The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046345	Burkholderia multivorans strain FDAARGOS_722 chromosome 2, complete sequence	792513	367267	374928	792513		uncultured_Caudovirales_phage(57.14%)	9	NA	NA
WP_012211083.1|367267_367939_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.7	2.5e-29
WP_009693503.1|367935_369330_+	heavy metal sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.7	1.6e-17
WP_012211084.1|369481_369877_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	42.1	1.4e-11
WP_012211085.1|370416_371154_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	75.5	3.0e-100
WP_009693508.1|371131_371554_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	71.4	2.6e-53
WP_009693509.1|371550_372783_-	MFS transporter	NA	NA	NA	NA	NA
WP_012210993.1|372784_373858_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_012210994.1|373921_374416_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	47.1	4.5e-28
WP_009693514.1|374433_374928_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	43.2	2.7e-25
>prophage 1
NZ_CP046346	Burkholderia multivorans strain FDAARGOS_722 chromosome 3, complete sequence	3432204	702775	742075	3432204	terminase,head,tail	Burkholderia_phage(57.5%)	61	NA	NA
WP_155822199.1|702775_703273_-	glycoside hydrolase family protein	NA	Q3HQU9	Burkholderia_phage	94.5	1.5e-84
WP_048996401.1|703265_703448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155822200.1|703567_704353_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_155822201.1|704684_704873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155822978.1|704881_705565_-|tail	phage tail protein	tail	A9YX14	Burkholderia_phage	59.0	1.4e-43
WP_155822202.1|705935_707447_-	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	37.7	3.1e-72
WP_155822203.1|707446_708628_-	hypothetical protein	NA	A9YX12	Burkholderia_phage	93.4	2.0e-199
WP_155822204.1|708624_708978_-	hypothetical protein	NA	A9YX11	Burkholderia_phage	95.7	4.3e-57
WP_155822205.1|708985_709735_-	hypothetical protein	NA	A9YX06	Burkholderia_phage	92.8	6.0e-125
WP_105839657.1|709738_710116_+	hypothetical protein	NA	A9YX05	Burkholderia_phage	83.2	8.1e-54
WP_155822206.1|710112_711078_-	hypothetical protein	NA	A9YX04	Burkholderia_phage	94.5	4.2e-155
WP_155822207.1|711124_711958_-	DNA-binding protein	NA	Q8SBE6	Shigella_phage	61.1	1.8e-29
WP_077056345.1|711957_712221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125902729.1|712241_712433_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_125902728.1|712514_712847_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_155822208.1|712847_713162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155822209.1|713161_713737_-	hypothetical protein	NA	I3PGV3	Xanthomonas_phage	25.7	7.4e-06
WP_155822210.1|713733_715788_-	mannosyl-glycoprotein endo-beta-N-acetylglucosamidase	NA	A0A0M4REK7	Salmonella_phage	36.2	1.1e-38
WP_155822211.1|715971_716526_-	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	35.6	3.1e-17
WP_069220302.1|716528_716969_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	58.9	6.8e-44
WP_155822212.1|716983_718459_-	DUF3383 family protein	NA	A0A0P0I492	Acinetobacter_phage	47.1	1.3e-110
WP_155822213.1|718468_719059_-	hypothetical protein	NA	A9YX29	Burkholderia_phage	94.9	1.6e-104
WP_155822214.1|719063_719435_-	hypothetical protein	NA	A9YX28	Burkholderia_phage	95.1	1.9e-63
WP_155822215.1|719496_719979_-	hypothetical protein	NA	A9YX26	Burkholderia_phage	88.7	3.8e-72
WP_155822216.1|720007_720391_-	DUF4054 domain-containing protein	NA	A9YX25	Burkholderia_phage	90.6	3.5e-60
WP_155822217.1|720399_720663_-	hypothetical protein	NA	A9YX24	Burkholderia_phage	74.0	5.2e-15
WP_155822218.1|720664_721702_-	DUF2184 domain-containing protein	NA	A0A0N7IRF2	Acinetobacter_phage	67.2	9.9e-126
WP_059594712.1|721712_722201_-	hypothetical protein	NA	A0A0P0I8F3	Acinetobacter_phage	56.8	1.9e-39
WP_155822219.1|722213_723497_-	DUF2213 domain-containing protein	NA	A0A0P0IRE1	Acinetobacter_phage	44.7	1.0e-68
WP_088924405.1|723498_723720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088925826.1|723721_724399_-|head	phage head morphogenesis protein	head	A9YWZ8	Burkholderia_phage	65.6	2.2e-73
WP_088925827.1|724292_725879_-	DUF1073 domain-containing protein	NA	A0A0P0I486	Acinetobacter_phage	60.3	7.9e-151
WP_155822220.1|725875_727471_-	TerL protein	NA	A9YWZ6	Burkholderia_phage	90.4	1.4e-293
WP_105775875.1|727472_728036_-|terminase	terminase small subunit	terminase	H2BD75	Pseudomonas_phage	66.5	9.6e-59
