1|242978_243839_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005729119.1|244243_244507_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_005727323.1|244594_245098_-	nucleoside deoxyribosyltransferase	NA	K4I206	Lactobacillus_phage	29.7	8.4e-14
WP_005727324.1|245264_246647_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_081096718.1|246918_248148_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	41.5	8.2e-79
WP_005727326.1|248382_249399_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_005727327.1|249517_250120_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005729117.1|250408_253918_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_005727331.1|253922_254498_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005727333.1|254630_255575_-	serine hydrolase	NA	NA	NA	NA	NA
WP_005726582.1|255590_256508_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_005725684.1|256626_257928_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005725685.1|257981_259277_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_005720697.1|259260_260085_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_005720695.1|260088_260955_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_005726585.1|260954_262043_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	2.9e-27
WP_005725687.1|262298_263726_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_005720689.1|263782_264637_-	DNA nuclease	NA	NA	NA	NA	NA
WP_005725688.1|264646_265603_-	DNA polymerase III subunit epsilon	NA	A0A0N9SJX9	Paenibacillus_phage	30.1	1.2e-08
WP_005727334.1|265618_266440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005720683.1|266441_267089_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_043884380.1|267088_267487_-	DUF3290 family protein	NA	NA	NA	NA	NA
WP_005727335.1|267519_268698_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	26.9	7.7e-34
WP_005727337.1|269021_269762_-	nicotinamide mononucleotide transporter	NA	A0A0A7NTY4	Lactobacillus_phage	86.2	4.0e-121
WP_134791624.1|269788_271033_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.5	1.4e-57
WP_005727340.1|271433_272660_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.4	5.6e-96
WP_005723933.1|273147_273399_+	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_005723932.1|273398_274112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005729109.1|274086_275019_+	choice-of-anchor A family protein	NA	NA	NA	NA	NA
WP_005728483.1|275117_276152_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.6	7.5e-41
WP_005718307.1|276263_276560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005723930.1|276603_277338_-	oxidoreductase	NA	NA	NA	NA	NA
WP_005727398.1|277465_278323_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP046311	Lactobacillus crispatus strain FDAARGOS_743 chromosome, complete genome	2373487	290254	361266	2373487	transposase,protease	Streptococcus_phage(26.67%)	56	NA	NA
WP_005729106.1|290254_291586_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QMQ9	Streptococcus_phage	41.9	9.9e-62
WP_005722622.1|291967_293209_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	3.4e-80
WP_005718288.1|293438_293840_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_005718287.1|293886_294462_-	elongation factor P	NA	NA	NA	NA	NA
WP_005725651.1|294579_295494_-	type I pantothenate kinase	NA	NA	NA	NA	NA
WP_005726951.1|295553_296111_+	arylesterase	NA	NA	NA	NA	NA
WP_005718284.1|296107_296557_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005718283.1|296558_297374_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005722421.1|297377_297998_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.1	1.0e-32
WP_005718280.1|298011_298659_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005727350.1|299092_301399_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005727351.1|301551_302244_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_005718274.1|302304_302955_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	32.1	4.0e-08
WP_005727352.1|303098_304133_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.3	1.3e-40
WP_005718273.1|305661_306933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005727354.1|307073_307760_+	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_005729103.1|307939_310591_+	cation-translocating P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	31.7	1.5e-93
WP_005723897.1|310637_311036_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_005722427.1|311091_311385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005726956.1|311671_312664_-	asparaginase	NA	NA	NA	NA	NA
WP_005718262.1|312675_313449_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005718261.1|313580_314918_-	6-phospho-alpha-glucosidase	NA	NA	NA	NA	NA
WP_005727373.1|315303_316482_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	7.4e-37
WP_005718260.1|317119_317953_+	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
WP_005722430.1|318409_318952_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005721666.1|319137_320508_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_005726960.1|320658_321192_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	28.4	6.4e-12
WP_005718256.1|321429_321993_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005718255.1|322009_324166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005723889.1|324420_325740_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_005718252.1|325783_326440_-	hypothetical protein	NA	A0A2I2L670	Orpheovirus	35.5	9.9e-07
WP_005729096.1|326476_326665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005725638.1|326665_327160_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_005725635.1|328474_331099_-	alpha-mannosidase	NA	NA	NA	NA	NA
WP_005725634.1|331109_333071_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_060785162.1|333115_335761_-	alpha-mannosidase	NA	NA	NA	NA	NA
WP_005718239.1|335868_336975_-	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_005718237.1|337019_337343_-	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
WP_005723881.1|337339_337798_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_005722622.1|338177_339419_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	3.4e-80
WP_005725540.1|339669_340953_-	glycoside hydrolase family 125 protein	NA	NA	NA	NA	NA
WP_005718227.1|341087_342050_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_005727360.1|342376_343291_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	31.0	3.4e-21
WP_005718225.1|343563_343980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005725537.1|343989_344388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005718223.1|344374_344929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005725536.1|345441_347421_-	inulosucrase	NA	NA	NA	NA	NA
WP_005723872.1|347678_348665_-	Abi family protein	NA	A0A0S2MYH0	Enterococcus_phage	28.7	1.9e-30
WP_005723870.1|348965_351959_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_005727393.1|352567_353746_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	4.4e-37
WP_080543679.1|354357_355587_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	41.5	1.4e-78
WP_005727395.1|355731_356244_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_043884411.1|356796_357831_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.0	1.1e-39
WP_005723850.1|358556_359447_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_133472178.1|359452_360238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005727398.1|360408_361266_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP046311	Lactobacillus crispatus strain FDAARGOS_743 chromosome, complete genome	2373487	377718	406461	2373487	transposase,bacteriocin	Corynebacterium_phage(50.0%)	31	NA	NA
WP_005729080.1|377718_378870_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	C1KFS0	Lactobacillus_virus	43.2	9.7e-82
WP_005718188.1|379162_379609_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_005718186.1|379611_380547_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A0N7CCA3	Skermania_phage	33.6	1.8e-46
WP_005718185.1|380586_381117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005718184.1|381233_381947_+	C39 family peptidase	NA	NA	NA	NA	NA
WP_005718183.1|382143_382629_-	threonine/serine exporter	NA	NA	NA	NA	NA
WP_005718182.1|382631_383402_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_005718181.1|383412_384954_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.9	1.7e-44
WP_005718180.1|384967_385345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005727414.1|385491_386040_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005727415.1|386354_386660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005727416.1|386674_386911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005725467.1|386918_387608_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_005725466.1|387674_388910_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005725465.1|389075_390872_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_005723825.1|391023_391239_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005723824.1|391242_391650_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_005723823.1|391763_392039_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_005723822.1|392042_392270_-	TIGR04139 family peptide modification target	NA	NA	NA	NA	NA
WP_005725464.1|392434_392731_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_005727422.1|392746_393007_-	thiol reductase thioredoxin	NA	NA	NA	NA	NA
WP_005727388.1|393194_394373_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	3.3e-37
WP_005727342.1|394995_395853_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_005723819.1|396127_396403_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_035164034.1|396554_397412_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_005723816.1|397763_398402_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_155872463.1|399281_400460_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	30.1	2.3e-38
WP_005718162.1|401936_402761_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005729075.1|402764_403673_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_005727426.1|403847_405026_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.1	2.0e-37
WP_005728089.1|405603_406461_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP046311	Lactobacillus crispatus strain FDAARGOS_743 chromosome, complete genome	2373487	423340	530471	2373487	transposase,holin,bacteriocin	unidentified_phage(10.71%)	109	NA	NA
WP_005721006.1|423340_423535_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_005721005.1|423552_423843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005721002.1|424396_424594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005721000.1|424594_425899_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_005720997.1|426053_426650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005728483.1|427414_428449_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.6	7.5e-41
WP_100068033.1|430123_430948_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005720992.1|430916_432245_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_005720990.1|432232_432364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005720989.1|432481_433879_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_005720988.1|434193_436500_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_060785082.1|436646_438050_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_005720986.1|438257_438443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005720985.1|438457_438649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005726533.1|438724_438949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005720983.1|439097_439421_-	enterocin A immunity protein	NA	NA	NA	NA	NA
WP_005721782.1|439562_440312_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_005720979.1|440321_441893_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_005720978.1|441945_443100_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	33.8	1.6e-31
WP_005720977.1|443101_443788_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.1	2.5e-37
WP_005727447.1|443963_444296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005727448.1|444359_446213_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.4	5.2e-45
WP_118992449.1|447996_448071_+	GlyGly-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_005720972.1|448092_448878_-	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
WP_005720971.1|448886_449987_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_005723772.1|450040_450304_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_005720969.1|450296_451184_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	31.7	1.4e-16
WP_005721788.1|451161_451941_-	ParA family protein	NA	Q8JL10	Natrialba_phage	37.2	2.5e-25
WP_005721789.1|451959_452796_-	nucleoid occlusion protein	NA	S5VSZ7	Leptospira_phage	33.9	6.1e-17
WP_005720965.1|452813_453536_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_005720964.1|454597_455134_+	CvpA family protein	NA	NA	NA	NA	NA
WP_123811771.1|455323_455413_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_005720962.1|455552_456482_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_005721790.1|456484_457276_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_005720960.1|457367_457916_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	41.0	3.1e-30
WP_005720958.1|457929_458469_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	42.0	2.2e-28
WP_005729061.1|458621_459245_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005727451.1|459375_459615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043884391.1|459759_460794_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.6	4.8e-40
WP_005727454.1|460900_462313_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_005721793.1|462345_463020_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.3	8.9e-35
WP_005720107.1|463021_464083_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005727455.1|464085_464610_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005721796.1|464728_465328_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_005721797.1|465457_466213_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_005720101.1|466209_466971_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005722622.1|467163_468405_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	3.4e-80
WP_005721800.1|468785_469430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005720097.1|469513_470311_-	DUF4931 domain-containing protein	NA	NA	NA	NA	NA
WP_005728184.1|470467_471670_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_005720094.1|471762_471954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005720093.1|471980_472736_-	membrane protein	NA	NA	NA	NA	NA
WP_005729054.1|472735_473188_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_035163884.1|473329_473608_-	membrane protein	NA	NA	NA	NA	NA
WP_005728186.1|473668_475162_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	36.6	7.9e-76
WP_005728187.1|475276_477814_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	26.4	1.3e-67
WP_005726721.1|478027_478390_+	hypothetical protein	NA	A0A0E3XCL7	Enterococcus_phage	67.1	1.5e-20
WP_005728188.1|478461_479445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005729050.1|481012_482047_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.9	7.5e-41
WP_005728189.1|482116_482620_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	53.9	2.8e-41
WP_005727342.1|482773_483631_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_005727885.1|484311_485490_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.8	3.3e-37
WP_005720062.1|486019_486469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005720061.1|486494_486881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005724692.1|486883_487261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005721837.1|487416_488292_+	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005720055.1|488440_489298_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_005720054.1|489300_490659_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_005720053.1|490733_491960_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005720052.1|492075_493182_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.2	3.5e-20
