The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046271	Enterobacter hormaechei strain E70 chromosome, complete genome	4572253	908849	916444	4572253	integrase	Enterobacteria_phage(30.0%)	10	901265:901279	926951:926965
901265:901279	attL	ACGGCGTAATCCTGT	NA	NA	NA	NA
WP_003863199.1|908849_909902_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.6e-118
WP_003863197.1|910207_911311_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.9	1.7e-59
WP_003863195.1|911322_912576_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.6	2.3e-97
WP_003863194.1|912777_913941_-|integrase	site-specific integrase	integrase	A0A220NQU7	Salmonella_phage	95.6	9.1e-221
WP_003863191.1|913817_914168_-	helix-turn-helix domain-containing protein	NA	Q5G8V4	Enterobacteria_phage	95.7	1.5e-57
WP_003863189.1|914170_914380_-	hypothetical protein	NA	A0A220IH74	Escherichia_phage	59.3	2.1e-11
WP_032628143.1|914416_914965_-	hypothetical protein	NA	E5AGD3	Erwinia_phage	35.0	2.3e-20
WP_003863184.1|914973_915174_-	hypothetical protein	NA	G8C7S1	Escherichia_phage	71.2	1.1e-20
WP_058652674.1|915182_915983_-	hypothetical protein	NA	K7P7Q8	Enterobacteria_phage	85.0	5.1e-138
WP_022650433.1|915982_916444_-	VUT family protein	NA	A0A2H4N7D9	Pectobacterium_phage	55.7	4.1e-39
926951:926965	attR	ACGGCGTAATCCTGT	NA	NA	NA	NA
>prophage 2
NZ_CP046271	Enterobacter hormaechei strain E70 chromosome, complete genome	4572253	1744315	1797604	4572253	capsid,tRNA,holin,integrase,head,portal,terminase,tail	Salmonella_phage(22.41%)	69	1739871:1739885	1746681:1746695
1739871:1739885	attL	AGGCGGCGCAGGCGC	NA	NA	NA	NA
WP_003857877.1|1744315_1744816_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_117308995.1|1745035_1746178_-|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	49.0	2.4e-93
WP_022650818.1|1746152_1746416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117308996.1|1746448_1746718_-	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	79.8	1.6e-32
1746681:1746695	attR	AGGCGGCGCAGGCGC	NA	NA	NA	NA
WP_117308997.1|1746918_1747644_-	hypothetical protein	NA	M9NZE4	Enterobacteria_phage	40.4	9.2e-30
WP_045617025.1|1747640_1748468_-	hypothetical protein	NA	K7PKM7	Enterobacterial_phage	86.3	2.8e-123
WP_117309026.1|1748467_1748881_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	84.7	6.8e-54
WP_117308998.1|1749335_1749794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152921628.1|1750172_1750553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045359139.1|1750730_1750940_+	hypothetical protein	NA	G8C7T7	Escherichia_phage	73.4	2.3e-18
WP_045359138.1|1750975_1751332_-	hypothetical protein	NA	G0ZNF1	Cronobacter_phage	92.4	2.0e-54
WP_117308999.1|1751443_1752262_-	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_126523694.1|1752258_1752942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117309001.1|1753064_1753817_-	helix-turn-helix transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	55.0	1.1e-73
WP_117309002.1|1753851_1754103_+	DNA-binding protein	NA	A0A2I6PIE5	Escherichia_phage	49.3	1.0e-12
WP_047359615.1|1754131_1754686_+	hypothetical protein	NA	S5FXP0	Shigella_phage	53.5	5.4e-46
WP_032619902.1|1754849_1755029_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.2	3.3e-13
WP_117309003.1|1755018_1755897_+	GntR family transcriptional regulator	NA	U5P0A0	Shigella_phage	82.0	7.7e-39
WP_063863790.1|1755893_1756388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117309004.1|1756387_1757047_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	78.1	7.2e-98
WP_117309005.1|1757043_1757271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117309006.1|1757267_1757657_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	95.3	1.2e-68
WP_117309007.1|1757653_1758643_+	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	89.4	9.6e-179
WP_117309008.1|1758657_1759020_+	antitermination protein Q	NA	K7PGW2	Enterobacterial_phage	92.5	1.2e-57
WP_045617010.1|1759068_1759884_-	TIR domain-containing protein	NA	K7PLZ9	Enterobacterial_phage	60.3	1.9e-87
WP_015570939.1|1760215_1760641_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	84.4	6.6e-60
WP_017384388.1|1760637_1760793_+	DUF3927 family protein	NA	S4TRP5	Salmonella_phage	68.8	5.0e-10
WP_017384387.1|1761521_1761911_+	membrane protein	NA	G8C7V8	Escherichia_phage	92.2	1.1e-58
WP_017384386.1|1761900_1762179_+|holin	phage holin family protein	holin	G8C7V9	Escherichia_phage	85.9	1.7e-37
