The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046277	Salmonella enterica strain FDAARGOS_710 chromosome, complete genome	4611029	125523	135321	4611029	integrase	Enterobacteria_phage(87.5%)	12	131194:131209	137936:137951
WP_023198743.1|125523_127857_-	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.5	0.0e+00
WP_000743152.1|127871_128192_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001145746.1|128188_128449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000459283.1|128522_128972_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	70.5	1.5e-43
WP_000556707.1|128964_129264_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	70.7	6.1e-28
WP_000986181.1|129253_129856_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.1	4.6e-43
WP_000149859.1|130666_131404_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	62.3	1.7e-76
131194:131209	attL	GCAGCAGGTGAAAGCG	NA	NA	NA	NA
WP_000984203.1|131400_131646_+	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	75.3	5.3e-30
WP_000210076.1|131662_132229_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	1.3e-55
WP_001610101.1|132561_133434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023198740.1|133433_134093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000124725.1|134127_135321_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	49.1	4.1e-107
137936:137951	attR	CGCTTTCACCTGCTGC	NA	NA	NA	NA
>prophage 2
NZ_CP046277	Salmonella enterica strain FDAARGOS_710 chromosome, complete genome	4611029	652822	661993	4611029	tRNA	Enterobacteria_phage(71.43%)	10	NA	NA
WP_000569166.1|652822_653770_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824854.1|653753_654485_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|654465_654573_-	protein YohO	NA	NA	NA	NA	NA
WP_001240416.1|654632_655364_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|655586_657272_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|657268_657988_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950412.1|658034_658502_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	1.8e-74
WP_001221794.1|658558_659089_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	33.1	7.2e-16
WP_000703136.1|659260_659719_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	73.2	7.6e-54
WP_000195336.1|659959_661993_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 3
NZ_CP046277	Salmonella enterica strain FDAARGOS_710 chromosome, complete genome	4611029	729220	735517	4611029		Enterobacteria_phage(50.0%)	6	NA	NA
WP_001111834.1|729220_730624_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	28.2	4.0e-21
WP_000981469.1|730801_731695_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697842.1|732071_733157_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	4.2e-103
WP_001023662.1|733156_734056_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_001612007.1|734103_734982_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	3.9e-107
WP_001100807.1|734986_735517_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.1	3.7e-52
>prophage 4
NZ_CP046277	Salmonella enterica strain FDAARGOS_710 chromosome, complete genome	4611029	819095	826329	4611029		Morganella_phage(33.33%)	8	NA	NA
WP_000394197.1|819095_819515_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_023212516.1|819517_820786_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.4	6.4e-228
WP_000208509.1|821240_821453_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|821463_821652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031567923.1|821910_823089_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.0	1.9e-109
WP_000107440.1|823738_824050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377042.1|824129_824825_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157316.1|824898_826329_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
>prophage 5
NZ_CP046277	Salmonella enterica strain FDAARGOS_710 chromosome, complete genome	4611029	1110963	1117707	4611029		Salmonella_phage(28.57%)	10	NA	NA
WP_000230462.1|1110963_1111770_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
WP_001128869.1|1111771_1112764_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_001146139.1|1112763_1113654_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_001543117.1|1113777_1114179_+	DUF4102 domain-containing protein	NA	K7PGY1	Enterobacteria_phage	58.4	8.4e-33
WP_001605114.1|1114558_1115281_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	38.9	4.3e-35
WP_031568331.1|1115751_1115934_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	79.1	1.4e-22
WP_001605117.1|1116183_1116324_+	hypothetical protein	NA	A0A0U2KD26	Escherichia_phage	77.1	6.5e-09
WP_072010149.1|1116362_1116662_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	52.9	1.2e-12
WP_000727928.1|1116588_1117014_+	peptidase	NA	NA	NA	NA	NA
WP_077905325.1|1117392_1117707_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	86.1	4.3e-40
>prophage 6
NZ_CP046277	Salmonella enterica strain FDAARGOS_710 chromosome, complete genome	4611029	1154548	1162277	4611029	tRNA,transposase	Diachasmimorpha_longicaudata_entomopoxvirus(20.0%)	6	NA	NA
WP_031568353.1|1154548_1155922_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.8e-51
WP_031568355.1|1155965_1156901_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	9.4e-144
WP_001223393.1|1157576_1159409_+	DUF4765 family protein	NA	A0A0N7KZG3	Stx2-converting_phage	34.7	2.5e-47
WP_000159242.1|1159683_1160022_+	EamA family transporter	NA	NA	NA	NA	NA
WP_001082296.1|1160074_1160509_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
WP_155982779.1|1161022_1162277_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	1.7e-18
>prophage 7
NZ_CP046277	Salmonella enterica strain FDAARGOS_710 chromosome, complete genome	4611029	1553117	1641976	4611029	integrase,tail,holin,head,tRNA,terminase,capsid,portal	Enterobacteria_phage(30.77%)	107	1588640:1588654	1637878:1637892