WP_005720051.1|493203_493866_-	beta-phosphoglucomutase	NA	G3MA51	Bacillus_virus	36.0	9.1e-08
WP_060785134.1|493858_496123_-	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_005728199.1|496293_498015_-	alpha-glycosidase	NA	NA	NA	NA	NA
WP_060464070.1|498018_499680_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_060464071.1|499816_500221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035458603.1|500577_501852_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A2K9VD29	Lactobacillus_phage	26.2	1.7e-23
WP_005728427.1|501793_502459_-|transposase	IS607 family transposase	transposase	Q331V0	Clostridium_botulinum_C_phage	52.3	1.3e-57
WP_005723725.1|503676_504627_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_005720044.1|504634_505408_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_005720043.1|505463_506963_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_005728211.1|507087_507903_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_060785102.1|508133_509357_-	MFS transporter	NA	NA	NA	NA	NA
WP_005721842.1|509598_510486_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005728214.1|510762_512001_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QMQ9	Streptococcus_phage	42.4	1.1e-54
WP_005721844.1|512097_512868_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005727426.1|513014_514193_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.1	2.0e-37
WP_005720033.1|514441_514852_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_005727342.1|514923_515781_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_081079922.1|515884_516124_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_005720032.1|516193_516880_+	cobyric acid synthase	NA	NA	NA	NA	NA
WP_005721846.1|516925_517411_-	C40 family peptidase	NA	A0A0A8WF62	Clostridium_phage	39.1	1.5e-15
WP_005726936.1|517605_517956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060785135.1|518077_518953_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005721848.1|519098_519788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005721849.1|519806_520088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060785136.1|520108_521038_-	EamA family transporter	NA	NA	NA	NA	NA
WP_005720026.1|521115_522036_-	EamA family transporter	NA	NA	NA	NA	NA
WP_005720024.1|522118_522598_-	DMT family transporter	NA	NA	NA	NA	NA
WP_081090741.1|522518_523034_-	DMT family transporter	NA	NA	NA	NA	NA
WP_005729286.1|523093_523738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005721854.1|523752_524385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005721855.1|524496_525528_+	membrane protein	NA	NA	NA	NA	NA
WP_005721856.1|525707_527105_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2I4R674	Erysipelothrix_phage	24.2	3.1e-26
WP_005728217.1|527130_527625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005720016.1|527727_528087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005720014.1|528176_528518_-	YxeA family protein	NA	NA	NA	NA	NA
WP_005720013.1|528616_528958_-	type II toxin-antitoxin system HicB family antitoxin	NA	R4JJS9	Burkholderia_phage	40.6	9.4e-17
WP_005728220.1|528944_529220_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_005727393.1|529292_530471_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	4.4e-37
>prophage 8
NZ_CP046311	Lactobacillus crispatus strain FDAARGOS_743 chromosome, complete genome	2373487	546274	605763	2373487	transposase,protease	Planktothrix_phage(12.5%)	53	NA	NA
WP_005719996.1|546274_548176_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	38.8	1.6e-105
WP_005719995.1|548506_549397_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005719994.1|549377_550685_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_005727342.1|550761_551619_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_005721862.1|551751_552453_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.1	7.8e-34
WP_005719990.1|552453_555003_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005721863.1|555049_555286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005721864.1|555388_557005_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005728089.1|557274_558132_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_060785079.1|558264_559215_+	lysin	NA	Q6SE63	Lactobacillus_prophage	55.8	4.6e-61
WP_005719985.1|559286_560003_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_005719984.1|560318_561260_-	serine hydrolase	NA	NA	NA	NA	NA
WP_005719983.1|561259_562546_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_005719981.1|562538_562778_-	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_005721867.1|562814_564053_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	27.4	4.0e-25
WP_005719977.1|564052_565567_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	28.3	4.0e-35
WP_005719975.1|565582_565735_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_005719974.1|565883_566180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005719973.1|566198_567335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005719971.1|567922_568393_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005724711.1|568521_570384_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	29.2	3.4e-68
WP_005721869.1|570618_571788_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005719967.1|571895_572204_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_005719965.1|572190_572460_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_005719963.1|572484_574053_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	5.3e-14
WP_005719961.1|574148_575009_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005719960.1|575086_575443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060785080.1|575669_576938_-	MFS transporter	NA	NA	NA	NA	NA
WP_005723665.1|577044_577914_+	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005723664.1|577942_578596_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005723663.1|578687_579791_+	membrane protein	NA	NA	NA	NA	NA
WP_005719955.1|579805_582145_+	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	38.5	4.2e-31
WP_005723662.1|582251_584990_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_005719951.1|585081_585687_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_005728248.1|585992_587087_+	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	46.7	4.1e-82
WP_005719949.1|587227_588208_+	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	46.6	7.7e-72
WP_005726929.1|588394_589933_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.1	1.6e-18
WP_005726928.1|589925_591074_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005719946.1|591073_592030_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005723656.1|592135_592963_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_005719942.1|593089_593809_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_005721875.1|594103_594751_+	deoxynucleoside kinase	NA	Q5ULP7	Lactobacillus_virus	49.8	7.2e-50
WP_005719940.1|594768_595455_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	52.2	4.6e-55
WP_005719939.1|595569_596028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005728244.1|596075_596876_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_005728238.1|597013_598192_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.6	8.2e-36
WP_005727505.1|598794_599973_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	3.3e-37
WP_005720716.1|600479_601208_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005726647.1|601388_602699_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.5	1.8e-44
WP_005727342.1|602758_603616_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_005720719.1|603840_604107_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_005720721.1|604096_604429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005727342.1|604905_605763_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP046311	Lactobacillus crispatus strain FDAARGOS_743 chromosome, complete genome	2373487	624742	679524	2373487	transposase,protease,tRNA	Streptococcus_phage(21.43%)	52	NA	NA
WP_080543679.1|624742_625972_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	41.5	1.4e-78
WP_080729516.1|626240_627257_+	MFS transporter	NA	NA	NA	NA	NA
WP_003624933.1|627313_627466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005724726.1|627526_628636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005720752.1|628769_629909_-	surface layer protein	NA	NA	NA	NA	NA
WP_005724728.1|630016_631168_-	surface layer protein	NA	NA	NA	NA	NA
WP_005723628.1|631286_632222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005723626.1|632251_632569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005721887.1|632883_633255_+	helix-turn-helix transcriptional regulator	NA	Q9T1J3	Lactobacillus_phage	42.2	6.9e-05
WP_005723624.1|633232_633658_+	ImmA/IrrE family metallo-endopeptidase	NA	Q6SEA2	Lactobacillus_prophage	35.5	8.1e-10
WP_005720758.1|633767_635327_-	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_005721666.1|635573_636944_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_005723621.1|637109_638513_-	NADP-dependent phosphogluconate dehydrogenase	NA	A0A0P0C6S9	Ostreococcus_lucimarinus_virus	28.8	8.3e-35
WP_005723620.1|638854_639097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005723618.1|639311_641120_-	pyruvate oxidase	NA	NA	NA	NA	NA
WP_005724731.1|641488_643387_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_005720764.1|643394_644780_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_005721891.1|644890_645766_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_005720766.1|645767_646136_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_003549412.1|646186_646327_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_060462680.1|646460_647495_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.3	1.5e-41
WP_005721034.1|647979_649347_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_005721892.1|649521_650652_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	25.6	6.5e-22
WP_155640221.1|650868_651090_+	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
WP_005724734.1|651098_652226_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_005724736.1|652226_654191_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	45.6	7.6e-143
WP_005721040.1|654200_656681_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.9	7.9e-113
WP_005723612.1|656897_657194_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005721894.1|657243_657762_+	single-stranded DNA-binding protein	NA	W6LM61	Streptococcus_phage	50.3	4.6e-39
WP_003549366.1|657789_658026_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005721046.1|658189_660211_+	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_005721048.1|660222_660678_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005721050.1|660697_662089_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	51.0	2.6e-121
WP_005721051.1|662256_663192_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005723610.1|663301_664231_+	DegV family protein	NA	NA	NA	NA	NA
WP_060785096.1|664328_665933_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.6	2.2e-15
WP_005723607.1|666063_666942_+	ROK family protein	NA	NA	NA	NA	NA
WP_005723606.1|667089_667281_+	CsbD family protein	NA	NA	NA	NA	NA
WP_005721061.1|667331_667589_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_060785095.1|667648_668878_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_005721064.1|668975_669677_-	methyltransferase	NA	G3MA03	Bacillus_virus	42.6	2.7e-18
WP_005723591.1|670359_671256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005721068.1|671277_672294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005727505.1|672553_673732_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	3.3e-37
WP_005720656.1|673965_674205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005720655.1|674267_674477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005727514.1|674840_675677_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005723588.1|675767_676580_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005721915.1|676748_676922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005727426.1|677385_678564_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.1	2.0e-37
WP_155872465.1|678635_679220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080543284.1|679131_679524_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 10
NZ_CP046311	Lactobacillus crispatus strain FDAARGOS_743 chromosome, complete genome	2373487	759542	812876	2373487	transposase,protease	Planktothrix_phage(25.0%)	52	NA	NA
WP_005727493.1|759542_760949_-|transposase	ISLre2-like element ISLcr2 family transposase	transposase	NA	NA	NA	NA
WP_005720468.1|761111_761372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021355495.1|761403_761505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005720469.1|761615_762758_+	C40 family peptidase	NA	NA	NA	NA	NA
WP_005720470.1|762766_763501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005726830.1|763524_764406_-	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005723999.1|764414_765068_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005720473.1|765072_766425_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.4	3.4e-09
WP_005721723.1|766581_767523_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005727492.1|767557_768454_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_005727491.1|768472_769033_-	LemA family protein	NA	NA	NA	NA	NA
WP_060785104.1|769129_770230_-	cation transporter	NA	NA	NA	NA	NA
WP_005727488.1|770430_770835_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_005729304.1|770928_772707_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_003548644.1|772778_772919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080549909.1|773377_774499_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_005724009.1|774507_775611_+	glycosyl hydrolase family 5	NA	NA	NA	NA	NA
WP_005720489.1|775696_776341_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_021355493.1|776341_777256_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_005724011.1|777354_778287_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_005721712.1|778370_779126_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	9.0e-28
WP_005720493.1|779125_780739_-	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_005724015.1|781071_781704_-	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_005720497.1|781736_782102_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_005720498.1|782098_782887_-	TerC family protein	NA	A0A068EP98	Bacillus_phage	42.7	2.8e-40
WP_005720499.1|782873_783392_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_005721711.1|783444_784143_-	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_155872469.1|784275_785625_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005718321.1|785793_786279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005726568.1|786279_787737_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_005721710.1|787756_788683_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005721709.1|788778_789549_+	ribonuclease	NA	C1KFJ1	Lactobacillus_virus	33.7	3.7e-29
WP_005718327.1|789575_790529_-	DUF1002 domain-containing protein	NA	NA	NA	NA	NA
WP_005718328.1|790689_791502_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_005718329.1|791510_792167_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005727477.1|792178_793036_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_005721708.1|793138_793555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005718331.1|793646_794633_+	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	31.6	3.7e-37