WP_117309009.1|1762178_1762808_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	88.5	2.1e-102
WP_063853303.1|1762815_1763085_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	71.9	1.9e-25
WP_062939161.1|1763223_1763601_+	hypothetical protein	NA	A0A192Y658	Salmonella_phage	57.9	1.0e-27
WP_020690713.1|1763746_1763950_+	hypothetical protein	NA	A0A1W6JPG4	Morganella_phage	52.9	1.6e-11
WP_047719375.1|1764015_1764204_+	hypothetical protein	NA	A0A2I7RUD6	Vibrio_phage	77.0	2.7e-18
WP_117309011.1|1764636_1764864_+	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	73.3	3.3e-18
WP_117309012.1|1765530_1766988_+	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	91.5	1.1e-271
WP_117309013.1|1767079_1767256_-	ATP-NAD kinase	NA	NA	NA	NA	NA
WP_049019491.1|1767374_1767944_+	HNH endonuclease	NA	G8IDS8	Mycobacterium_phage	38.9	4.4e-19
WP_117309014.1|1767940_1768519_+	hypothetical protein	NA	S4TR53	Salmonella_phage	82.7	1.8e-92
WP_045895687.1|1768511_1768880_+	HNH endonuclease	NA	S4TTG9	Salmonella_phage	88.5	1.0e-56
WP_000954404.1|1768985_1769480_+|terminase	terminase small subunit	terminase	S4TNN3	Salmonella_phage	100.0	1.7e-83
WP_117309015.1|1769476_1771138_+|terminase	terminase large subunit	terminase	S4TSQ6	Salmonella_phage	98.7	0.0e+00
WP_049019489.1|1771196_1773131_+|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	93.3	0.0e+00
WP_117309016.1|1773334_1774696_+|portal	phage portal protein	portal	S4TTG7	Salmonella_phage	92.7	1.2e-243
WP_117309017.1|1774692_1775910_+|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TNN1	Salmonella_phage	71.6	6.8e-94
WP_117309018.1|1775906_1776233_+|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TSQ3	Salmonella_phage	88.9	7.5e-48
WP_063863774.1|1776241_1776592_+|head	phage head closure protein	head	S4TND9	Salmonella_phage	89.7	1.1e-52
WP_117309019.1|1776588_1777038_+	HK97 gp10 family phage protein	NA	K7P6X4	Enterobacteria_phage	98.7	4.9e-74
WP_117309020.1|1777034_1777382_+	DUF3168 domain-containing protein	NA	Q9MCS8	Enterobacteria_phage	97.4	8.5e-58
WP_045281469.1|1777441_1777885_+	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	93.1	1.0e-71
WP_001549114.1|1777893_1778277_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	93.7	4.4e-63
WP_006809154.1|1778285_1778564_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	97.8	1.2e-43
WP_032634878.1|1778619_1778955_+	membrane protein	NA	S4TR42	Salmonella_phage	94.6	3.0e-52
WP_117309021.1|1779001_1782493_+|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	86.1	0.0e+00
WP_022650857.1|1782495_1782834_+|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	60.7	1.1e-38
WP_016240208.1|1782830_1783589_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	63.6	3.9e-95
WP_117309022.1|1783591_1784302_+	C40 family peptidase	NA	F1C573	Cronobacter_phage	69.8	1.7e-97
WP_047731792.1|1784301_1784886_+|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	53.1	1.1e-54
WP_080337223.1|1784932_1785118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117309023.1|1785708_1789554_+	DUF1983 domain-containing protein	NA	Q9MCU0	Escherichia_phage	63.3	0.0e+00
WP_022651029.1|1789597_1789912_+	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	64.7	1.5e-32
WP_022651030.1|1789912_1790584_+	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	73.1	2.6e-87
WP_117308971.1|1790691_1790925_+	cor protein	NA	E4WL42	Enterobacteria_phage	75.0	7.3e-29
WP_155961075.1|1790983_1792315_+|tail	phage tail protein	tail	K7PH95	Enterobacterial_phage	49.9	2.7e-99
WP_155961097.1|1792292_1792820_-	hypothetical protein	NA	A0A220NRP2	Escherichia_phage	78.4	3.2e-72
WP_045350188.1|1793220_1793769_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	80.6	2.6e-77
WP_032665393.1|1793884_1794307_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	44.1	6.0e-21
WP_117309025.1|1795074_1796541_+	flagellin FliC	NA	NA	NA	NA	NA
WP_045895310.1|1796686_1797604_+	helix-turn-helix domain-containing protein	NA	A0A077SL42	Escherichia_phage	43.6	8.3e-68
>prophage 3
NZ_CP046271	Enterobacter hormaechei strain E70 chromosome, complete genome	4572253	2034437	2041685	4572253		Escherichia_phage(83.33%)	8	NA	NA
WP_022651054.1|2034437_2035115_+	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	62.6	1.5e-77
WP_032609101.1|2035290_2035602_-	YebG family protein	NA	NA	NA	NA	NA
WP_017384547.1|2035711_2036326_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	34.7	3.3e-28