WP_000829534.1|1553117_1553645_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_000272232.1|1553641_1553749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460698.1|1553954_1554401_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_000579798.1|1554380_1555175_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000205347.1|1555275_1556460_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_001222533.1|1556578_1556926_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_000487132.1|1556911_1557223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000673492.1|1557291_1557543_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001589065.1|1557738_1557837_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_000512149.1|1557975_1558224_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_000605462.1|1558537_1559185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000513733.1|1559408_1559591_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_001248993.1|1559593_1559956_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000457186.1|1560128_1560767_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_000617984.1|1560963_1561509_-	chorismate mutase	NA	NA	NA	NA	NA
WP_000208086.1|1561824_1562073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153218876.1|1562181_1562355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000190269.1|1562327_1563176_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_072275082.1|1563244_1563838_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023136870.1|1563982_1564771_-	cryptic aminoglycoside nucleotidyltransferase ANT(3'')/ANT(9)	NA	NA	NA	NA	NA
WP_000234684.1|1564879_1565530_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001183699.1|1565723_1566050_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_000456065.1|1566243_1567377_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000947448.1|1567458_1568049_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_000950208.1|1568042_1568840_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_000966647.1|1568833_1569646_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001611887.1|1569635_1570610_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000946070.1|1570609_1572244_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000182479.1|1572925_1573240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929976.1|1573388_1573919_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	69.5	1.1e-35
WP_023136874.1|1574001_1575045_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_001518864.1|1575383_1575854_-	Hsp20 family protein	NA	NA	NA	NA	NA
WP_077909914.1|1576045_1576276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000758944.1|1576487_1576613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000977725.1|1576990_1577335_+	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000789469.1|1578571_1579129_-	virulence membrane protein PagC	NA	Q9LA63	Enterobacterial_phage	33.0	2.2e-15
WP_001605721.1|1579935_1580199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001537306.1|1580330_1580543_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_001542631.1|1580959_1581481_+	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_000497451.1|1581671_1581911_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_001036547.1|1582121_1582286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001529135.1|1582783_1583593_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
WP_001277616.1|1583665_1584043_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_000158845.1|1584190_1584733_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
WP_000733630.1|1584916_1585645_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.5	1.6e-61
WP_000275697.1|1585661_1586075_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	37.7	3.2e-19
WP_023136605.1|1587119_1588244_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
1588640:1588654	attL	AATAAAAACGGGAAC	NA	NA	NA	NA
WP_001521673.1|1588691_1588904_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.5e-20
WP_000334551.1|1589157_1589829_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.9	1.1e-80
WP_058215289.1|1590147_1592259_-	type III secretion system effector E3 ubiquitin transferase SspH1	NA	Q9MBL9	Phage_Gifsy-2	46.2	1.1e-25
WP_000457876.1|1593792_1593918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060629041.1|1594488_1594689_+	PagK	NA	NA	NA	NA	NA
WP_000143179.1|1594785_1595370_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	84.8	1.7e-87
WP_155982787.1|1595369_1597811_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	61.5	4.0e-85
WP_000178851.1|1597864_1598107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155982788.1|1598145_1601508_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	80.2	0.0e+00
WP_000246124.1|1601569_1602217_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	78.1	9.3e-90
WP_000662739.1|1602114_1602852_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|1602858_1603557_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|1603566_1603896_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_155982789.1|1603898_1606994_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	61.6	1.4e-276
WP_010989052.1|1606965_1607304_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|1607300_1607696_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_155982790.1|1607746_1608493_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.5	7.4e-99
WP_000033885.1|1608500_1608902_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000677089.1|1608898_1609477_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083293.1|1609463_1609841_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	1.5e-28
WP_000201486.1|1609851_1610211_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_155982791.1|1610268_1611297_-|capsid	major capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.1	2.9e-114
WP_047588326.1|1611351_1611699_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	53.8	5.4e-20
WP_047594315.1|1611711_1613208_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.1	4.0e-96