WP_155822221.1|728122_728302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155822222.1|728300_728447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155822223.1|728582_729014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081336772.1|729010_729304_-	hypothetical protein	NA	A9YWZ0	Burkholderia_phage	62.2	2.2e-22
WP_155822224.1|729350_729821_-	RusA family crossover junction endodeoxyribonuclease	NA	A9YWY9	Burkholderia_phage	80.8	2.4e-63
WP_155822225.1|729817_730078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155822226.1|730074_730821_-	hypothetical protein	NA	A0A0U1UNR3	Pseudomonas_phage	42.6	5.1e-23
WP_155822979.1|730823_731786_-	DUF1376 domain-containing protein	NA	H2BD69	Pseudomonas_phage	47.3	8.0e-29
WP_155822980.1|731842_732049_-	hypothetical protein	NA	A9YWY0	Burkholderia_phage	82.4	6.0e-27
WP_155822227.1|732051_732426_-	hypothetical protein	NA	A9YWX9	Burkholderia_phage	85.5	1.6e-57
WP_155822228.1|732592_732844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155822229.1|733245_734019_+	helix-turn-helix domain-containing protein	NA	A0A0R6PHL1	Moraxella_phage	37.1	5.4e-36
WP_155822230.1|734313_734586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155822231.1|734629_734827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155822232.1|735320_735764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155822233.1|735792_736062_+	hypothetical protein	NA	A0A2R2YAV1	Pseudomonas_phage	53.0	3.7e-16
WP_054316253.1|736191_736461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155822234.1|736658_737414_+	hypothetical protein	NA	Q3HQX1	Burkholderia_phage	90.1	4.9e-58
WP_155822235.1|737442_737787_+	hypothetical protein	NA	Q3HQX0	Burkholderia_phage	94.7	3.7e-53
WP_155822236.1|737817_738168_+	hypothetical protein	NA	I6NP76	Burkholderia_phage	67.2	1.7e-37
WP_155822237.1|738222_738486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155822238.1|738517_738853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155822239.1|738878_739145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155822240.1|739141_739618_+	hypothetical protein	NA	Q3HQW8	Burkholderia_phage	66.0	5.0e-08
WP_105767472.1|739610_739889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105775887.1|740204_741017_+	exonuclease VIII	NA	G8CLD3	Synechococcus_phage	40.8	1.6e-46
WP_155822981.1|741022_742075_+	recombinase RecT	NA	Q858E1	Salmonella_phage	48.8	4.7e-59
>prophage 2
NZ_CP046346	Burkholderia multivorans strain FDAARGOS_722 chromosome 3, complete sequence	3432204	1015509	1023796	3432204		Yaba_monkey_tumor_virus(16.67%)	8	NA	NA
WP_155822320.1|1015509_1016415_+	alpha/beta fold hydrolase	NA	Q6TUZ7	Yaba_monkey_tumor_virus	26.4	2.8e-15
WP_155822321.1|1016439_1017363_-	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	34.0	3.9e-41
WP_155822322.1|1017406_1018750_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_006413203.1|1018830_1019733_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.5	4.8e-52
WP_059783473.1|1019943_1020321_-	competence protein ComE	NA	NA	NA	NA	NA
WP_006400719.1|1020396_1021389_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	6.9e-28
WP_050804771.1|1021437_1022403_-	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.5	1.2e-16
WP_155822323.1|1022395_1023796_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	37.7	3.0e-77
>prophage 3
NZ_CP046346	Burkholderia multivorans strain FDAARGOS_722 chromosome 3, complete sequence	3432204	1356889	1365861	3432204		unidentified_phage(16.67%)	7	NA	NA
WP_035949390.1|1356889_1358428_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	30.7	6.1e-23
WP_006417097.1|1358463_1359003_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_035949388.1|1358999_1359686_+	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	30.1	2.7e-07
WP_039224558.1|1359732_1360548_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.7	3.9e-37
WP_155822440.1|1360653_1362516_-	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	38.9	2.6e-60
WP_006417099.1|1362519_1363650_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	39.0	2.8e-25
WP_006401601.1|1363914_1365861_-	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	51.2	2.7e-148
>prophage 4
NZ_CP046346	Burkholderia multivorans strain FDAARGOS_722 chromosome 3, complete sequence	3432204	1651787	1709660	3432204	plate,integrase,tRNA,tail	Acinetobacter_phage(33.33%)	50	1639726:1639743	1723418:1723435
1639726:1639743	attL	CGTAAGGGGATGGTGGCC	NA	NA	NA	NA
WP_105857383.1|1651787_1653035_-|integrase	integrase family protein	integrase	NA	NA	NA	NA
WP_006406916.1|1653091_1654186_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_155822516.1|1654255_1655125_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_146121200.1|1655766_1656087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155822517.1|1656153_1657308_+	cupin	NA	NA	NA	NA	NA