WP_005718332.1|794797_795481_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005718333.1|795493_796318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005718334.1|796444_797929_+	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_005718336.1|797921_798659_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	1.0e-31
WP_005718337.1|798694_799945_-	CAP domain-containing protein	NA	NA	NA	NA	NA
WP_005718338.1|800097_801180_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_005718339.1|801207_801957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005718340.1|802047_803181_+	YibE/F family protein	NA	NA	NA	NA	NA
WP_005718341.1|803177_803963_+	YibE/F family protein	NA	NA	NA	NA	NA
WP_005727475.1|803934_804756_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_060785169.1|805058_808067_-	DUF5110 domain-containing protein	NA	NA	NA	NA	NA
WP_005718344.1|808366_809521_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_005727426.1|809790_810969_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.1	2.0e-37
WP_005727426.1|811697_812876_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.1	2.0e-37
>prophage 11
NZ_CP046311	Lactobacillus crispatus strain FDAARGOS_743 chromosome, complete genome	2373487	822339	893466	2373487	transposase,protease,tRNA	Enterococcus_phage(12.5%)	60	NA	NA
WP_005726106.1|822339_823743_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005718373.1|824934_825504_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005724044.1|825662_826148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060785071.1|826204_827602_+	serine/threonine protein phosphatase	NA	A0A2P0ZKZ2	Lactobacillus_phage	21.9	1.8e-05
WP_005718379.1|827738_829688_+	asparagine synthase (glutamine-hydrolyzing)	NA	E3T4J5	Cafeteria_roenbergensis_virus	25.5	1.3e-17
WP_005718381.1|829709_830993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005718383.1|831166_833374_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	64.9	5.9e-253
WP_005718384.1|833373_834087_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0C5K925	Enterococcus_phage	56.4	4.6e-50
WP_005724046.1|834138_834717_+	DUF59 domain-containing protein	NA	NA	NA	NA	NA
WP_005718386.1|834709_835906_+	DUF438 domain-containing protein	NA	NA	NA	NA	NA
WP_035163463.1|836022_837240_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	29.8	8.5e-44
WP_060785070.1|839439_841449_-	KUP/HAK/KT family potassium transporter	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	34.5	1.2e-63
WP_005718390.1|841670_842105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005721691.1|842296_843376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005718393.1|843411_843639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005721690.1|843787_844126_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_005721688.1|844148_844424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005722622.1|844804_846046_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	3.4e-80
WP_005718396.1|846284_846701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005718397.1|846854_847070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005718399.1|847104_847377_+	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
WP_060785083.1|847902_849249_+	S-layer protein	NA	NA	NA	NA	NA
WP_005726849.1|849362_849557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005718409.1|850166_851063_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_005718408.1|851256_852126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005718407.1|852338_852830_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005718406.1|853106_853391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005718404.1|854054_854645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005725404.1|854718_856182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005718411.1|856913_857216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005718412.1|857505_858732_+	N-acetylmuramidase	NA	A0A0A7RUS8	Clostridium_phage	40.8	3.2e-14
WP_005718413.1|858751_859843_+	amidase	NA	NA	NA	NA	NA
WP_005729184.1|859930_861769_+	potassium transporter	NA	NA	NA	NA	NA
WP_005721681.1|861823_862471_-	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_005718422.1|862488_863454_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_005718424.1|863462_864269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005718426.1|864350_865106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005721679.1|865261_865954_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_005718431.1|866231_866792_+	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_005724059.1|866897_867998_+	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005718435.1|867997_868612_+	membrane protein	NA	NA	NA	NA	NA
WP_035163864.1|868649_871640_+	LTA synthase family protein	NA	NA	NA	NA	NA
WP_005728108.1|871834_873061_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	49.4	2.3e-97
WP_005718438.1|873390_874785_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_005718439.1|875038_876301_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.5	6.7e-84
WP_005725398.1|876724_877081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005718442.1|877305_878619_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	32.2	1.4e-60
WP_005721672.1|878618_879272_+	HD domain-containing protein	NA	S4W232	Pandoravirus	27.1	8.4e-06
WP_005718445.1|879439_881059_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005721668.1|881248_882877_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005721666.1|883135_884506_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_005718452.1|884729_885875_+	guanosine monophosphate reductase	NA	A0A1V0SHK8	Klosneuvirus	33.5	1.1e-61
WP_005718454.1|886033_886963_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005718456.1|886971_888003_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005718457.1|888018_889077_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	2.8e-19
WP_005718459.1|889097_890042_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.6	2.7e-21
WP_005721665.1|890137_891454_-	aminopeptidase	NA	R4TV59	Phaeocystis_globosa_virus	35.0	5.2e-63
WP_005718462.1|891595_892021_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_005721664.1|892262_892724_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_005721663.1|892803_893466_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 12
NZ_CP046311	Lactobacillus crispatus strain FDAARGOS_743 chromosome, complete genome	2373487	899485	1013161	2373487	transposase,protease,tRNA,integrase	Corynebacterium_phage(12.0%)	113	979730:979744	1010196:1010210
WP_005718473.1|899485_901462_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.0	2.4e-96
WP_005718474.1|901461_902229_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005718476.1|902215_902782_+	ribonuclease M5	NA	NA	NA	NA	NA
WP_005718477.1|902771_903656_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_005718479.1|903717_903975_+	Veg-like protein	NA	NA	NA	NA	NA
WP_005718481.1|904010_904841_+	pur operon repressor	NA	NA	NA	NA	NA
WP_005718483.1|904887_906273_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L277	Tupanvirus	32.7	1.3e-27
WP_005727954.1|906461_907868_+|transposase	ISLre2-like element ISLcr2 family transposase	transposase	NA	NA	NA	NA
WP_005718484.1|908009_908762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005718485.1|908870_910640_+	cell division protein	NA	NA	NA	NA	NA
WP_005718487.1|910867_911842_+	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	34.7	6.1e-45
WP_005718488.1|912003_912924_+	ROK family protein	NA	NA	NA	NA	NA
WP_005721656.1|912984_913263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005718490.1|913294_914668_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	33.5	8.4e-32
WP_155872472.1|914763_915942_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	2.6e-37
WP_005721655.1|916161_916566_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_020993095.1|916612_917131_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_005718494.1|917247_918867_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	47.7	1.5e-136
WP_005718495.1|918998_920297_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005718496.1|920358_920877_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005718497.1|920873_921365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005721654.1|921419_922844_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_005718499.1|922932_923745_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005718500.1|923896_925183_-	purine permease	NA	NA	NA	NA	NA
WP_005718502.1|925189_925768_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_005727236.1|926001_926604_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005718506.1|926826_928377_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	34.1	9.5e-24
WP_005718507.1|928873_929065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005718509.1|930072_931284_+	LEA family epithelial adhesin	NA	NA	NA	NA	NA
WP_005721650.1|931186_933388_+	LEA family epithelial adhesin	NA	NA	NA	NA	NA
WP_005721649.1|934032_934944_-	prenyltransferase	NA	NA	NA	NA	NA
WP_005718512.1|935344_935860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005727505.1|936131_937310_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	3.3e-37
WP_005721647.1|937385_938585_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005721074.1|938597_939599_+	FMN-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_060785120.1|939911_940256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005721084.1|940236_940512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005721085.1|940570_941806_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.7	5.9e-101
WP_005721643.1|941909_943502_+	APC family permease	NA	NA	NA	NA	NA
WP_005721088.1|943547_944375_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_005725358.1|944490_946110_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_005721090.1|946219_946465_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_005725357.1|946590_947958_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_005725356.1|947971_949456_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	39.5	1.2e-71
WP_005721641.1|949538_949895_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_005721640.1|949899_951030_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.6	1.0e-27
WP_005721098.1|951094_951802_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005721100.1|951973_952945_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_005721102.1|953081_953639_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005721104.1|953640_957135_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_005721105.1|957150_957393_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005721106.1|957460_957838_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_005721108.1|957837_958200_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005721110.1|958238_959492_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A0N7G7K4	Chrysochromulina_ericina_virus	24.4	5.3e-17
WP_005721112.1|959586_961755_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	48.4	2.1e-109
WP_005721113.1|961807_962698_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_005721639.1|962772_963801_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_005721117.1|963817_965368_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	39.6	1.1e-83
WP_118992448.1|965433_966678_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.5	1.4e-57
WP_021355350.1|967078_968305_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.6	1.1e-96
WP_005721185.1|968535_968991_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_043884476.1|969423_970458_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.3	3.3e-41
WP_005720322.1|971012_971468_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_005720323.1|971572_974053_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	37.7	3.3e-119
WP_005729342.1|974274_977913_+	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	25.0	9.0e-49
WP_005721631.1|977928_981588_+	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.0	1.8e-65
979730:979744	attL	AGATTGATAAGAAGA	NA	NA	NA	NA
WP_005720326.1|981650_982334_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_005720327.1|982515_982923_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_005720329.1|982938_983409_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_005720330.1|983442_985536_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.7	9.4e-67
WP_003549023.1|985850_986159_+	30S ribosomal protein S10	NA	NA	NA	NA	NA
WP_005720335.1|986182_986821_+	50S ribosomal protein L3	NA	NA	NA	NA	NA
WP_060464008.1|986835_987453_+	50S ribosomal protein L4	NA	NA	NA	NA	NA
WP_005720338.1|987452_987758_+	50S ribosomal protein L23	NA	NA	NA	NA	NA
WP_005721628.1|987773_988610_+	50S ribosomal protein L2	NA	NA	NA	NA	NA
WP_005720340.1|988628_988913_+	30S ribosomal protein S19	NA	NA	NA	NA	NA
WP_003625788.1|988932_989286_+	50S ribosomal protein L22	NA	NA	NA	NA	NA
WP_005720341.1|989299_989974_+	30S ribosomal protein S3	NA	NA	NA	NA	NA
WP_003625792.1|989973_990414_+	50S ribosomal protein L16	NA	NA	NA	NA	NA
WP_003549032.1|990403_990601_+	50S ribosomal protein L29	NA	NA	NA	NA	NA
WP_005721626.1|990619_990886_+	30S ribosomal protein S17	NA	NA	NA	NA	NA
WP_003549034.1|990917_991286_+	50S ribosomal protein L14	NA	NA	NA	NA	NA
WP_005720345.1|991305_991542_+	50S ribosomal protein L24	NA	NA	NA	NA	NA
WP_005720346.1|991556_992099_+	50S ribosomal protein L5	NA	NA	NA	NA	NA
WP_003549037.1|992111_992297_+	type Z 30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_005720347.1|992321_992720_+	30S ribosomal protein S8	NA	NA	NA	NA	NA
WP_005720348.1|992744_993275_+	50S ribosomal protein L6	NA	NA	NA	NA	NA
WP_005720349.1|993301_993658_+	50S ribosomal protein L18	NA	NA	NA	NA	NA
WP_005720350.1|993675_994182_+	30S ribosomal protein S5	NA	NA	NA	NA	NA
WP_005720351.1|994199_994385_+	50S ribosomal protein L30	NA	NA	NA	NA	NA
WP_005720352.1|994408_994849_+	50S ribosomal protein L15	NA	NA	NA	NA	NA
WP_005720354.1|994848_996144_+	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
WP_005720355.1|996154_996811_+	adenylate kinase	NA	NA	NA	NA	NA
WP_002878178.1|996886_997108_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_005721621.1|997124_997241_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_060464009.1|997261_997612_+	30S ribosomal protein S13	NA	NA	NA	NA	NA
WP_003625817.1|997636_998026_+	30S ribosomal protein S11	NA	NA	NA	NA	NA
WP_005720363.1|998071_999010_+	DNA-directed RNA polymerase subunit alpha	NA	NA	NA	NA	NA
WP_005721620.1|999037_999421_+	50S ribosomal protein L17	NA	NA	NA	NA	NA
WP_013085817.1|999605_1000457_+	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	31.6	3.0e-19
WP_005720366.1|1000432_1001278_+	energy-coupling factor transporter ATPase	NA	W8CYL7	Bacillus_phage	27.2	5.6e-10
WP_005720367.1|1001281_1002079_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_005721618.1|1002083_1002872_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_005720369.1|1002976_1003420_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_005720370.1|1003431_1003827_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_005727960.1|1003896_1004949_-|integrase	site-specific integrase	integrase	A8ATX2	Listeria_phage	24.1	9.3e-15
WP_005727959.1|1005021_1006200_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.4	3.9e-38
WP_060464100.1|1006404_1006593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060464099.1|1008018_1008777_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_005727954.1|1008975_1010382_-|transposase	ISLre2-like element ISLcr2 family transposase	transposase	NA	NA	NA	NA
1010196:1010210	attR	TCTTCTTATCAATCT	NA	NA	NA	NA
WP_005720378.1|1010655_1011729_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_005720379.1|1011798_1012257_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_005727342.1|1012303_1013161_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP046311	Lactobacillus crispatus strain FDAARGOS_743 chromosome, complete genome	2373487	1033900	1079083	2373487	transposase,tRNA	Streptococcus_phage(30.77%)	53	NA	NA