WP_023237960.1|1613197_1614778_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	63.0	4.3e-189
WP_039513171.1|1614774_1614978_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	72.3	9.5e-17
WP_039513168.1|1614961_1616893_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	1.8e-258
WP_001102153.1|1616864_1617410_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_155982792.1|1617803_1618364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155982835.1|1618418_1618634_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_155982793.1|1618879_1619383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023225793.1|1619485_1620028_-	DUF2514 family protein	NA	NA	NA	NA	NA
WP_023225794.1|1620024_1620639_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	94.1	3.8e-109
WP_000226306.1|1620638_1620920_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.3e-36
WP_001294873.1|1620906_1621296_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	72.5	4.8e-41
WP_052907302.1|1621554_1622652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072103257.1|1622662_1623085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052907301.1|1623077_1623713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077943546.1|1623709_1624078_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	83.3	2.0e-52
WP_052907312.1|1624092_1625082_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	98.5	7.5e-192
WP_079918495.1|1625089_1625950_-	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	97.6	3.6e-158
WP_135369298.1|1625966_1626356_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	96.1	3.9e-67
WP_080070878.1|1626352_1628287_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	54.0	1.6e-201
WP_046722474.1|1628279_1629158_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	87.7	2.7e-148
WP_001669427.1|1629157_1629640_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	98.1	6.0e-86
WP_000104924.1|1629641_1630601_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	80.9	1.6e-117
WP_155982794.1|1630818_1631961_-	peptidase	NA	A0A1C9IHV9	Salmonella_phage	87.4	1.4e-181
WP_155982795.1|1631957_1632512_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	98.9	2.2e-100
WP_001191666.1|1632540_1632765_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020640.1|1632862_1633558_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
WP_000997190.1|1634372_1634744_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_023195414.1|1634801_1635629_+	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	98.2	9.2e-151
WP_057517787.1|1635765_1636305_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	99.4	5.9e-98
WP_000089141.1|1636447_1636684_+	excisionase	NA	NA	NA	NA	NA
WP_000741325.1|1636673_1637816_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	80.3	8.2e-174
WP_000444508.1|1637929_1639180_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
1637878:1637892	attR	AATAAAAACGGGAAC	NA	NA	NA	NA
WP_001249415.1|1639351_1640017_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000825956.1|1640013_1640343_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_023136606.1|1640354_1640816_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000004540.1|1640869_1641976_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP046277	Salmonella enterica strain FDAARGOS_710 chromosome, complete genome	4611029	3309881	3404143	4611029	integrase,protease,tail,holin,head,tRNA,lysis,terminase,capsid,plate,portal	Salmonella_phage(54.76%)	94	3369072:3369118	3399518:3399564
WP_001528904.1|3309881_3310982_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_000813838.1|3311028_3311388_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_000971958.1|3311403_3312039_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_001120789.1|3312237_3313638_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_001025919.1|3313620_3314538_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_031571423.1|3314821_3316198_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_088524128.1|3316315_3317092_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_000935333.1|3317099_3318104_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_000800208.1|3318192_3319344_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_001005549.1|3319735_3322387_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_001192092.1|3322597_3324331_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_000274595.1|3324491_3325328_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000424866.1|3325582_3326245_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	2.5e-29
WP_000374031.1|3326256_3327360_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_000108113.1|3327466_3329647_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_000007507.1|3329811_3330702_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_000865250.1|3330896_3332453_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_001134820.1|3332588_3333713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023219816.1|3333947_3334946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000398243.1|3334948_3335806_+	small-conductance mechanosensitive channel MscS	NA	NA	NA	NA	NA
WP_001528872.1|3335941_3338374_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_000197212.1|3338376_3339537_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_000852811.1|3339801_3340119_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_155982820.1|3340575_3342366_+	aryl-sulfate sulfotransferase	NA	NA	NA	NA	NA
WP_000792791.1|3342566_3343229_+	TIGR02117 family protein	NA	NA	NA	NA	NA
WP_000715284.1|3343273_3343486_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000109376.1|3343689_3345888_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_000841337.1|3346042_3347068_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_000068814.1|3347161_3348133_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000208240.1|3348224_3348755_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293360.1|3348764_3350096_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