WP_006400482.1|1657448_1658840_-	GABA permease	NA	NA	NA	NA	NA
WP_060151448.1|1659209_1659548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155822518.1|1659616_1660996_-	MFS transporter	NA	NA	NA	NA	NA
WP_155822519.1|1661134_1662052_+	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_006400487.1|1662161_1662470_+	DUF3761 domain-containing protein	NA	NA	NA	NA	NA
WP_006400488.1|1662653_1664321_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	28.1	4.4e-43
WP_060097768.1|1664394_1665018_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_006414118.1|1665014_1665566_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_060145277.1|1665624_1667439_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	50.6	3.8e-173
WP_006406928.1|1667457_1667712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035949183.1|1667880_1668642_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_006400498.1|1668668_1669967_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_006400499.1|1670049_1671132_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	44.8	8.7e-08
WP_035949180.1|1671142_1671985_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_006400503.1|1672052_1672364_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_006414108.1|1672377_1672974_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_006406932.1|1673192_1673984_+	dioxygenase	NA	NA	NA	NA	NA
WP_006400506.1|1674138_1675737_-	APC family permease	NA	NA	NA	NA	NA
WP_006400508.1|1676159_1676363_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	71.6	1.4e-20
WP_155822520.1|1676474_1677725_-	Hsp70 family protein	NA	NA	NA	NA	NA
WP_006400510.1|1677881_1678487_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_054315501.1|1678633_1679917_-	MFS transporter	NA	NA	NA	NA	NA
WP_006400513.1|1680129_1680750_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006400514.1|1680805_1681378_+	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_035949172.1|1681428_1682319_-	methyltransferase	NA	NA	NA	NA	NA
WP_155822521.1|1682408_1683542_-	methyltransferase	NA	NA	NA	NA	NA
WP_155822522.1|1683651_1684149_-	Water stress and hypersensitive response domain-containing protein	NA	NA	NA	NA	NA
WP_006414124.1|1684792_1686964_+	peptidase M1	NA	A0A0P0IY26	Acinetobacter_phage	26.6	2.9e-50
WP_012467450.1|1687090_1688119_-	transporter	NA	NA	NA	NA	NA
WP_155822523.1|1688331_1689306_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_006415101.1|1689427_1690273_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_155822524.1|1690571_1694519_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_155822525.1|1694515_1695505_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_155822526.1|1695509_1696460_+	OmpA family protein	NA	NA	NA	NA	NA
WP_155822527.1|1696559_1697681_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_155822528.1|1697719_1700389_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	30.7	1.3e-89
WP_006400543.1|1700433_1701534_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_155822529.1|1701497_1703333_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_006400545.1|1703411_1703897_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_006400546.1|1703959_1704463_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_006400547.1|1704534_1706025_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_006406960.1|1706040_1706556_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_155822996.1|1706591_1707224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012214251.1|1707599_1708211_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_006400551.1|1708313_1709660_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
1723418:1723435	attR	GGCCACCATCCCCTTACG	NA	NA	NA	NA
>prophage 5
NZ_CP046346	Burkholderia multivorans strain FDAARGOS_722 chromosome 3, complete sequence	3432204	3184488	3294012	3432204	holin,tRNA,tail,integrase,head,plate,terminase,capsid,portal,protease	uncultured_Caudovirales_phage(29.27%)	107	3218652:3218681	3260633:3260662
WP_006401946.1|3184488_3186015_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.2	4.3e-85
WP_100085614.1|3186087_3187192_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	37.1	2.2e-06
WP_155822892.1|3187327_3189025_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.6	1.2e-56
WP_088931510.1|3189042_3190107_-	regulator	NA	NA	NA	NA	NA
WP_006401942.1|3190271_3191525_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_006401941.1|3191580_3192276_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.6	6.6e-33