WP_022651056.1|2036370_2037225_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	34.9	1.2e-23
WP_003858259.1|2037226_2037844_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	1.4e-74
WP_072207423.1|2037854_2040251_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.5	4.1e-215
WP_003857424.1|2040422_2040728_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_003857421.1|2040830_2041685_-	benzoate transporter	NA	M1I711	Paramecium_bursaria_Chlorella_virus	33.2	8.1e-25
>prophage 4
NZ_CP046271	Enterobacter hormaechei strain E70 chromosome, complete genome	4572253	2336800	2415340	4572253	transposase,tRNA,holin,integrase,plate,terminase,tail	Enterobacteria_phage(28.85%)	80	2382857:2382873	2420940:2420956
WP_003856933.1|2336800_2337961_+	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	59.3	2.5e-117
WP_022651250.1|2337995_2338418_-	GFA family protein	NA	NA	NA	NA	NA
WP_003856931.1|2338421_2338619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071785691.1|2339039_2339240_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U2JGI6	Escherichia_phage	71.7	1.1e-20
WP_058652221.1|2339659_2340337_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	58.7	3.1e-80
WP_032734475.1|2340514_2341360_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	37.3	1.6e-33
WP_058652222.1|2341352_2341751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117308969.1|2341750_2342416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058652224.1|2342449_2343718_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.7	5.3e-230
WP_058652225.1|2343720_2344140_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	55.9	5.5e-35
WP_000343760.1|2344236_2345457_+|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_039272126.1|2345636_2346194_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	78.7	3.5e-77
WP_058652226.1|2347006_2348332_-	hypothetical protein	NA	K7P6I4	Enterobacteria_phage	60.3	6.4e-138
WP_017382566.1|2348390_2348624_-	hypothetical protein	NA	E4WL42	Enterobacteria_phage	78.9	3.9e-30
WP_045892418.1|2348731_2349403_-	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	73.5	1.2e-87
WP_022651029.1|2349403_2349718_-	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	64.7	1.5e-32
WP_117308972.1|2349761_2353313_-|tail	phage tail protein	tail	K7P7D9	Enterobacteria_phage	89.4	0.0e+00
WP_058652901.1|2353365_2353995_-|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	57.9	1.6e-54
WP_058652902.1|2354027_2354738_-	peptidase P60	NA	K7PJX1	Enterobacterial_phage	95.7	1.5e-141
WP_058652903.1|2354739_2355495_-|tail	phage minor tail protein L	tail	G8C7J7	Escherichia_phage	77.6	5.2e-116
WP_058652904.1|2355491_2355839_-|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	63.5	2.6e-38
WP_045336370.1|2355913_2356597_-	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	42.8	2.4e-40
WP_058652905.1|2356710_2359641_-|tail	phage tail tape measure protein	tail	I6PCW3	Cronobacter_phage	35.6	2.6e-131
WP_080399018.1|2359637_2359952_-	hypothetical protein	NA	I6PD79	Cronobacter_phage	65.0	1.1e-16
WP_023344275.1|2359948_2360260_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	68.0	2.4e-35
WP_058652907.1|2360322_2360994_-|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	48.4	4.4e-50
WP_058652908.1|2361063_2361474_-	hypothetical protein	NA	I6PDJ8	Cronobacter_phage	53.6	1.7e-33
WP_058652909.1|2361470_2362055_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	55.8	8.5e-50
WP_117308973.1|2362056_2362407_-	hypothetical protein	NA	I6PD77	Cronobacter_phage	55.2	8.1e-32
WP_058652911.1|2362408_2362891_-	hypothetical protein	NA	A0A2I7RQ74	Vibrio_phage	31.3	2.3e-08
WP_162339398.1|2362927_2363227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117308974.1|2363208_2364162_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.7	9.0e-134
WP_058652913.1|2364173_2364944_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.1	2.2e-66
WP_058652914.1|2365024_2366122_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	59.1	9.5e-119
WP_058652915.1|2366123_2367512_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	49.7	3.3e-124
WP_058652916.1|2367513_2368821_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	57.3	5.0e-143
WP_022651282.1|2368798_2369797_-|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	43.4	1.1e-38
WP_057059589.1|2369843_2370293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058652968.1|2372013_2372289_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	83.3	2.4e-31