WP_005726795.1|1033900_1035400_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_005724208.1|1035490_1036924_+|tRNA	cysteine--tRNA ligase	tRNA	A0A0U2SJ70	Niemeyer_virus	29.5	4.8e-46
WP_005726794.1|1036916_1037360_+	mini-ribonuclease III	NA	NA	NA	NA	NA
WP_005724210.1|1037346_1038102_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005724212.1|1038235_1038781_+	DNA-directed RNA polymerase subunit sigma	NA	NA	NA	NA	NA
WP_005720420.1|1038844_1039063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005725562.1|1039179_1040688_+	gluconokinase	NA	NA	NA	NA	NA
WP_031267115.1|1040734_1042480_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005720427.1|1042665_1042815_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_005720429.1|1042824_1042995_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_060464022.1|1043103_1043661_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_004045505.1|1043791_1044217_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_005720434.1|1044294_1044987_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_005720435.1|1045106_1045973_+	phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_101886288.1|1045976_1046993_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_005727505.1|1047031_1048210_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	3.3e-37
WP_060785172.1|1048353_1049241_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_089142853.1|1049246_1050044_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.0	1.6e-11
WP_005721590.1|1050045_1050801_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	1.4e-15
WP_005720440.1|1050818_1051496_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_005720443.1|1052271_1052550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005720444.1|1052753_1053266_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_005720445.1|1053318_1053681_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_005724218.1|1053757_1054600_+	potassium channel protein	NA	A0A1B0Y2S3	Lactobacillus_phage	30.9	8.5e-19
WP_155872474.1|1054605_1054965_+	methyltransferase	NA	NA	NA	NA	NA
WP_005727342.1|1055044_1055902_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_005720449.1|1056325_1056508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005728621.1|1056582_1057083_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_005725987.1|1057288_1059094_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	40.1	8.1e-51
WP_005720597.1|1059100_1059691_+	DUF1792 domain-containing protein	NA	NA	NA	NA	NA
WP_118992204.1|1059579_1059930_+	DUF1792 domain-containing protein	NA	NA	NA	NA	NA
WP_005728618.1|1059945_1060281_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_005728617.1|1060281_1060881_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_005720594.1|1060880_1061120_+	YaaL family protein	NA	NA	NA	NA	NA
WP_005728616.1|1061222_1061861_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	50.5	1.1e-53
WP_005728615.1|1061873_1062194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005728614.1|1062193_1063051_+	DNA polymerase III subunit delta	NA	M1NSC1	Streptococcus_phage	29.4	4.2e-21
WP_005721578.1|1063060_1063411_+	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
WP_005728613.1|1063410_1064262_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.4	2.8e-62
WP_005728612.1|1064264_1064999_+	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_005720585.1|1065049_1065568_+	folate family ECF transporter S component	NA	NA	NA	NA	NA
WP_021355804.1|1065597_1066332_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_013085858.1|1066315_1066888_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_005728608.1|1066884_1067931_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	35.8	9.5e-52
WP_005718146.1|1068110_1069478_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	29.4	1.3e-40
WP_155872476.1|1069392_1069623_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_005718145.1|1069687_1070035_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005725995.1|1070287_1070554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035163704.1|1071857_1073567_-	oxalyl-CoA decarboxylase	NA	NA	NA	NA	NA
WP_005727935.1|1073740_1075663_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.2	1.7e-59
WP_005720571.1|1075837_1076473_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_080543679.1|1076740_1077970_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	41.5	1.4e-78
WP_005727342.1|1078225_1079083_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP046311	Lactobacillus crispatus strain FDAARGOS_743 chromosome, complete genome	2373487	1149442	1154280	2373487	integrase	Lactobacillus_phage(37.5%)	9	1140318:1140334	1156620:1156636
1140318:1140334	attL	ATTAAAAGAAAAATTAA	NA	NA	NA	NA
WP_155872478.1|1149442_1150555_-|integrase	tyrosine-type recombinase/integrase	integrase	E9LUK6	Lactobacillus_phage	41.2	1.0e-72
WP_155872480.1|1150702_1151107_-	ImmA/IrrE family metallo-endopeptidase	NA	O48433	Lactobacillus_phage	41.1	4.8e-20
WP_057726492.1|1151122_1151470_-	helix-turn-helix transcriptional regulator	NA	A0A097QQ00	Enterococcus_phage	37.0	7.1e-12
WP_057726494.1|1151625_1151832_+	helix-turn-helix transcriptional regulator	NA	A0A0A8WJE4	Clostridium_phage	46.3	1.3e-05
WP_060785186.1|1151889_1152660_+	hypothetical protein	NA	X2CYF1	Lactobacillus_phage	33.2	6.8e-15
WP_005729368.1|1152662_1152794_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_005721465.1|1152783_1152960_-	Arc family DNA-binding protein	NA	A0A0A8WG21	Clostridium_phage	64.8	2.3e-11
WP_060785187.1|1153222_1153933_+	helix-turn-helix domain-containing protein	NA	A0A2D1GQ66	Lysinibacillus_phage	54.0	6.1e-18
WP_005726376.1|1153935_1154280_+	DUF771 domain-containing protein	NA	Q37943	Lactococcus_phage	51.0	8.5e-26
1156620:1156636	attR	ATTAAAAGAAAAATTAA	NA	NA	NA	NA
>prophage 15
NZ_CP046311	Lactobacillus crispatus strain FDAARGOS_743 chromosome, complete genome	2373487	1158373	1280902	2373487	transposase,protease,tRNA,bacteriocin	Corynebacterium_phage(17.86%)	107	NA	NA
WP_005727388.1|1158373_1159552_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	3.3e-37
WP_020992891.1|1160034_1160418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005727898.1|1160772_1160928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005721449.1|1161248_1161503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060785188.1|1161629_1162859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005721447.1|1162912_1163665_+	class A sortase	NA	NA	NA	NA	NA
WP_005726010.1|1163639_1164215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155872485.1|1164325_1167337_+	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_005721443.1|1167430_1168561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035163828.1|1168647_1170876_+	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_005721441.1|1170963_1171260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005726016.1|1171302_1171635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080729518.1|1174034_1176851_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_005727978.1|1176895_1179610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005721436.1|1179613_1179940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005727981.1|1179917_1180541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005727982.1|1180550_1182560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005727984.1|1182559_1184020_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A288TY55	Enterococcus_phage	55.3	1.5e-15
WP_005724861.1|1184041_1184620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005724860.1|1184621_1185263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005728982.1|1185264_1185666_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005724858.1|1185668_1185917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005724856.1|1185928_1186798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005723210.1|1187137_1187470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005723208.1|1187490_1187718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005727993.1|1187732_1188092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060785163.1|1188191_1189802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060785164.1|1189907_1190996_+	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_060785126.1|1191227_1192115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060785127.1|1192235_1194683_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_060785128.1|1194965_1195403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155872488.1|1195526_1198103_+	type IA DNA topoisomerase	NA	NA	NA	NA	NA
WP_155872491.1|1198236_1198917_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_155635095.1|1199813_1199978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060464216.1|1200423_1201215_+	ParA family protein	NA	E2ELL2	Clostridium_phage	28.1	4.9e-16
WP_060464215.1|1201280_1201562_+	DUF3850 domain-containing protein	NA	U5U430	Lactobacillus_phage	54.2	1.2e-14
WP_005728019.1|1201584_1201836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155872463.1|1202229_1203408_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	30.1	2.3e-38
WP_005725898.1|1203629_1204511_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005725899.1|1204975_1206175_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	64.5	4.3e-141
WP_005728875.1|1206198_1207659_+	MFS transporter	NA	NA	NA	NA	NA
WP_005725753.1|1207794_1208649_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005725754.1|1208650_1209544_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_005725653.1|1209752_1210652_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_005725654.1|1210664_1212107_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_043884464.1|1212320_1213355_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.3	6.3e-40
WP_060785171.1|1213399_1214392_+	DUF871 domain-containing protein	NA	NA	NA	NA	NA
WP_005725656.1|1214407_1215253_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005727876.1|1215901_1217272_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_005728879.1|1217386_1218673_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_005725658.1|1218674_1219691_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_005725659.1|1219690_1221409_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	25.6	1.7e-26
WP_005725903.1|1221398_1223147_+	thiol reductant ABC exporter subunit CydC	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.2	8.0e-19
WP_005720785.1|1223156_1223858_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_005720786.1|1223854_1224844_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005728024.1|1224903_1225803_+	prenyltransferase	NA	NA	NA	NA	NA
WP_005728025.1|1225817_1227038_+	NADH dehydrogenase	NA	NA	NA	NA	NA
WP_080514226.1|1227107_1227203_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_031267172.1|1227197_1227497_+	FAD-binding protein	NA	A0A2P0ZL82	Lactobacillus_phage	75.9	3.6e-28
WP_005728027.1|1227721_1228561_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_005729411.1|1228620_1229544_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	44.4	5.6e-64
WP_005728881.1|1229586_1230252_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_005728030.1|1230541_1232956_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	65.2	2.0e-307
WP_005728882.1|1233042_1234686_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_035163792.1|1235137_1236346_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005728886.1|1236734_1236980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005728887.1|1237409_1238294_+	phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005728034.1|1238311_1239220_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_005728035.1|1239219_1240095_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_005728036.1|1240097_1240853_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.0	5.3e-20
WP_060785077.1|1240893_1241535_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_060785076.1|1241645_1242323_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.3	2.7e-31
WP_005728039.1|1242322_1243999_+	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	36.0	6.0e-32
WP_005727426.1|1244384_1245563_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.1	2.0e-37
WP_005727340.1|1245813_1247040_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.4	5.6e-96
WP_134791624.1|1247440_1248685_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	46.5	1.4e-57
WP_080592479.1|1248696_1249953_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.0	2.7e-53
WP_101883480.1|1250450_1250777_-	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_005728042.1|1251044_1252346_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_005728043.1|1252348_1253197_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_005728044.1|1253322_1254009_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_005728046.1|1254372_1256058_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	31.9	2.7e-72
WP_005728047.1|1256168_1257086_+	class II fructose-bisphosphate aldolase family protein	NA	NA	NA	NA	NA
WP_005728048.1|1257222_1258257_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.0	1.1e-39
WP_005728891.1|1258409_1258934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005720813.1|1259529_1259733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005728049.1|1259852_1260731_+	prenyltransferase	NA	NA	NA	NA	NA
WP_155872494.1|1260723_1261581_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_005728051.1|1261802_1262126_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_005722279.1|1263698_1264334_+	hypothetical protein	NA	A0A0E3XCL7	Enterococcus_phage	60.8	4.2e-18
WP_005725671.1|1264357_1265014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005722274.1|1265093_1265825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005718074.1|1265821_1266016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005718075.1|1266216_1266432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005728296.1|1266561_1267116_+	MFS transporter	NA	NA	NA	NA	NA
WP_005728901.1|1267236_1268568_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	39.0	5.2e-63
WP_035163264.1|1268759_1269593_+	MFS transporter	NA	NA	NA	NA	NA
WP_005728292.1|1269722_1270496_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_155872497.1|1270534_1271713_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.1	2.6e-37
WP_005728905.1|1271883_1272372_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_005718085.1|1272526_1273636_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_005728287.1|1273632_1274751_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_005718089.1|1274856_1275675_+	triphosphoribosyl-dephospho-CoA synthase	NA	NA	NA	NA	NA
WP_005727538.1|1276271_1277570_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.9	1.0e-39
WP_005728283.1|1277852_1278605_-	aquaporin family protein	NA	M1GYI5	Paramecium_bursaria_Chlorella_virus	31.2	5.3e-20
WP_005728282.1|1279026_1279593_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	35.4	1.4e-20
WP_005727426.1|1279723_1280902_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.1	2.0e-37
>prophage 16
NZ_CP046311	Lactobacillus crispatus strain FDAARGOS_743 chromosome, complete genome	2373487	1299285	1351248	2373487	transposase,protease,tRNA	Corynebacterium_phage(26.67%)	53	NA	NA
WP_005718114.1|1299285_1299942_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_081079883.1|1300243_1300573_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_005718117.1|1300662_1300983_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005723469.1|1301002_1301650_+|tRNA	DUF4479 and tRNA-binding domain-containing protein	tRNA	NA	NA	NA	NA
WP_005728919.1|1301937_1303251_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_005728272.1|1303307_1304570_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_005728271.1|1304749_1305727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005728923.1|1305825_1307340_-	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_005728268.1|1307473_1308454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005728267.1|1308566_1308875_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_005728924.1|1308895_1309585_+	SPFH domain-containing protein	NA	NA	NA	NA	NA
