The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046307	Enterococcus gallinarum strain FDAARGOS_728 chromosome, complete genome	3274932	102493	117429	3274932	integrase	Listeria_phage(23.08%)	21	101986:102000	104888:104902
101986:102000	attL	TCAATATATCCAAGA	NA	NA	NA	NA
WP_144335611.1|102493_103717_-|integrase	site-specific integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	42.3	1.5e-80
WP_086269424.1|103716_103995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041119351.1|104148_104490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086269423.1|104499_105567_-	endonuclease	NA	A0A1S5SAB0	Streptococcus_phage	55.3	4.1e-111
104888:104902	attR	TCTTGGATATATTGA	NA	NA	NA	NA
WP_144335878.1|105578_106052_-	ImmA/IrrE family metallo-endopeptidase	NA	B6SBW7	Clostridium_virus	32.5	1.0e-13
WP_029487111.1|106062_106386_-	helix-turn-helix transcriptional regulator	NA	A8ATJ9	Listeria_phage	71.0	9.5e-19
WP_029487110.1|106546_106777_+	helix-turn-helix transcriptional regulator	NA	A0A290G4F8	Caldibacillus_phage	41.4	1.7e-09
WP_144335612.1|106770_107115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081131303.1|107118_107340_-	hypothetical protein	NA	A0A0B5D131	Listeria_phage	52.2	8.5e-11
WP_144335613.1|107415_107670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155852674.1|108049_108985_+	DUF4373 domain-containing protein	NA	A0A2H4JAR8	uncultured_Caudovirales_phage	37.0	1.3e-20
WP_155852675.1|109106_109859_+	DNA (cytosine-5-)-methyltransferase	NA	A0A0C5ABP5	Bacteriophage	55.8	7.2e-78
WP_155852676.1|109855_110644_+	DNA adenine methylase	NA	R4IBV6	Listeria_phage	46.0	8.4e-61
WP_155852677.1|110773_111649_-	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_155852678.1|111716_112157_+	hypothetical protein	NA	A0A2D1GPA7	Lactobacillus_phage	44.0	3.2e-17
WP_155852679.1|112146_112335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040013712.1|112527_112941_+	autolysin	NA	D2IYV6	Enterococcus_phage	64.0	1.9e-43
WP_155852680.1|113372_113900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155852681.1|113975_114710_+	hypothetical protein	NA	A0A1B1IMM2	Lactococcus_phage	76.5	3.1e-57
WP_155852682.1|114724_115372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155852683.1|115368_117429_+	hypothetical protein	NA	A0A1B1PA03	Enterococcus_phage	28.9	1.8e-70
>prophage 2
NZ_CP046307	Enterococcus gallinarum strain FDAARGOS_728 chromosome, complete genome	3274932	823179	836824	3274932		Lactobacillus_phage(30.0%)	15	NA	NA
WP_003126538.1|823179_825603_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	66.7	0.0e+00
WP_003126537.1|825621_826227_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	68.2	7.4e-73
WP_003126536.1|826526_827441_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	44.7	3.0e-70
WP_003126534.1|827672_828623_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_003126533.1|828737_829199_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	54.0	2.9e-37
WP_005471510.1|829218_830397_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	50.4	5.6e-101
WP_003126531.1|830389_831010_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	39.4	8.4e-32
WP_003126530.1|830978_832058_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.3	2.0e-36
WP_003126529.1|832622_833234_-	hypothetical protein	NA	Q9XJF2	Lactococcus_phage	36.7	2.3e-13
WP_003126527.1|833994_834216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003126526.1|834403_834589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003126522.1|834953_835232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003126521.1|835228_835633_-	DUF1064 domain-containing protein	NA	A0A1P8BKR1	Lactococcus_phage	44.3	8.5e-17
WP_003126520.1|835629_835932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003126519.1|835912_836824_-	DnaD domain protein	NA	A6M985	Geobacillus_virus	36.7	4.9e-36
>prophage 3
NZ_CP046307	Enterococcus gallinarum strain FDAARGOS_728 chromosome, complete genome	3274932	2700102	2709631	3274932	tRNA	Only_Syngen_Nebraska_virus(33.33%)	7	NA	NA
WP_005472769.1|2700102_2701149_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	3.3e-20
WP_003128581.1|2701163_2702099_+	ABC transporter ATP-binding protein	NA	A0A1J0FA64	Only_Syngen_Nebraska_virus	23.5	2.7e-05
WP_003128583.1|2702115_2703153_+	helix-turn-helix domain-containing protein	NA	A0A288TXV8	Enterococcus_phage	45.1	1.7e-61
WP_003128584.1|2703351_2704182_-	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	31.7	2.7e-25
WP_005472766.1|2704227_2704497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003128586.1|2704681_2706688_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	37.7	1.9e-96
WP_005472760.1|2706952_2709631_+	cation-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	28.2	1.4e-70
>prophage 4