WP_058652917.1|2372296_2372926_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	87.6	4.6e-102
WP_022651286.1|2372925_2373207_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	46.2	1.3e-19
WP_015570936.1|2373193_2373580_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	78.1	3.2e-45
WP_058652918.1|2374365_2374557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058652919.1|2375082_2375916_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	78.7	1.4e-122
WP_032645711.1|2375912_2376275_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	83.1	5.2e-50
WP_058652920.1|2376482_2377085_-	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	83.0	3.1e-95
WP_028013336.1|2377472_2377697_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.4	4.7e-25
WP_000343760.1|2377797_2379018_+|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_058652921.1|2379386_2379836_-	VOC family protein	NA	NA	NA	NA	NA
WP_117308975.1|2380323_2381505_+	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_045903081.1|2381776_2382433_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058652923.1|2382494_2383478_-	oxidoreductase	NA	NA	NA	NA	NA
2382857:2382873	attL	TGCCCGGGCTTGAAAGC	NA	NA	NA	NA
WP_058652924.1|2383921_2384140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014832179.1|2384443_2384893_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_058652926.1|2385169_2385856_-	phage replication protein	NA	G8C7U6	Escherichia_phage	63.4	6.4e-81
WP_080399019.1|2385852_2386710_-	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	70.1	2.9e-99
WP_058652928.1|2386854_2387406_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	46.4	5.7e-32
WP_058652929.1|2387408_2387627_-	Rha family transcriptional regulator	NA	K7PKS2	Enterobacteria_phage	57.7	9.2e-18
WP_058652930.1|2387724_2388108_+	hypothetical protein	NA	K7PHG0	Enterobacteria_phage	76.4	1.7e-46
WP_058652931.1|2388275_2389415_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_058652932.1|2389411_2389924_+	DUF4411 family protein	NA	NA	NA	NA	NA
WP_058652934.1|2390700_2393973_+	exodeoxyribonuclease	NA	K7P6V4	Enterobacteria_phage	68.4	0.0e+00
WP_058652935.1|2393983_2395069_+	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	63.1	2.0e-121
WP_020882485.1|2395107_2395350_+	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	93.6	1.3e-33
WP_014884030.1|2395414_2395627_+	DUF1233 family excisionase	NA	A0A0U2RY08	Escherichia_phage	64.8	4.3e-20
WP_058652936.1|2395628_2396867_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	70.5	1.0e-169
WP_155961080.1|2396905_2397841_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	95.3	5.2e-142
WP_003856922.1|2397884_2399258_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.6	1.1e-50
WP_003856916.1|2399742_2400726_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_080399020.1|2400816_2401947_-	chemoreceptor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.6	2.6e-10
WP_058652938.1|2402263_2402752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022651307.1|2402780_2404097_-	type VI secretion system protein VasL	NA	NA	NA	NA	NA
WP_022651308.1|2404120_2404576_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_003856903.1|2405721_2406246_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_126519048.1|2406809_2407085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003856902.1|2407130_2407604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022651313.1|2410233_2411241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039268915.1|2411230_2413693_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_022651315.1|2413697_2414222_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_022651316.1|2414257_2415340_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
2420940:2420956	attR	GCTTTCAAGCCCGGGCA	NA	NA	NA	NA
>prophage 5
NZ_CP046271	Enterobacter hormaechei strain E70 chromosome, complete genome	4572253	2795822	2831157	4572253	integrase,holin,transposase	Escherichia_phage(30.77%)	51	2788990:2789003	2831382:2831395
2788990:2789003	attL	CCGGTCAACTGCAT	NA	NA	NA	NA
WP_044704326.1|2795822_2797091_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.7	6.9e-230
WP_044704327.1|2797090_2797396_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	42.6	2.3e-14
WP_044704329.1|2797506_2797869_+	GtrA family protein	NA	U5P0S6	Shigella_phage	83.3	9.9e-49