WP_155822893.1|3192355_3193144_+	TatD family deoxyribonuclease	NA	NA	NA	NA	NA
WP_155822894.1|3193207_3195682_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_155822895.1|3195733_3196564_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_006401937.1|3196725_3198387_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.2	1.9e-150
WP_006401936.1|3198383_3199238_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.2	1.2e-47
WP_006401935.1|3199344_3200628_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	62.1	2.4e-150
WP_006401934.1|3200709_3201135_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_006401933.1|3201227_3201575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155822896.1|3201699_3202650_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_006412160.1|3202675_3203200_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_105823231.1|3203349_3204207_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_012213092.1|3204338_3205229_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_006401928.1|3205347_3206187_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_006401927.1|3206262_3206895_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_006401926.1|3206942_3207605_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_006401925.1|3207613_3208816_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_155822897.1|3208820_3209423_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_035951216.1|3209469_3210375_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_006408193.1|3210486_3211632_+	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_155822898.1|3211636_3212413_+	MBL fold metallo-hydrolase	NA	U5PVD0	Bacillus_phage	27.5	1.6e-11
WP_035488361.1|3212527_3212791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105790626.1|3213016_3214243_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_006401918.1|3214275_3214833_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_155822899.1|3214812_3216075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155822900.1|3216055_3218743_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	23.6	7.9e-26
3218652:3218681	attL	AGGTACTGCTGCATCATTGGCGTGTGGTTG	NA	NA	NA	NA
WP_105854874.1|3218902_3220207_+|integrase	integrase family protein	integrase	C7BGE7	Burkholderia_phage	57.3	4.8e-146
WP_105855590.1|3220489_3221569_-	RelA/SpoT domain-containing protein	NA	NA	NA	NA	NA
WP_105855592.1|3221720_3221966_-	AlpA family phage regulatory protein	NA	C7BGF0	Burkholderia_phage	63.0	7.2e-19
WP_105855589.1|3222079_3222394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155822901.1|3222495_3223845_-	pyridoxal phosphate biosynthetic protein PdxJ	NA	NA	NA	NA	NA
WP_105813145.1|3223844_3224444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105813144.1|3224440_3224803_-	beta-hexosaminidase	NA	NA	NA	NA	NA
WP_088930393.1|3224853_3225072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143281453.1|3225386_3225929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088930423.1|3226011_3226245_+	hypothetical protein	NA	A0A2H4JCB6	uncultured_Caudovirales_phage	57.4	3.8e-09
WP_080594107.1|3226560_3226833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043281023.1|3226962_3227490_+	hypothetical protein	NA	C7BGG0	Burkholderia_phage	47.6	3.9e-30
WP_053297112.1|3227491_3227875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043281031.1|3227908_3228349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125902534.1|3228350_3228824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155822902.1|3228966_3231462_+	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	41.1	2.9e-99
WP_060097135.1|3231677_3232265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105813143.1|3232523_3233135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125902822.1|3233404_3233656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105807744.1|3234275_3236390_+|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	53.5	4.4e-181
WP_105807745.1|3236399_3236606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105807746.1|3236602_3238093_+|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	52.6	2.1e-137
WP_105807747.1|3238089_3239163_+|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	38.3	1.4e-50
WP_105807748.1|3239187_3239532_+|head	head decoration protein	head	NA	NA	NA	NA
WP_088930400.1|3239605_3240601_+|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	61.8	3.4e-115
WP_006411281.1|3240602_3240893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105807749.1|3240898_3241426_+|tail	phage tail protein	tail	K7R9K2	Vibrio_phage	31.6	3.0e-22