NZ_CP046307	Enterococcus gallinarum strain FDAARGOS_728 chromosome, complete genome	3274932	2968930	2999433	3274932	holin,terminase,capsid,tail,portal,integrase	Lactococcus_phage(48.15%)	47	2968785:2968844	3003270:3003356
2968785:2968844	attL	AATACGGTCTCAAAGACGCGAACGCTGCGGAATAATTCTAACAAGGTTAGAACGTTGGTT	NA	NA	NA	NA
WP_155853335.1|2968930_2970082_-|integrase	tyrosine-type recombinase/integrase	integrase	J7KBT5	Streptococcus_phage	36.2	1.3e-54
WP_137264766.1|2970230_2970821_-	DUF5067 domain-containing protein	NA	A8ASM1	Listeria_phage	49.5	6.4e-21
WP_137264767.1|2970917_2971394_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTX7	Clostridium_phage	39.9	2.2e-19
WP_137264768.1|2971420_2971870_-	helix-turn-helix domain-containing protein	NA	A0A2H4PQQ2	Staphylococcus_phage	31.4	8.0e-08
WP_131731871.1|2972008_2972272_+	helix-turn-helix transcriptional regulator	NA	Q38329	Lactococcus_phage	44.8	8.8e-07
WP_131731870.1|2972277_2972556_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155853336.1|2972588_2972774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137264770.1|2972929_2973184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137264771.1|2973176_2973470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137264802.1|2973486_2973723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137264772.1|2974720_2975107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137264773.1|2975081_2975582_+	recombination protein U	NA	A0A2K9V2V4	Faecalibacterium_phage	38.9	4.9e-22
WP_137264774.1|2975585_2975858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137264775.1|2975844_2976039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155853337.1|2976070_2976223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137264776.1|2976326_2976629_+	hypothetical protein	NA	D2IZY1	Enterococcus_phage	73.7	5.7e-34
WP_137264777.1|2976667_2976883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021149562.1|2977268_2977688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134874622.1|2977690_2978095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155853338.1|2978238_2978481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137264778.1|2978532_2979045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155853339.1|2979163_2979337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137264779.1|2979326_2979515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137264780.1|2979518_2979779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155853340.1|2979783_2980281_+	hypothetical protein	NA	S5MUC4	Brevibacillus_phage	44.0	7.0e-05
WP_137264782.1|2980284_2980545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137264783.1|2980703_2981192_+	hypothetical protein	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	52.4	2.0e-28
WP_155853341.1|2981404_2981617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131731849.1|2981600_2981933_+	HNH endonuclease	NA	O64273	Lactococcus_phage	78.7	3.1e-49
WP_131731848.1|2982082_2983324_+|portal	phage portal protein	portal	A0A1P8BMI8	Lactococcus_phage	73.9	1.1e-174
WP_131731847.1|2983316_2984078_+	hypothetical protein	NA	A0A1B1IMX1	Lactococcus_phage	58.6	1.7e-87
WP_131731846.1|2984137_2985562_+|terminase	terminase	terminase	A0A1P8BMS5	Lactococcus_phage	77.8	8.5e-221
WP_131731845.1|2985642_2986104_+	DUF4355 domain-containing protein	NA	M1NRH2	Streptococcus_phage	52.9	2.8e-32
WP_131731844.1|2986108_2987002_+|capsid	phage major capsid protein	capsid	A0A1P8BKC4	Lactococcus_phage	65.2	3.8e-110
WP_131731843.1|2987001_2987328_+	hypothetical protein	NA	A0A1P8BKC8	Lactococcus_phage	36.2	7.6e-08
WP_131731842.1|2987332_2987776_+	hypothetical protein	NA	A0A1B1IMX8	Lactococcus_phage	75.6	6.0e-48
WP_131731841.1|2987717_2988056_+	hypothetical protein	NA	A0A1P8BMP0	Lactococcus_phage	74.1	1.2e-45
WP_041120510.1|2988048_2988285_+	hypothetical protein	NA	M1NRG9	Streptococcus_phage	71.8	2.1e-23
WP_131731840.1|2988285_2988621_+	hypothetical protein	NA	A0A1B1IMT0	Lactococcus_phage	75.7	1.2e-40
WP_131731839.1|2988632_2989214_+|tail	phage tail protein	tail	A0A1P8BMS0	Lactococcus_phage	69.1	6.4e-66
WP_041120505.1|2989210_2989474_+	hypothetical protein	NA	A0A1P8BMR6	Lactococcus_phage	52.3	1.0e-18
WP_041120504.1|2989485_2989869_+	DUF5361 domain-containing protein	NA	M1PL84	Streptococcus_phage	64.6	8.6e-35
WP_144316766.1|2992273_2994334_+	hypothetical protein	NA	A0A1B1PA03	Enterococcus_phage	29.4	2.5e-72
WP_155853342.1|2994333_2998224_+	hypothetical protein	NA	B4XYQ5	Lactobacillus_phage	42.1	3.7e-141
WP_131731836.1|2998234_2998540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131731835.1|2998768_2999122_+	hypothetical protein	NA	A0A1P8BKU2	Lactococcus_phage	68.4	8.4e-37
WP_086269401.1|2999124_2999433_+|holin	phage holin	holin	J7KDR1	Streptococcus_phage	64.6	2.3e-22
3003270:3003356	attR	AATACGGTCTCAAAGACGCGAACGCTGCGGAATAATTCTAACAAGGTTAGAACGTTGGTTTATCAACGATTTAGAGATGTTTTCCTT	NA	NA	NA	NA