WP_005728925.1|1309588_1309777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005728266.1|1309983_1312647_+	DNA polymerase I	NA	S5M8J1	Bacillus_phage	26.1	8.6e-57
WP_005728265.1|1312655_1313483_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	30.0	1.0e-24
WP_005721156.1|1313482_1314085_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_005728264.1|1314087_1314555_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_005728263.1|1314557_1315892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005728262.1|1315911_1316820_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	28.5	4.6e-26
WP_005728261.1|1317106_1319041_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	33.4	1.2e-95
WP_005727885.1|1319328_1320507_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.8	3.3e-37
WP_005729050.1|1320638_1321673_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.9	7.5e-41
WP_155872500.1|1321814_1322993_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.2	5.7e-37
WP_043884503.1|1323175_1324435_-	DUF389 domain-containing protein	NA	NA	NA	NA	NA
WP_005727426.1|1324596_1325775_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.1	2.0e-37
WP_043884502.1|1325911_1326439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005728256.1|1326746_1327178_+	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
WP_035163293.1|1327179_1328106_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	5.0e-20
WP_005728254.1|1328105_1328870_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_043884464.1|1328977_1330012_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.3	6.3e-40
WP_005728252.1|1330198_1331548_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080729502.1|1332366_1332900_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	40.0	3.6e-15
WP_005719899.1|1332921_1333122_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005719897.1|1333166_1333523_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005722239.1|1333570_1334572_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_020992959.1|1334853_1336005_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	C1KFS0	Lactobacillus_virus	42.2	3.1e-80
WP_005719892.1|1336195_1336720_+	YqeG family HAD IIIA-type phosphatase	NA	NA	NA	NA	NA
WP_005719890.1|1336712_1337822_+	ribosome biogenesis GTPase YqeH	NA	NA	NA	NA	NA
WP_005723422.1|1337832_1338486_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005723420.1|1338466_1339060_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005719884.1|1339077_1339425_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005719882.1|1339428_1340580_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005719880.1|1340582_1341146_+	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_005719878.1|1341314_1342031_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	29.6	1.5e-24
WP_005719876.1|1342008_1343586_+	HAMP domain-containing histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	29.3	1.0e-09
WP_005719874.1|1343758_1344040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005723417.1|1344033_1344918_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005719871.1|1344986_1346168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005723412.1|1346375_1346864_-|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_005723411.1|1346910_1347876_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_005723409.1|1347919_1348192_-	acylphosphatase	NA	NA	NA	NA	NA
WP_005728437.1|1348291_1349059_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_005719866.1|1349166_1349517_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005727388.1|1350069_1351248_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	3.3e-37
>prophage 17
NZ_CP046311	Lactobacillus crispatus strain FDAARGOS_743 chromosome, complete genome	2373487	1362560	1556138	2373487	transposase,protease,tRNA	Corynebacterium_phage(21.28%)	170	NA	NA
WP_005727388.1|1362560_1363739_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	3.3e-37
WP_005719852.1|1364062_1364878_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_005727141.1|1365274_1366906_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005727140.1|1366917_1368123_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_005723390.1|1368341_1369613_+	peptidase dimerisation domain-containing protein	NA	NA	NA	NA	NA
WP_005727138.1|1369609_1370428_+	DUF3100 domain-containing protein	NA	NA	NA	NA	NA
WP_005727136.1|1370420_1370912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005727342.1|1370929_1371787_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080549914.1|1371996_1372536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035163222.1|1372620_1373415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005723385.1|1373594_1374188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005723383.1|1374303_1374903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005719839.1|1374902_1375622_+	cell surface protein	NA	NA	NA	NA	NA
WP_005719838.1|1375618_1376500_+	heme ABC transporter substrate-binding protein IsdE	NA	NA	NA	NA	NA
WP_005722222.1|1376505_1377432_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_005719834.1|1377424_1378198_+	ABC transporter ATP-binding protein	NA	A0A1V0SD74	Indivirus	29.0	1.1e-12
WP_005719832.1|1378242_1378527_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	53.9	8.3e-19
WP_005719829.1|1379274_1379568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005719828.1|1379570_1379819_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_005719826.1|1380086_1381010_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_005727174.1|1381072_1383712_-	YfhO family protein	NA	NA	NA	NA	NA
WP_060785125.1|1383799_1385908_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_003548272.1|1385983_1386133_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_005728452.1|1386187_1386751_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_005719818.1|1386785_1387472_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_005719816.1|1387471_1387711_+	YqgQ family protein	NA	NA	NA	NA	NA
WP_005719815.1|1387769_1388171_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_035163288.1|1388248_1389169_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_060785124.1|1389161_1390406_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_005719812.1|1390541_1391879_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_005719811.1|1392168_1393083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005727009.1|1393227_1394217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155872503.1|1394388_1394814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005727505.1|1394852_1396031_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	3.3e-37
WP_005729025.1|1396216_1396426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005722205.1|1396409_1396601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005722204.1|1396638_1396914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005725423.1|1398254_1398386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005722199.1|1398922_1400557_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005719798.1|1400838_1401678_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005722197.1|1401782_1402655_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_005719796.1|1402934_1403798_+	ROK family protein	NA	NA	NA	NA	NA
WP_005725421.1|1403948_1404686_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_005725420.1|1404695_1405859_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005725419.1|1405878_1407375_+	sodium:solute symporter	NA	NA	NA	NA	NA
WP_005725418.1|1407395_1408019_+	cephalosporin deacetylase	NA	NA	NA	NA	NA
WP_005727016.1|1408038_1408395_+	acetylxylan esterase	NA	NA	NA	NA	NA
WP_005725417.1|1408417_1409110_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_005727015.1|1409233_1409389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005729026.1|1409420_1410293_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_005729027.1|1410545_1411724_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.5	9.7e-37
WP_005719778.1|1414371_1415286_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005719776.1|1415305_1415809_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	39.0	9.3e-21
WP_005722191.1|1415805_1416420_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_005727004.1|1416420_1417338_+	type I pantothenate kinase	NA	NA	NA	NA	NA
WP_005727562.1|1417943_1419242_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.3	2.6e-38
WP_005725850.1|1419432_1419834_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005727477.1|1420868_1421726_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_005727541.1|1421808_1422669_-	ROK family protein	NA	NA	NA	NA	NA
WP_005726841.1|1422781_1423639_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_005727542.1|1423761_1424250_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_005729050.1|1424526_1425561_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.9	7.5e-41
WP_005727545.1|1425631_1426165_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_005727546.1|1426244_1427531_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	52.4	1.6e-109
WP_005727547.1|1427745_1428579_+	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	38.0	8.1e-46
WP_005729492.1|1428618_1429194_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_043884464.1|1429314_1430349_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.3	6.3e-40
WP_005727549.1|1430474_1431452_-	choloylglycine hydrolase family protein	NA	M1HVK5	Paramecium_bursaria_Chlorella_virus	30.7	8.1e-21
WP_005727551.1|1431847_1432879_+	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_005727552.1|1433005_1433473_+	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_060464020.1|1433743_1434784_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005727554.1|1435073_1435670_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_005727556.1|1437344_1437794_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005727558.1|1438025_1439375_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_005728483.1|1439691_1440726_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.6	7.5e-41
WP_101883502.1|1441572_1443501_+	plasma-membrane proton-efflux P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	25.1	4.5e-31
WP_081090746.1|1443645_1445016_+	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_005728252.1|1445344_1446694_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_126708910.1|1446745_1447348_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_005727562.1|1447957_1449256_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.3	2.6e-38
WP_005727388.1|1450491_1451670_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	3.3e-37
WP_155872506.1|1451820_1453515_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	38.1	5.4e-89
WP_005719082.1|1453516_1453981_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.0	1.2e-25
WP_005719083.1|1453995_1455174_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	1.1e-99
WP_005722848.1|1455175_1455772_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.8	3.1e-31
WP_005721297.1|1455764_1456826_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	33.5	3.4e-41
WP_005728489.1|1457452_1458310_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_005719088.1|1458474_1459146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126708831.1|1459635_1460814_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.7	8.8e-38
WP_100068035.1|1461118_1461736_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_005719090.1|1461842_1463099_+	ATPase AAA	NA	NA	NA	NA	NA
WP_005721294.1|1463150_1463852_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005725942.1|1463995_1465525_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005725941.1|1465517_1466213_+	oxidoreductase	NA	NA	NA	NA	NA
WP_005721176.1|1466353_1467592_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	46.2	5.0e-84
WP_005729475.1|1468040_1468472_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_155872467.1|1468593_1469772_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.5	3.3e-37
WP_005719095.1|1469953_1470748_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	27.3	4.0e-10
WP_005719096.1|1470763_1471972_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_005719097.1|1471952_1473191_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	43.9	1.2e-101
WP_060785101.1|1473177_1473639_+	SUF system NifU family Fe-S cluster assembly protein	NA	A0A2H4N7M4	Lake_Baikal_phage	27.9	1.7e-05
WP_005719099.1|1473631_1475035_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_005729473.1|1475034_1475358_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_005719101.1|1475369_1476878_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_005719080.1|1478893_1479076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118992224.1|1479087_1479699_+	maturase	NA	NA	NA	NA	NA
WP_005722846.1|1479776_1480241_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	41.7	2.0e-25
WP_060462467.1|1480255_1481434_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.4	3.3e-101
WP_005727565.1|1481435_1482032_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	39.3	3.3e-33
WP_035163922.1|1482024_1483083_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.6	1.5e-41
WP_005727388.1|1484738_1485917_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	3.3e-37
WP_005729463.1|1486638_1487733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005727573.1|1487719_1488343_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_060785176.1|1488727_1490104_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_005727342.1|1490198_1491056_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080592481.1|1492389_1492935_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_080543679.1|1493191_1494421_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	41.5	1.4e-78
WP_005727575.1|1494660_1495155_-	thiol peroxidase	NA	NA	NA	NA	NA
WP_005720278.1|1495320_1495479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005729027.1|1495584_1496763_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.5	9.7e-37
WP_005727580.1|1497047_1497968_+	MFS transporter	NA	NA	NA	NA	NA
WP_080729508.1|1497983_1498850_+	MFS transporter	NA	NA	NA	NA	NA
WP_005727583.1|1498942_1500025_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005729559.1|1500114_1500606_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005720285.1|1500607_1501264_+	glucose-6-phosphate 1-dehydrogenase	NA	NA	NA	NA	NA
WP_005722883.1|1501703_1501943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005729560.1|1502164_1503760_+	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	21.2	1.2e-13
WP_005727505.1|1503976_1505155_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	3.3e-37
WP_005727589.1|1505241_1506720_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	20.6	1.3e-14
WP_005727590.1|1506849_1508241_+	amino acid permease	NA	NA	NA	NA	NA
WP_005722891.1|1508356_1509313_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	60.5	1.2e-114
WP_005722894.1|1509322_1509832_+	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	39.5	1.7e-25
WP_060785157.1|1509917_1512320_+	HAD-IC family P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	26.3	5.0e-40
WP_005727592.1|1512361_1513303_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_005727594.1|1513721_1514576_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005722902.1|1514588_1515653_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.2	9.7e-28
WP_155872511.1|1515645_1516302_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005728396.1|1516284_1517142_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_005722356.1|1517450_1518854_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_005720301.1|1518866_1520243_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	32.8	2.1e-54