WP_044704331.1|2797865_2798792_+	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	91.4	3.9e-158
WP_001310555.1|2799084_2800101_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_155961082.1|2800304_2801450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155961083.1|2801914_2804338_-	hypothetical protein	NA	G0XNW5	Escherichia_phage	40.0	3.2e-143
WP_155961084.1|2804393_2806871_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	92.8	0.0e+00
WP_032677284.1|2806857_2807223_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	90.8	1.6e-62
WP_015571561.1|2807236_2807707_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	80.1	1.0e-66
WP_038416175.1|2807706_2808204_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	90.9	4.6e-89
WP_087451024.1|2808448_2809569_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_003859853.1|2809871_2810102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003859849.1|2810701_2811220_-	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	98.2	6.1e-92
WP_003859846.1|2811689_2811968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003859844.1|2811964_2812507_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	70.4	1.2e-74
WP_001514184.1|2812509_2812785_-|holin	phage holin family protein	holin	S4TNV9	Salmonella_phage	41.0	5.8e-09
WP_155961086.1|2812781_2813183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155961087.1|2813512_2814013_-	antiterminator	NA	G8C7V7	Escherichia_phage	95.7	7.2e-90
WP_155961088.1|2814312_2814954_-	NinG family protein	NA	M9NYX8	Enterobacteria_phage	93.9	3.5e-105
WP_044704910.1|2814946_2815117_-	NinE family protein	NA	G8C7V4	Escherichia_phage	85.7	1.2e-20
WP_032647533.1|2815109_2815559_-	recombination protein NinB	NA	I6R9D0	Salmonella_phage	47.2	2.5e-33
WP_013095965.1|2815743_2815965_-	hypothetical protein	NA	G8C7V2	Escherichia_phage	100.0	6.4e-35
WP_013095964.1|2815967_2816210_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	96.2	1.5e-37
WP_044704913.1|2816209_2816536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_130027228.1|2816607_2816799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047736909.1|2816795_2817419_-	DUF551 domain-containing protein	NA	S4TSR6	Salmonella_phage	36.9	1.5e-33
WP_044704916.1|2817415_2817613_-	hypothetical protein	NA	K7PKS4	Enterobacteria_phage	92.3	1.8e-25
WP_044704918.1|2817609_2817954_-	winged helix-turn-helix transcriptional regulator	NA	G8C7U7	Escherichia_phage	88.5	2.2e-50
WP_044704919.1|2817950_2818826_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	66.2	5.8e-103
WP_044704922.1|2818810_2819680_-	replication protein	NA	K7PGT1	Enterobacteria_phage	51.2	3.9e-67
WP_044704924.1|2819765_2820308_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	92.2	6.6e-89
WP_022650973.1|2820338_2820557_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	47.0	1.9e-10
WP_155961089.1|2820665_2821325_+	helix-turn-helix domain-containing protein	NA	F1C599	Cronobacter_phage	65.6	1.2e-71
WP_044704986.1|2821437_2821851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155961090.1|2821860_2822340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044704990.1|2822341_2822581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046695766.1|2822713_2822911_-	hypothetical protein	NA	G8C7T7	Escherichia_phage	90.6	3.5e-24
WP_154816751.1|2823247_2823424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072056244.1|2823804_2824110_+	superinfection exclusion protein	NA	Q76H37	Enterobacteria_phage	76.3	2.7e-39
WP_044856894.1|2824261_2824468_+	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	98.5	1.1e-31
WP_155961091.1|2824546_2824831_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	94.7	5.0e-48
WP_063840721.1|2824849_2825695_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	61.2	1.8e-69
WP_047028426.1|2825691_2826372_+	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	94.2	8.4e-126
WP_063840722.1|2826368_2826797_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	96.5	1.5e-72
WP_059360873.1|2826793_2826946_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	44.2	2.1e-05
WP_155961098.1|2827755_2828316_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	58.3	4.9e-55
WP_155961092.1|2828312_2828531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017693148.1|2829036_2829510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014070846.1|2829570_2829816_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	67.9	9.4e-27