WP_000139638.1|3350162_3351092_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872918.1|3351184_3351670_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000051370.1|3351891_3352131_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084285.1|3352529_3353375_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
WP_001523753.1|3353395_3354904_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250617.1|3355015_3356026_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796303.1|3356122_3356869_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000155237.1|3356975_3357404_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802241.1|3357504_3358101_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216336.1|3358213_3358981_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000061007.1|3359090_3360395_-	citrate transporter	NA	NA	NA	NA	NA
WP_001535809.1|3360492_3361215_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000557882.1|3361277_3362318_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_031570708.1|3362327_3363287_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000777308.1|3363297_3364632_-	MFS transporter	NA	NA	NA	NA	NA
WP_000750757.1|3364894_3365650_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000758706.1|3365750_3366740_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591793.1|3366943_3367906_-	ATP-dependent 6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001077321.1|3368090_3368993_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
3369072:3369118	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_155982821.1|3369279_3369687_+	hypothetical protein	NA	S4TTB4	Salmonella_phage	99.3	7.9e-71
WP_000468311.1|3369737_3369956_-	DNA-binding transcriptional regulator	NA	S4TNZ3	Salmonella_phage	100.0	4.7e-38
WP_023139995.1|3370033_3371203_-	phage late control D family protein	NA	S4TRX8	Salmonella_phage	99.5	4.3e-210
WP_016505047.1|3371199_3371685_-|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	99.4	3.9e-85
WP_023139996.1|3371697_3374139_-|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	98.9	0.0e+00
WP_085984508.1|3374131_3374287_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
WP_001749787.1|3374283_3374619_-|tail	phage tail assembly protein	tail	A0A218M4J8	Erwinia_phage	98.2	5.2e-52
WP_001207675.1|3374681_3375200_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	100.0	6.5e-94
WP_023139997.1|3375215_3376403_-|tail	phage tail sheath protein	tail	Q6K1H0	Salmonella_virus	99.7	3.4e-223
WP_023139998.1|3376537_3377086_-|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	99.5	1.7e-100
WP_023139999.1|3377098_3379213_-|tail	tail fiber protein (GpH)	tail	Q6K1H2	Salmonella_virus	76.8	1.9e-237
WP_001000068.1|3379223_3379754_-|tail	phage tail protein I	tail	S4TTA8	Salmonella_phage	100.0	9.2e-104
WP_000246677.1|3379746_3380655_-|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	100.0	2.6e-162
WP_000127148.1|3380661_3381009_-|plate	baseplate assembly protein	plate	S4TRW8	Salmonella_phage	100.0	2.5e-57
WP_001534860.1|3381005_3381647_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	99.1	1.6e-113
WP_001293096.1|3381715_3382165_-	phage virion morphogenesis protein	NA	S4TP59	Salmonella_phage	99.3	4.2e-73
WP_111725026.1|3382157_3382625_-|tail	phage tail protein	tail	S4TTA5	Salmonella_phage	98.7	9.3e-84
WP_094583807.1|3382732_3383146_-|lysis	LysB family phage lysis regulatory protein	lysis	S4TRW3	Salmonella_phage	99.3	9.9e-45
WP_079848222.1|3383142_3383640_-	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	98.2	5.8e-92
WP_000134660.1|3383626_3383923_-|holin	holin	holin	Q6K1I2	Salmonella_virus	100.0	5.8e-47
WP_010835754.1|3383926_3384130_-	phage Tail protein X	NA	S4TTA0	Salmonella_phage	100.0	6.1e-32
WP_000214255.1|3384129_3384636_-|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	100.0	1.3e-91
WP_023230506.1|3384729_3385479_-|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	98.0	9.0e-129
WP_001247243.1|3385482_3386550_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	99.7	1.2e-198
WP_001085932.1|3386626_3387481_-|capsid	capsid scaffolding protein	capsid	A0A0M3UL81	Salmonella_phage	100.0	9.9e-148
WP_023140008.1|3387646_3389416_+|terminase	terminase ATPase subunit family protein	terminase	S4TT96	Salmonella_phage	98.6	0.0e+00
WP_000517958.1|3389415_3390462_+|portal	phage portal protein	portal	S4TNX7	Salmonella_phage	99.4	4.4e-190
WP_017441879.1|3390809_3391694_-	DNA adenine methylase	NA	NA	NA	NA	NA
WP_023140009.1|3391763_3393263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023140010.1|3393617_3395903_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	93.1	0.0e+00
WP_000027664.1|3395892_3396168_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113264.1|3396164_3396389_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001277958.1|3396388_3396691_-	hypothetical protein	NA	U5N0U2	Enterobacteria_phage	98.0	5.0e-46
WP_000557701.1|3396690_3396915_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	3.0e-32
WP_000217670.1|3396978_3397479_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001308179.1|3397648_3397921_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000777029.1|3398057_3398351_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_000985246.1|3398420_3399401_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_001233463.1|3399586_3400087_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
3399518:3399564	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033731.1|3400237_3400936_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580402.1|3400932_3402306_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_000133441.1|3402356_3402752_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_076735184.1|3402763_3403516_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000122632.1|3403522_3404143_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