WP_005720302.1|1520439_1521369_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_005722910.1|1521504_1522821_+	C1 family peptidase	NA	NA	NA	NA	NA
WP_005720304.1|1524879_1525578_+	RraA family protein	NA	NA	NA	NA	NA
WP_005727599.1|1525594_1527064_+	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_005721666.1|1527261_1528632_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_005727600.1|1528824_1529616_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005726917.1|1529696_1530752_+	[citrate (pro-3S)-lyase] ligase	NA	NA	NA	NA	NA
WP_005720311.1|1530741_1531035_+	citrate lyase acyl carrier protein	NA	NA	NA	NA	NA
WP_005726916.1|1531035_1531950_+	citrate lyase	NA	NA	NA	NA	NA
WP_005727602.1|1531939_1533481_+	citrate lyase subunit alpha	NA	NA	NA	NA	NA
WP_005722922.1|1533897_1534353_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_005722925.1|1534561_1535395_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_005726913.1|1535387_1537097_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.3	1.7e-18
WP_005720320.1|1537100_1537658_-	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005720116.1|1537815_1538196_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_005726911.1|1538496_1538823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005720123.1|1538870_1539809_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005727607.1|1539972_1541319_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_031266736.1|1541382_1541622_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_005727610.1|1543944_1544454_-|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_005727612.1|1544514_1545459_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_005727613.1|1545514_1545877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005720132.1|1545891_1548132_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1X9SH80	Bradyrhizobium_phage	36.4	2.3e-10
WP_005720133.1|1548131_1548569_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_005727614.1|1548864_1550151_+|tRNA	histidine--tRNA ligase	tRNA	A0A1V0S921	Catovirus	26.3	1.2e-24
WP_005727615.1|1550156_1552010_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_005727617.1|1552075_1553260_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_005727618.1|1553417_1554596_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	1.7e-36
WP_005727619.1|1554758_1555016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043884411.1|1555103_1556138_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.0	1.1e-39
>prophage 18
NZ_CP046311	Lactobacillus crispatus strain FDAARGOS_743 chromosome, complete genome	2373487	1575672	1628125	2373487	transposase,protease,tRNA,integrase	Corynebacterium_phage(16.67%)	47	1619376:1619390	1629479:1629493
WP_005727624.1|1575672_1576851_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	7.4e-37
WP_005720158.1|1577109_1578072_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_005720160.1|1578105_1579875_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_005720162.1|1580001_1580895_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_005720164.1|1580881_1581787_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.6	1.7e-36
WP_005727626.1|1581795_1582158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005720168.1|1582144_1582885_+	segregation and condensation protein A	NA	NA	NA	NA	NA
WP_005720170.1|1582874_1583465_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	5.1e-18
WP_005720172.1|1583468_1584185_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005720173.1|1584402_1585092_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_005725874.1|1585193_1585655_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005729574.1|1585706_1586378_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_005720179.1|1586450_1587659_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_005720181.1|1587729_1589037_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_005720183.1|1589196_1589472_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	64.0	7.1e-23
WP_081079901.1|1590840_1592124_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_005727388.1|1592906_1594085_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	3.3e-37
WP_005729577.1|1594151_1594673_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005727631.1|1594712_1595522_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005727632.1|1595560_1596739_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_005720194.1|1597361_1598051_+	F420-0--gamma-glutamyl ligase	NA	NA	NA	NA	NA
WP_005722336.1|1598110_1598611_+	kinase	NA	NA	NA	NA	NA
WP_005720198.1|1598613_1599066_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_005727342.1|1599181_1600039_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_005722335.1|1600051_1600813_+	nucleoside phosphorylase	NA	F5CA76	Streptococcus_phi-m46.1-like_phage	47.2	3.7e-37
WP_005720202.1|1600844_1601609_+	nucleoside phosphorylase	NA	F5CA76	Streptococcus_phi-m46.1-like_phage	47.5	6.7e-39
WP_005720204.1|1601650_1602466_-	AAC(3) family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005727388.1|1602865_1604044_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	3.3e-37
WP_005720210.1|1605692_1606193_+	lactocepin s-layer protein	NA	NA	NA	NA	NA
WP_005726217.1|1606236_1607121_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	38.2	3.1e-51
WP_005720213.1|1607209_1608409_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	G3MAR3	Bacillus_virus	41.5	1.8e-38
WP_005720215.1|1608445_1609111_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_005722333.1|1609224_1610076_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	40.3	7.3e-18
WP_005722332.1|1610078_1610309_+	YozE family protein	NA	NA	NA	NA	NA
WP_005720229.1|1611972_1612812_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_005720231.1|1612808_1613561_+	ribonuclease HII	NA	D2TEQ2	Emiliania_huxleyi_virus	36.0	1.3e-23
WP_005720233.1|1613623_1614472_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_005720234.1|1614541_1616653_+	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	37.1	4.7e-98
WP_005720236.1|1616675_1617992_+|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_005729587.1|1617991_1618900_+	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	36.2	6.4e-20
WP_005720240.1|1618908_1619433_+	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
1619376:1619390	attL	GATTGCTTCAGGAAT	NA	NA	NA	NA
WP_005722328.1|1619444_1620842_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IB03	Erwinia_phage	26.2	5.2e-29
WP_005720244.1|1621001_1621898_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_005727726.1|1623852_1624890_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	39.6	1.5e-33
WP_005721179.1|1624856_1625564_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	40.2	4.8e-39
WP_005728108.1|1625829_1627056_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	49.4	2.3e-97
WP_005722326.1|1627309_1628125_-|integrase	integrase	integrase	NA	NA	NA	NA
1629479:1629493	attR	ATTCCTGAAGCAATC	NA	NA	NA	NA
>prophage 19
NZ_CP046311	Lactobacillus crispatus strain FDAARGOS_743 chromosome, complete genome	2373487	1639405	1684008	2373487	transposase	Corynebacterium_phage(25.0%)	37	NA	NA
WP_005727735.1|1639405_1640263_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_005728252.1|1640459_1641809_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_005719566.1|1641982_1642435_+	Trp operon repressor	NA	NA	NA	NA	NA
WP_126708831.1|1642846_1644025_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.7	8.8e-38
WP_005722315.1|1644225_1646739_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	31.1	1.9e-138
WP_005719570.1|1646889_1647879_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_005719573.1|1647875_1648103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060785166.1|1648134_1648743_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_005727342.1|1648758_1649616_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_005729593.1|1649926_1650976_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.2	6.8e-50
WP_005719578.1|1651037_1651487_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005719579.1|1651503_1652118_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_031266958.1|1652263_1653370_+	serine hydrolase	NA	NA	NA	NA	NA
WP_005722309.1|1653435_1654266_+	pyridoxamine kinase	NA	NA	NA	NA	NA
WP_005719583.1|1654268_1654835_+	membrane protein	NA	NA	NA	NA	NA
WP_005719584.1|1654909_1656115_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_005719585.1|1656560_1657016_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005719587.1|1657029_1658313_+	peptidase T	NA	NA	NA	NA	NA
WP_005727739.1|1658665_1659928_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	38.4	7.9e-69
WP_005727741.1|1660068_1660470_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_005727743.1|1660534_1662469_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_005729597.1|1662663_1663389_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_005722304.1|1663398_1665066_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_005721176.1|1665383_1666622_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	46.2	5.0e-84
WP_005722676.1|1666985_1667423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005719600.1|1667705_1668983_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005722407.1|1669343_1669709_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_005719603.1|1669812_1671039_+	serine/threonine protein phosphatase	NA	NA	NA	NA	NA
WP_005719604.1|1671073_1671232_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_005719605.1|1671376_1673470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005719606.1|1673607_1676826_+	type I restriction-modification system endonuclease	NA	A0A1D8EYF5	Mycobacterium_phage	22.6	4.0e-08
WP_005719607.1|1676920_1678222_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_005719608.1|1678202_1678784_+	RloB domain-containing protein	NA	NA	NA	NA	NA
WP_005719609.1|1678798_1680250_+	type I restriction-modification system subunit M	NA	A0A220A2U4	Liberibacter_phage	27.1	2.5e-26
WP_005727746.1|1680239_1681682_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_005727342.1|1681695_1682553_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_005727505.1|1682829_1684008_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	3.3e-37
>prophage 20
NZ_CP046311	Lactobacillus crispatus strain FDAARGOS_743 chromosome, complete genome	2373487	1704835	1714745	2373487	transposase	Lactobacillus_phage(33.33%)	8	NA	NA
WP_005719637.1|1704835_1706713_+	DNA mismatch repair protein	NA	F2QAG1	Chrysochromulina_ericina_virus	26.3	5.4e-21
WP_005719639.1|1706766_1707834_-	tyrosine recombinase XerS	NA	A0A0E3T6W0	Gordonia_phage	31.9	5.2e-05
WP_005719641.1|1708336_1708795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005719642.1|1708839_1709451_-	DUF5052 family protein	NA	A0A2K9VCV0	Lactobacillus_phage	43.6	3.0e-37
WP_005726784.1|1709600_1710758_-	lysin	NA	Q38317	Lactobacillus_phage	52.4	6.8e-59
WP_005727505.1|1711104_1712283_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	3.3e-37
WP_005727307.1|1712495_1712756_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005727505.1|1713566_1714745_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	3.3e-37
>prophage 21
NZ_CP046311	Lactobacillus crispatus strain FDAARGOS_743 chromosome, complete genome	2373487	1747579	1887569	2373487	transposase,protease,tRNA	Corynebacterium_phage(19.35%)	117	NA	NA
WP_005719685.1|1747579_1748878_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	26.5	3.0e-47
WP_005719686.1|1748931_1749429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060463972.1|1752223_1755832_-	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	25.4	2.1e-26
WP_005719689.1|1755834_1759314_-	ATP-dependent helicase/nuclease RexB	NA	NA	NA	NA	NA
WP_005723089.1|1759392_1760301_+	mevalonate kinase	NA	NA	NA	NA	NA
WP_005719691.1|1760300_1761263_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_005719692.1|1761305_1762388_+	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_005722377.1|1762399_1763416_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_005719694.1|1763468_1764260_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_005722376.1|1764256_1765630_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_005722375.1|1765610_1766588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005719700.1|1766577_1767330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005722374.1|1767412_1767976_+	signal peptidase I	NA	NA	NA	NA	NA
WP_005719704.1|1768047_1768236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005719705.1|1768294_1769113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005719706.1|1769133_1769943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005719707.1|1769952_1770783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005723095.1|1770782_1771490_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	1.3e-15
WP_005722371.1|1771482_1771857_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005719711.1|1772163_1773405_-	peptidase T	NA	NA	NA	NA	NA
WP_005719713.1|1774218_1774902_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_005719714.1|1775002_1775443_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_005719715.1|1775442_1776117_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_005719716.1|1776163_1777276_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	37.6	1.8e-37
WP_005719718.1|1777291_1779112_-	DNA primase	NA	A0A1S5RH03	Helicobacter_phage	28.1	4.8e-35
WP_005719719.1|1779141_1781205_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_005719721.1|1781197_1782115_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_060785087.1|1782374_1783130_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_005719725.1|1783499_1784402_-	GTPase Era	NA	NA	NA	NA	NA
WP_005719727.1|1784401_1784926_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_005723097.1|1784928_1785888_-	PhoH family protein	NA	H6X2N1	Pseudomonas_phage	46.1	1.7e-47
WP_005719731.1|1785913_1786357_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	32.9	1.9e-14
WP_002880182.1|1786517_1786694_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_005719759.1|1786921_1787758_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_005724791.1|1788376_1788625_-	type II-A CRISPR-associated protein Csn2	NA	NA	NA	NA	NA
WP_101885619.1|1788687_1789866_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.5	3.0e-38
WP_005724793.1|1789987_1790422_-	type II-A CRISPR-associated protein Csn2	NA	NA	NA	NA	NA
WP_005728741.1|1790418_1790724_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_005722367.1|1790701_1791610_-	type II CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_005728740.1|1791813_1792857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155872514.1|1793569_1795261_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	37.9	4.6e-88
WP_005728738.1|1795198_1797772_-	type II CRISPR RNA-guided endonuclease Cas9	NA	NA	NA	NA	NA
WP_005728075.1|1797930_1799109_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.6	7.4e-37
WP_005728076.1|1799451_1800075_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_005726248.1|1800145_1800712_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_005719205.1|1802059_1802938_-	YitT family protein	NA	NA	NA	NA	NA
WP_005729620.1|1803108_1803756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005719209.1|1803781_1804645_-	homoserine kinase	NA	NA	NA	NA	NA
WP_005719211.1|1804658_1805894_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005719213.1|1806005_1807496_+	threonine synthase	NA	NA	NA	NA	NA
WP_005719215.1|1807515_1808883_+	aspartate kinase	NA	NA	NA	NA	NA
WP_005727342.1|1809425_1810283_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155872517.1|1810660_1811839_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.1	9.7e-37
WP_005719218.1|1812054_1814370_+	phospholipase	NA	NA	NA	NA	NA