WP_044704474.1|2829861_2831157_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	68.6	8.7e-180
2831382:2831395	attR	ATGCAGTTGACCGG	NA	NA	NA	NA
>prophage 6
NZ_CP046271	Enterobacter hormaechei strain E70 chromosome, complete genome	4572253	2915058	2922804	4572253		Bodo_saltans_virus(16.67%)	7	NA	NA
WP_003859480.1|2915058_2915670_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	29.3	2.1e-14
WP_003859479.1|2915708_2916689_-	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_003859478.1|2916881_2917886_+	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	29.3	1.1e-33
WP_003859477.1|2917934_2919101_-	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	54.0	4.1e-112
WP_058652854.1|2919340_2920222_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.0	5.8e-103
WP_003859475.1|2920222_2921308_-	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	52.6	3.7e-99
WP_003859473.1|2921397_2922804_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	3.1e-37
>prophage 7
NZ_CP046271	Enterobacter hormaechei strain E70 chromosome, complete genome	4572253	4008166	4107222	4572253	transposase,capsid,tRNA,integrase,protease,head,portal,terminase,tail	uncultured_Caudovirales_phage(40.0%)	87	4068835:4068882	4086932:4086979
WP_058652661.1|4008166_4011022_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.9	1.6e-141
WP_003861887.1|4011145_4011649_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003861889.1|4011732_4012752_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	5.4e-44
WP_022651917.1|4012899_4014546_-	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_022651918.1|4014683_4016186_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	43.6	5.7e-82
WP_096888951.1|4016165_4017107_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	34.4	6.8e-17
WP_058652662.1|4017794_4022255_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_003860453.1|4022264_4023683_+	glutamate synthase subunit GltD	NA	NA	NA	NA	NA
WP_003860450.1|4023739_4024411_-	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_003860449.1|4024609_4025275_-	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_103883337.1|4025443_4026016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058652663.1|4026006_4028424_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_003860443.1|4028438_4029143_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_023323800.1|4029271_4029949_-	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_003860440.1|4030319_4030817_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.6	2.9e-27
WP_003860438.1|4030822_4031461_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_003860436.1|4031768_4032161_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_003860434.1|4032176_4032605_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_003860433.1|4032897_4034022_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_003860432.1|4034211_4034610_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_003860431.1|4034780_4036148_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.4	5.1e-21
WP_003860430.1|4036240_4037308_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_003860429.1|4037359_4038298_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_003860428.1|4038695_4039166_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_003860426.1|4039544_4039808_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_003860424.1|4039867_4040140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003860422.1|4040185_4041640_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_058648370.1|4041726_4043694_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_048209694.1|4043699_4044632_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_003860416.1|4044639_4044843_-	AaeX family protein	NA	NA	NA	NA	NA
WP_003860415.1|4045022_4045949_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_003860414.1|4045998_4047444_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_058652664.1|4047527_4051334_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_003860405.1|4051376_4052846_-	ribonuclease G	NA	NA	NA	NA	NA
WP_003860403.1|4052835_4053429_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_003860402.1|4053438_4053927_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003860400.1|4053926_4054943_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000913396.1|4055005_4056049_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_003860399.1|4056331_4058272_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_003860398.1|4058454_4059429_+	oxidoreductase	NA	NA	NA	NA	NA