WP_105807750.1|3241418_3241946_+	hypothetical protein	NA	Q9JML9	Wolbachia_phage	40.3	2.5e-24
WP_105807751.1|3241942_3242623_+|plate	phage baseplate assembly protein V	plate	Q9JML8	Wolbachia_phage	30.7	2.6e-18
WP_105807752.1|3242686_3242893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105807753.1|3242889_3243234_+|plate	phage baseplate protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	49.1	1.6e-24
WP_105807754.1|3243230_3244124_+|plate	baseplate J protein	plate	A0A2H4JFK9	uncultured_Caudovirales_phage	39.4	2.7e-47
WP_105807755.1|3244116_3244683_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	54.1	1.4e-33
WP_105807756.1|3244679_3245777_+	hypothetical protein	NA	A4JWL8	Burkholderia_virus	44.3	8.2e-54
WP_105807757.1|3245778_3246234_+|tail	phage tail protein	tail	A4JWL9	Burkholderia_virus	32.7	5.3e-07
WP_105807758.1|3246308_3247478_+|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	72.4	4.9e-158
WP_105807759.1|3247488_3247992_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	49.4	1.0e-43
WP_105807760.1|3248074_3248404_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_105807761.1|3248459_3250877_+|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	33.3	2.9e-59
WP_006411280.1|3250887_3251769_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	37.2	2.7e-31
WP_105807762.1|3251743_3251950_+|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	55.2	2.6e-14
WP_105807763.1|3251960_3253013_+	late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	49.6	3.5e-86
WP_006410008.1|3253087_3253372_+|holin	holin	holin	C7BGD7	Burkholderia_phage	94.7	1.0e-40
WP_105807764.1|3253374_3253869_+	glycoside hydrolase family 104 protein	NA	Q6J1Q5	Burkholderia_virus	87.8	4.8e-78
WP_155822903.1|3253865_3254360_+	DUF2514 family protein	NA	C7BGD9	Burkholderia_phage	49.4	2.4e-29
WP_006414243.1|3255691_3255934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080594100.1|3256120_3256375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065494964.1|3257111_3257429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080594106.1|3257879_3258164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065494651.1|3258216_3258456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080594099.1|3258848_3259301_-	response regulator	NA	NA	NA	NA	NA
WP_006414250.1|3259517_3260432_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155822904.1|3261532_3264316_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.0	4.3e-83
3260633:3260662	attR	AGGTACTGCTGCATCATTGGCGTGTGGTTG	NA	NA	NA	NA
WP_155822905.1|3264335_3266654_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.6	1.2e-22
WP_155822906.1|3266650_3268345_+	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
WP_080743868.1|3268408_3268669_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_006408202.1|3269194_3269998_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_044055276.1|3270274_3271099_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_006401899.1|3271275_3272049_+	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_006401898.1|3272083_3272884_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_006401897.1|3272907_3273399_-	peptidyl-prolyl cis-trans isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	29.6	9.7e-07
WP_006408206.1|3273487_3274063_-	peptidyl-prolyl cis-trans isomerase	NA	A0A1V0SCU1	Indivirus	39.3	1.4e-12
WP_155823012.1|3274104_3274770_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_012213111.1|3275059_3276457_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.1	1.0e-40
WP_060184124.1|3276500_3277382_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_006401892.1|3277484_3278456_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_155822907.1|3278502_3279909_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_006408212.1|3280251_3281502_+	aspartate kinase	NA	NA	NA	NA	NA
WP_123876363.1|3282761_3283226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105773477.1|3283732_3286204_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	43.8	1.0e-152
WP_105773479.1|3286266_3286968_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_105773476.1|3287008_3289576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105773475.1|3289579_3290668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123876362.1|3290677_3291169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105773474.1|3291238_3291499_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_155822908.1|3292134_3294012_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