WP_005719221.1|1814427_1814799_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_005719223.1|1814799_1815366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005719224.1|1815443_1815683_+	galactose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_005728084.1|1816071_1816452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155872521.1|1816490_1817669_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.1	5.7e-37
WP_005728085.1|1818116_1819658_-	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	24.4	2.0e-13
WP_005727388.1|1819814_1820993_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	3.3e-37
WP_005728089.1|1821308_1822166_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_005726445.1|1822342_1823005_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_005719232.1|1823100_1823649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005719233.1|1823738_1824356_-	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_005722145.1|1824522_1825689_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005719236.1|1825804_1826341_-	citrate lyase holo-[acyl-carrier protein] synthase	NA	NA	NA	NA	NA
WP_060785122.1|1826354_1827215_-	peptide transporter	NA	NA	NA	NA	NA
WP_005726441.1|1827175_1827607_-	peptide transporter	NA	NA	NA	NA	NA
WP_005719240.1|1827617_1828847_-	arginine deiminase	NA	NA	NA	NA	NA
WP_005723104.1|1828920_1829769_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013086476.1|1829897_1832171_+	HAD-IC family P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	27.6	1.3e-45
WP_005719245.1|1832238_1832553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005727388.1|1832699_1833878_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	3.3e-37
WP_080543270.1|1834019_1834391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005719249.1|1834796_1835891_+	DUF871 domain-containing protein	NA	NA	NA	NA	NA
WP_005727340.1|1836154_1837381_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.4	5.6e-96
WP_005722137.1|1837616_1838144_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	39.3	5.5e-24
WP_005722136.1|1840644_1841331_-	class A sortase	NA	NA	NA	NA	NA
WP_005723108.1|1841333_1843172_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.1	8.9e-21
WP_005726875.1|1843388_1844540_-	molecular chaperone DnaJ	NA	Q8QNB4	Ectocarpus_siliculosus_virus	25.4	4.9e-25
WP_005719256.1|1844622_1846476_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	48.8	3.3e-140
WP_005719257.1|1846492_1847077_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_005728092.1|1847089_1848139_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_005728686.1|1848275_1849211_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_005719263.1|1849231_1850125_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_005719265.1|1850180_1850546_-	ribosome-binding factor A	NA	NA	NA	NA	NA
WP_005728093.1|1850565_1853169_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.9	1.5e-21
WP_005719268.1|1853173_1853485_-	50S ribosomal protein L7ae	NA	NA	NA	NA	NA
WP_005719270.1|1853487_1853784_-	YlxR family protein	NA	NA	NA	NA	NA
WP_005726872.1|1853792_1854986_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_005722018.1|1855005_1855482_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_005723111.1|1855592_1859903_-	PolC-type DNA polymerase III	NA	Q8W6C3	Saccharomonospora_phage	22.1	3.3e-26
WP_060785130.1|1859908_1861606_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_005719280.1|1861633_1862890_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_005719281.1|1862902_1863718_-	phosphatidate cytidylyltransferase	NA	A0A2K9L268	Tupanvirus	29.9	2.3e-05
WP_005719282.1|1863720_1864455_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	39.0	2.5e-22
WP_005719284.1|1864457_1865015_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_005719286.1|1865014_1865740_-	UMP kinase	NA	NA	NA	NA	NA
WP_005719289.1|1865884_1866910_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_005719291.1|1866943_1867717_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_060785131.1|1867881_1868913_-	methyltransferase	NA	NA	NA	NA	NA
WP_060785132.1|1868976_1869591_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_060785133.1|1869694_1870858_+	class I SAM-dependent methyltransferase	NA	A0A2K9L0U7	Tupanvirus	33.4	1.9e-45
WP_005718145.1|1871167_1871515_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005725993.1|1871579_1871810_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101891605.1|1871724_1873092_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	29.4	9.9e-41
WP_155872541.1|1873222_1876558_-	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_005727482.1|1876708_1877566_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_060785193.1|1877708_1879652_-	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	28.8	1.0e-62
WP_035164034.1|1879772_1880630_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_060785177.1|1882506_1884273_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.9	3.7e-48
WP_013438154.1|1884356_1884575_-	YneF family protein	NA	NA	NA	NA	NA
WP_155634295.1|1884640_1884907_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_060785178.1|1885063_1885690_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	50.7	5.2e-13
WP_060785179.1|1885728_1886490_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_005729050.1|1886534_1887569_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.9	7.5e-41
>prophage 22
NZ_CP046311	Lactobacillus crispatus strain FDAARGOS_743 chromosome, complete genome	2373487	1959362	2064615	2373487	transposase,protease,integrase	Corynebacterium_phage(35.29%)	85	1959263:1959300	2008380:2008417
1959263:1959300	attL	AATACGCGTGGTGCTAGTTAAATCGTTTTAGTTAATAA	NA	NA	NA	NA
WP_005727342.1|1959362_1960220_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_005728153.1|1960216_1960666_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_005726124.1|1960681_1960963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005724976.1|1961088_1961952_-	sugar transporter	NA	NA	NA	NA	NA
WP_005724978.1|1962096_1963623_-	L-lactate permease	NA	NA	NA	NA	NA
WP_005728151.1|1963886_1967075_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_005728149.1|1967067_1968153_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.0	1.9e-55
WP_005728147.1|1968152_1969430_-	dihydroorotase	NA	NA	NA	NA	NA
WP_005728145.1|1969429_1970386_-	aspartate carbamoyltransferase catalytic subunit	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	33.7	2.7e-21
WP_005728144.1|1970526_1971069_-	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_005728656.1|1971237_1972161_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_005726123.1|1972411_1973116_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_005721958.1|1973117_1973756_+	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	31.9	5.8e-28
WP_005719463.1|1973810_1974458_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_005728142.1|1974701_1975880_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.4	1.1e-37
WP_042747419.1|1975951_1976179_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080543272.1|1976169_1976592_+	FCD domain-containing protein	NA	NA	NA	NA	NA
WP_005719466.1|1976727_1977168_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_005728484.1|1977174_1977534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005724986.1|1979228_1980599_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_005728650.1|1982069_1982633_-|integrase	tyrosine-type recombinase/integrase	integrase	A3F636	Streptococcus_phage	31.6	8.0e-13
WP_005726889.1|1982973_1983351_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_005719479.1|1983350_1983596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005728647.1|1985088_1985748_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_005724991.1|1986081_1989861_-	type I pullulanase	NA	NA	NA	NA	NA
WP_155872547.1|1990096_1991275_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.1	2.0e-37
WP_005723286.1|1991558_1992758_+	acetate kinase	NA	NA	NA	NA	NA
WP_060785106.1|1992813_1994310_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_005723292.1|1994431_1995085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005728136.1|1996744_1997497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005726976.1|1997549_1998062_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_005723299.1|1998065_1998470_-	OsmC family protein	NA	NA	NA	NA	NA
WP_005723301.1|1998479_1999652_-	MFS transporter	NA	NA	NA	NA	NA
WP_005723304.1|2000973_2001639_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.5	1.8e-24
WP_005723306.1|2001646_2002207_-	GTP pyrophosphokinase	NA	NA	NA	NA	NA
WP_005727388.1|2002364_2003543_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	3.3e-37
WP_005723311.1|2004554_2005511_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_005719540.1|2005567_2005801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005727342.1|2005859_2006717_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_005726106.1|2006924_2008328_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_005727388.1|2008531_2009710_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	3.3e-37
2008380:2008417	attR	TTATTAACTAAAACGATTTAACTAGCACCACGCGTATT	NA	NA	NA	NA
WP_005723314.1|2009886_2010882_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_005719543.1|2011005_2012475_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_005728135.1|2012493_2013657_-	galactokinase	NA	NA	NA	NA	NA
WP_005725893.1|2013823_2015812_-	beta-galactosidase	NA	NA	NA	NA	NA
WP_005726611.1|2017925_2018930_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005728132.1|2021022_2021976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005726606.1|2022080_2023073_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.1	4.5e-51
WP_005726605.1|2023183_2024059_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_005719553.1|2024055_2024646_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_005719554.1|2025000_2026032_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_155872550.1|2026083_2027463_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.7	1.1e-55
WP_118992304.1|2027728_2028955_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.9	5.6e-96
WP_043884491.1|2029202_2030252_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	32.9	3.2e-47
WP_013437702.1|2030296_2030539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005727505.1|2030720_2031899_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	28.8	3.3e-37
WP_005729501.1|2032040_2032763_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005729502.1|2032772_2034254_+	family 1 glycosylhydrolase	NA	NA	NA	NA	NA
WP_005729503.1|2034356_2034767_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_005727482.1|2035904_2036762_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_042747413.1|2037371_2037749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005727426.1|2037968_2039147_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.1	2.0e-37
WP_005728116.1|2039375_2039747_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_005728115.1|2039787_2040126_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_005728114.1|2040491_2041196_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043884490.1|2041282_2042722_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_005728112.1|2042814_2043441_-	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_005728111.1|2043571_2044498_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_005728110.1|2044524_2045040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005728109.1|2045049_2045316_-	FMN-binding protein	NA	NA	NA	NA	NA
WP_155872553.1|2045603_2046830_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	49.4	1.8e-97
WP_005727398.1|2047097_2047955_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_005728106.1|2048268_2049879_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_005728105.1|2049921_2050965_-	serine hydrolase	NA	NA	NA	NA	NA
WP_005728103.1|2051127_2052186_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005728102.1|2052185_2053361_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_005718904.1|2053372_2054152_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_005718903.1|2054158_2055085_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_005722819.1|2055086_2056241_-	N-acetyldiaminopimelate deacetylase	NA	NA	NA	NA	NA
WP_005718901.1|2056242_2056950_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
WP_005718900.1|2056964_2058275_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_005721316.1|2058733_2060089_+	aspartate kinase	NA	NA	NA	NA	NA
WP_005718898.1|2060097_2061102_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_005718893.1|2062769_2063360_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_005721319.1|2063349_2064615_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.5	1.6e-130
>prophage 23
NZ_CP046311	Lactobacillus crispatus strain FDAARGOS_743 chromosome, complete genome	2373487	2133809	2243735	2373487	terminase,protease,transposase,tRNA,plate,tail	Lactobacillus_phage(28.95%)	113	NA	NA
WP_005729050.1|2133809_2134844_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.9	7.5e-41
WP_005722794.1|2134945_2136163_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_005724543.1|2136162_2137323_-	cysteine desulfurase	NA	NA	NA	NA	NA
WP_005718795.1|2137410_2139123_-	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_005721374.1|2139407_2140019_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_005718792.1|2140110_2140578_+	YueI family protein	NA	NA	NA	NA	NA
WP_005718790.1|2140578_2141886_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	51.2	4.3e-102
WP_005718786.1|2142196_2142478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005718784.1|2142538_2143003_+	universal stress protein	NA	NA	NA	NA	NA
WP_005721375.1|2143083_2144277_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_005718781.1|2144298_2144526_-	DUF2969 domain-containing protein	NA	NA	NA	NA	NA
WP_005721376.1|2144534_2144828_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	55.1	1.4e-16
WP_005718778.1|2144841_2145831_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_005718777.1|2145914_2146145_-	DUF1146 domain-containing protein	NA	NA	NA	NA	NA
WP_005718776.1|2146211_2146652_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_005718775.1|2146663_2148103_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_005718774.1|2148125_2149088_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_005724540.1|2149098_2150610_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_005722786.1|2150624_2151173_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_005718771.1|2151172_2151679_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_005718768.1|2151735_2151960_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_005718767.1|2151980_2152694_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_005718766.1|2152816_2153446_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_005727080.1|2153530_2154535_-	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	38.2	6.1e-48
WP_005718764.1|2154537_2155383_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005718763.1|2155375_2156464_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	37.8	3.1e-05
WP_005718762.1|2156480_2157080_-	thymidine kinase	NA	A0A1W6JKV9	Lactococcus_phage	49.0	2.4e-47
WP_005718761.1|2157215_2158568_+	Mur ligase family protein	NA	NA	NA	NA	NA
WP_005718760.1|2158875_2159886_+	serine hydrolase	NA	S5Z991	Mycobacterium_phage	22.4	4.9e-05
WP_005727079.1|2159994_2161368_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005718758.1|2161489_2162827_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_005721383.1|2162914_2163517_-	VanZ family protein	NA	NA	NA	NA	NA
WP_005728521.1|2163659_2165840_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	42.3	1.9e-147
WP_005718754.1|2165881_2167336_-	HAMP domain-containing histidine kinase	NA	A0A1X9VNV7	Mimivirus	25.5	1.9e-05
WP_005721385.1|2167335_2168058_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.7e-37
WP_005721386.1|2168060_2168450_-	SdpI family protein	NA	NA	NA	NA	NA