WP_003860395.1|4059506_4060508_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_003860393.1|4060508_4061108_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_003860391.1|4061342_4061795_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_003860389.1|4061816_4062281_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_003860388.1|4062291_4063641_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_003860385.1|4063749_4063992_+	YhdT family protein	NA	NA	NA	NA	NA
WP_058652665.1|4063981_4065433_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_003860381.1|4065444_4066326_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_003860379.1|4066463_4067204_+	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_003860376.1|4067533_4068499_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|4068522_4068819_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
4068835:4068882	attL	TGCTTGTTTAAAAAGGCGCTCTTCGGCATGGGGAAGCGCCTTTTTTAT	NA	NA	NA	NA
WP_072206014.1|4069170_4069764_-|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	51.8	5.9e-51
WP_023309412.1|4069796_4071458_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	97.8	0.0e+00
WP_023326190.1|4071441_4071798_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	95.8	4.6e-59
WP_001145894.1|4072071_4072515_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	63.3	1.1e-49
WP_000123150.1|4072514_4072808_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	85.6	2.7e-44
WP_001201224.1|4072804_4073143_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	90.2	1.8e-52
WP_023326191.1|4073139_4074375_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	97.3	1.5e-237
WP_019077813.1|4074376_4074937_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	98.9	3.5e-101
WP_019077814.1|4074988_4076155_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	99.5	4.4e-215
WP_032660547.1|4076397_4076880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032672061.1|4076881_4077943_-	hypothetical protein	NA	U5P4L0	Shigella_phage	40.1	6.6e-69
WP_032672062.1|4078083_4078344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087451024.1|4078424_4079545_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_032672063.1|4079844_4081614_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	51.6	6.2e-128
WP_021538179.1|4081597_4081789_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_021538180.1|4081775_4081991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058652666.1|4081987_4082182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161646063.1|4082160_4082667_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGN8	uncultured_Caudovirales_phage	42.0	2.9e-06
WP_019077824.1|4083955_4084240_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_019077825.1|4084860_4085511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023326200.1|4085510_4086731_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	63.0	1.6e-154
WP_003860373.1|4087094_4087259_+	DUF2556 family protein	NA	NA	NA	NA	NA
4086932:4086979	attR	TGCTTGTTTAAAAAGGCGCTCTTCGGCATGGGGAAGCGCCTTTTTTAT	NA	NA	NA	NA
WP_003860371.1|4087399_4089484_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	34.8	7.0e-22
WP_003860370.1|4089478_4090126_-	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
WP_003860367.1|4090524_4091664_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003860366.1|4091675_4094789_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_003860364.1|4095037_4095259_+	lipoprotein	NA	NA	NA	NA	NA
WP_003863357.1|4101299_4101854_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_022651937.1|4101829_4102078_-	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_022651938.1|4102074_4102893_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_003863353.1|4102897_4103470_-	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	S4VW33	Pandoravirus	25.7	1.9e-09
WP_003863351.1|4103462_4104017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460665.1|4104043_4104517_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_003863350.1|4104488_4105613_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_006812188.1|4105740_4106250_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	3.3e-18