WP_005718751.1|2168485_2169448_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_100068040.1|2170712_2171603_-	DUF3737 family protein	NA	NA	NA	NA	NA
WP_005724829.1|2172010_2172352_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A9D9Y1	Lactobacillus_prophage	75.0	8.1e-45
WP_005724831.1|2172388_2172664_-	hypothetical protein	NA	A9D9X7	Lactobacillus_prophage	83.5	2.8e-40
WP_005721389.1|2172896_2173157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005724832.1|2173179_2173467_-	DUF3850 domain-containing protein	NA	U5U430	Lactobacillus_phage	55.6	3.7e-14
WP_005728142.1|2173542_2174721_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.4	1.1e-37
WP_060463651.1|2174906_2175698_-	ParA family protein	NA	E2ELL2	Clostridium_phage	27.7	1.8e-15
WP_020992880.1|2176138_2176426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005723179.1|2176425_2176734_+	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_035458603.1|2177347_2178622_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A2K9VD29	Lactobacillus_phage	26.2	1.7e-23
WP_005728427.1|2178563_2179229_-|transposase	IS607 family transposase	transposase	Q331V0	Clostridium_botulinum_C_phage	52.3	1.3e-57
WP_060462714.1|2180364_2182431_-	N-6 DNA methylase	NA	A0A2H4JBT5	uncultured_Caudovirales_phage	33.2	5.2e-86
WP_005723185.1|2182543_2183017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060785149.1|2183839_2185171_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	39.4	2.1e-64
WP_060785150.1|2185200_2185800_-|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	42.1	5.1e-34
WP_060785151.1|2185918_2186137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155872558.1|2186147_2186828_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005728010.1|2186808_2187075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155872561.1|2187084_2189661_-	type IA DNA topoisomerase	NA	NA	NA	NA	NA
WP_155872463.1|2189950_2191129_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	30.1	2.3e-38
WP_005723195.1|2191332_2191662_-	toxin MazF	NA	NA	NA	NA	NA
WP_005724846.1|2191654_2191930_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_081090747.1|2192093_2193554_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_148239080.1|2193577_2193964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005724850.1|2194200_2194983_-	Fic family protein	NA	NA	NA	NA	NA
WP_155872564.1|2195752_2196841_-	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_043884477.1|2196945_2198556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005727993.1|2198655_2199015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005723208.1|2199029_2199257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005723210.1|2199277_2199610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005724856.1|2199949_2200819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005724858.1|2200830_2201079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005728982.1|2201081_2201483_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005724860.1|2201484_2202126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005727984.1|2202726_2204187_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A288TY55	Enterococcus_phage	55.3	1.5e-15
WP_005727982.1|2204186_2206196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005727981.1|2206205_2206829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005721436.1|2206806_2207133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005727978.1|2207136_2209851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005727281.1|2209895_2211674_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_005719066.1|2212126_2212336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035450187.1|2213215_2214337_-	lysin	NA	L0P6H6	Lactobacillus_phage	82.3	8.6e-176
WP_005724871.1|2214429_2214828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005729628.1|2214827_2215058_-	hypothetical protein	NA	L0P6E4	Lactobacillus_phage	61.8	2.2e-17
WP_005724874.1|2215041_2215263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005724875.1|2215271_2215661_-	hypothetical protein	NA	B8R662	Lactobacillus_phage	29.5	1.8e-08
WP_005724876.1|2215629_2215812_-	XkdX family protein	NA	NA	NA	NA	NA
WP_005724877.1|2215830_2216457_-	hypothetical protein	NA	L0P6H5	Lactobacillus_phage	37.9	7.7e-25
WP_005724878.1|2216541_2216934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005724880.1|2217304_2219290_-	hypothetical protein	NA	Q9T1E3	Lactobacillus_phage	30.1	1.8e-19
WP_005724881.1|2219306_2220056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005727971.1|2220045_2221227_-|plate	baseplate J/gp47 family protein	plate	A8ATI2	Listeria_phage	33.9	2.1e-55
WP_005724883.1|2221223_2221568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060785121.1|2221578_2222061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005728965.1|2222073_2223201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005724886.1|2223200_2223611_-	hypothetical protein	NA	D6PSZ5	Lactobacillus_phage	34.1	4.9e-12
WP_005728964.1|2223623_2224577_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005724888.1|2224594_2230072_-|tail	phage tail tape measure protein	tail	Q9AZS0	Lactococcus_phage	31.9	1.1e-37
WP_005719037.1|2230117_2230363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005719035.1|2230334_2230781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005719033.1|2230839_2231271_-	DUF3277 family protein	NA	A8ATH3	Listeria_phage	29.8	1.7e-10
WP_005728963.1|2231285_2232620_-	DUF3383 family protein	NA	A8ATH2	Listeria_phage	37.6	3.3e-49
WP_035450191.1|2232623_2233169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005724896.1|2233146_2233566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005719024.1|2233575_2234247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005719022.1|2234243_2234630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005719020.1|2234646_2235606_-	DUF2184 domain-containing protein	NA	NA	NA	NA	NA
WP_005719018.1|2235620_2236157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005719016.1|2236156_2237368_-	DUF2213 domain-containing protein	NA	D6PSX5	Lactobacillus_phage	35.0	2.5e-35
WP_005724903.1|2237367_2237724_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005719013.1|2237734_2238538_-	hypothetical protein	NA	L7TMD0	Rhizobium_phage	30.7	9.9e-17
WP_005724905.1|2238524_2239910_-	DUF1073 domain-containing protein	NA	D6PSX2	Lactobacillus_phage	32.7	5.8e-49
WP_005724906.1|2239922_2241395_-|terminase	phage terminase large subunit	terminase	A5GYP8	Lactococcus_phage	49.3	2.0e-124
WP_005724908.1|2241391_2241964_-|terminase	terminase small subunit	terminase	A0A182BQ99	Lactococcus_phage	33.1	5.2e-12
WP_005726049.1|2242010_2242229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005724912.1|2243231_2243735_-	ArpU family transcriptional regulator	NA	B8R690	Lactobacillus_phage	38.2	2.3e-11
>prophage 24
NZ_CP046311	Lactobacillus crispatus strain FDAARGOS_743 chromosome, complete genome	2373487	2249129	2259039	2373487	integrase,transposase	Lactobacillus_phage(62.5%)	14	2242371:2242386	2258656:2258671
2242371:2242386	attL	CGAAAAAAAGCACTGG	NA	NA	NA	NA
WP_005726061.1|2249129_2250008_-	DUF1351 domain-containing protein	NA	A0A0P0IV40	Lactobacillus_phage	25.6	1.2e-20
WP_005718968.1|2250010_2250376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005718966.1|2250629_2250875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005726064.1|2250879_2251179_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005718964.1|2251268_2251685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005718959.1|2252398_2252617_-	hypothetical protein	NA	Q9T1J1	Lactobacillus_phage	42.4	1.8e-05
WP_005718957.1|2252629_2253373_-	phage antirepressor Ant	NA	A9D9L9	Lactobacillus_prophage	71.4	1.1e-94
WP_005718955.1|2253407_2253617_-	helix-turn-helix transcriptional regulator	NA	A9D9J9	Lactobacillus_prophage	47.1	1.0e-10
WP_005726068.1|2253787_2254135_+	helix-turn-helix transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	42.0	1.1e-17
WP_005726069.1|2254144_2254543_+	ImmA/IrrE family metallo-endopeptidase	NA	O48433	Lactobacillus_phage	41.9	1.1e-19
WP_005726070.1|2254607_2255201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005726071.1|2255214_2255553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005724939.1|2255639_2256788_+|integrase	site-specific integrase	integrase	U3PCM7	Lactobacillus_phage	35.7	1.4e-59
WP_005727335.1|2257860_2259039_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	26.9	7.7e-34
2258656:2258671	attR	CGAAAAAAAGCACTGG	NA	NA	NA	NA
>prophage 25
NZ_CP046311	Lactobacillus crispatus strain FDAARGOS_743 chromosome, complete genome	2373487	2277892	2349551	2373487	integrase,tRNA,transposase	Lactobacillus_phage(19.05%)	71	2276620:2276636	2339009:2339025
2276620:2276636	attL	AATATCAATTTTGTCAT	NA	NA	NA	NA
WP_021355762.1|2277892_2278237_-	DUF771 domain-containing protein	NA	Q37943	Lactococcus_phage	46.2	8.8e-23
WP_060785141.1|2278239_2279010_-	HTH domain-containing protein	NA	X2CYF1	Lactobacillus_phage	41.6	2.6e-14
WP_021355760.1|2279046_2279256_-	helix-turn-helix transcriptional regulator	NA	A9D9J9	Lactobacillus_prophage	51.5	5.5e-12
WP_060785142.1|2279434_2279788_+	helix-turn-helix transcriptional regulator	NA	Q9T1J3	Lactobacillus_phage	39.0	6.1e-11
WP_155872580.1|2279803_2280208_+	ImmA/IrrE family metallo-endopeptidase	NA	O48433	Lactobacillus_phage	41.9	1.7e-20
WP_060463835.1|2280355_2281468_+|integrase	site-specific integrase	integrase	E9LUK6	Lactobacillus_phage	44.5	9.7e-79
WP_005722775.1|2281960_2283145_-	acetate kinase	NA	NA	NA	NA	NA
WP_005727832.1|2283189_2284191_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_005727833.1|2284385_2284913_-	ComGF family competence protein	NA	NA	NA	NA	NA
WP_005728527.1|2284866_2285136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005727835.1|2285132_2285558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005721477.1|2285532_2285874_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_005718741.1|2285934_2286936_-	type II secretion system protein F	NA	NA	NA	NA	NA
WP_005718739.1|2286904_2287879_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005718738.1|2288078_2288807_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005727836.1|2288891_2289413_-	VanZ family protein	NA	NA	NA	NA	NA
WP_005722770.1|2289483_2290125_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_005722769.1|2290137_2290323_-	type Z 30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_005727838.1|2290604_2291651_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	43.0	1.2e-41
WP_100068034.1|2291611_2292352_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	41.0	1.5e-35
WP_005724515.1|2292559_2294185_+	APC family permease	NA	NA	NA	NA	NA
WP_005727426.1|2294400_2295579_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	29.1	2.0e-37
WP_005722767.1|2295746_2296496_+	Firmicu-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_005722765.1|2296482_2298012_+	membrane protein	NA	NA	NA	NA	NA
WP_005722764.1|2298014_2299121_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	27.6	2.9e-06
WP_005722762.1|2299140_2299728_+	exosortase family protein XrtG	NA	NA	NA	NA	NA
WP_005727840.1|2299740_2301024_+	putative glycosyltransferase, exosortase G system-associated	NA	NA	NA	NA	NA
WP_005722758.1|2301013_2301382_+	6-pyruvoyltetrahydropterin synthase	NA	NA	NA	NA	NA
WP_005722756.1|2301396_2302113_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005722755.1|2302153_2303101_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005724509.1|2303229_2304705_-	family 1 glycosylhydrolase	NA	NA	NA	NA	NA
WP_005722753.1|2304746_2306768_-	PTS beta-glucoside transporter subunit EIIBCA	NA	NA	NA	NA	NA
WP_005718724.1|2306895_2307729_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_005722750.1|2307938_2309084_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.6	1.7e-41
WP_005718721.1|2309108_2309564_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_005718719.1|2309563_2310280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005718717.1|2310294_2310735_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_005718714.1|2311681_2313034_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_005718713.1|2313056_2314016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005718712.1|2314012_2314855_-	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_005718711.1|2314893_2315967_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005718710.1|2315963_2316779_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005721486.1|2316775_2317588_-	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	29.6	3.6e-14
WP_005727342.1|2318543_2319401_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_005718707.1|2319714_2320611_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_005718706.1|2320706_2321240_+	exonuclease	NA	M1PFD8	Streptococcus_phage	35.3	1.7e-20
WP_005718705.1|2321277_2321757_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_005718704.1|2321756_2322746_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_005718702.1|2322756_2323455_-	uracil-DNA glycosylase	NA	A0A0Y0A6W9	Macropodid_alphaherpesvirus	40.1	7.3e-40
WP_005718700.1|2323522_2324398_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_005721490.1|2324417_2324933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005721492.1|2325285_2326335_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	32.9	3.2e-47
WP_005718695.1|2326619_2327378_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_005721494.1|2327402_2328614_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_005718691.1|2328728_2329745_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_005721496.1|2329797_2330829_-	central glycolytic genes regulator	NA	NA	NA	NA	NA
WP_005728534.1|2331243_2332776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005718685.1|2332944_2334378_+	amino acid permease	NA	NA	NA	NA	NA
WP_005718683.1|2334444_2335230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005718681.1|2335313_2335751_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005721500.1|2335911_2337384_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_005727342.1|2337789_2338647_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_005718668.1|2339164_2339923_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
2339009:2339025	attR	ATGACAAAATTGATATT	NA	NA	NA	NA
WP_005718667.1|2339919_2340558_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	33.2	2.5e-18
WP_005718665.1|2340666_2342295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005718663.1|2342489_2343074_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	54.4	1.1e-52
WP_005722729.1|2343138_2344074_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	34.9	1.4e-46
WP_005718658.1|2344066_2345110_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	49.2	2.6e-86
WP_005718656.1|2345120_2346002_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.3	2.4e-08
WP_005718654.1|2346095_2346638_-	membrane protein	NA	NA	NA	NA	NA
WP_005721504.1|2346710_2349551_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	7.0e-307
>prophage 1
NZ_CP046312	Lactobacillus crispatus strain FDAARGOS_743 plasmid unnamed1, complete sequence	13473	3312	12380	13473		Streptococcus_phage(16.67%)	8	NA	NA
WP_005728424.1|3312_4425_-	replication initiator protein A	NA	M1PFC4	Streptococcus_phage	39.4	7.1e-13
WP_005728422.1|5003_5789_+	AAA family ATPase	NA	F0PIG8	Enterococcus_phage	35.6	1.2e-30
WP_005728419.1|5795_6011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005728417.1|6887_7493_+	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	40.8	2.2e-32
WP_021355456.1|8396_8534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005728415.1|8805_9813_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A160DHK0	Gordonia_phage	54.0	1.2e-96
WP_020807717.1|9796_10219_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	J9PTY0	Bacillus_phage	38.3	1.1e-11
WP_005729300.1|10211_12380_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0D3MSW9	Lactococcus_phage	48.2	3.2e-171