WP_003863341.1|4106274_4107222_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	30.5	1.1e-06
>prophage 1
NZ_CP046272	Enterobacter hormaechei strain E70 plasmid pE70-A, complete sequence	114701	0	63403	114701	terminase,portal,transposase,integrase,tail	Salmonella_phage(91.3%)	77	6676:6692	31446:31462
WP_058652536.1|0_1056_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.6	1.0e-186
WP_006812558.1|1625_1838_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	98.6	3.1e-34
WP_072643051.1|1837_2098_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	100.0	1.3e-42
WP_058652534.1|2170_2350_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	100.0	1.2e-20
WP_058652533.1|2390_2666_-	hypothetical protein	NA	J9Q738	Salmonella_phage	97.8	2.7e-46
WP_058652532.1|2734_3145_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.8	2.4e-75
WP_058652531.1|3128_3500_-	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	98.4	5.2e-69
WP_004110049.1|3662_4493_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	99.3	1.1e-127
WP_058652530.1|4496_4697_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	98.5	2.5e-25
WP_162339404.1|4788_5820_-	recombinase	NA	J9Q736	Salmonella_phage	99.1	9.0e-196
WP_000920226.1|5867_6134_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_058652528.1|6133_7078_-	5'-3' exonuclease	NA	J9Q7S6	Salmonella_phage	98.7	2.2e-180
6676:6692	attL	CAGTCAGCAGGTAGATG	NA	NA	NA	NA
WP_058652527.1|7138_8155_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	99.3	2.4e-164
WP_023180923.1|8274_8706_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	98.6	1.7e-71
WP_058652526.1|9249_9813_+	hypothetical protein	NA	J9Q7G7	Salmonella_phage	65.6	7.6e-64
WP_162339405.1|9849_10266_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	96.4	2.4e-67
WP_058652524.1|10280_13799_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.4	0.0e+00
WP_058652523.1|13979_15215_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	99.3	3.9e-238
WP_058652522.1|15311_17684_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	91.1	0.0e+00
WP_004110118.1|17793_18006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058652521.1|18269_18656_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_058652520.1|18647_19754_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	32.6	5.6e-26
WP_058652519.1|19927_20344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058652518.1|20334_20859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006812570.1|20955_21201_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	44.9	1.0e-12
WP_058652517.1|21200_21560_-	hypothetical protein	NA	K7PH35	Enterobacteria_phage	67.2	2.3e-37
WP_058652516.1|21575_21779_-	hypothetical protein	NA	A0A0B6VT64	Edwardsiella_phage	50.8	5.2e-07
WP_072207462.1|21789_22623_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	65.5	1.4e-90
WP_126519095.1|22806_24003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058652458.1|25007_25313_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	97.0	4.1e-48
WP_022649968.1|25461_25674_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.6	5.8e-33
WP_058652459.1|25833_27156_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	99.1	6.2e-258
WP_032623539.1|27190_27448_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	97.6	4.0e-36
WP_058652460.1|27748_28543_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	74.2	9.9e-110
WP_117308950.1|28729_29086_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_087451024.1|29135_30255_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_006812535.1|30493_30811_+	hypothetical protein	NA	J9Q750	Salmonella_phage	81.9	3.3e-48
WP_006812534.1|30894_31731_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
31446:31462	attR	CATCTACCTGCTGACTG	NA	NA	NA	NA
WP_006812533.1|31869_33060_+	hypothetical protein	NA	J9Q803	Salmonella_phage	54.8	2.4e-120
WP_006812532.1|34494_34737_-	hypothetical protein	NA	J9Q751	Salmonella_phage	93.8	8.9e-38
WP_158009091.1|34726_35041_-	DUF4084 domain-containing protein	NA	NA	NA	NA	NA
WP_032655917.1|35108_35327_+	hypothetical protein	NA	J9Q804	Salmonella_phage	95.8	1.6e-33
WP_006812530.1|35467_35779_+	hypothetical protein	NA	J9Q7T7	Salmonella_phage	97.1	1.2e-47
WP_006812529.1|35907_36303_+	hypothetical protein	NA	J9Q7I1	Salmonella_phage	66.2	2.0e-42
WP_162268523.1|36513_36711_+	hypothetical protein	NA	J9Q753	Salmonella_phage	96.9	3.8e-31
WP_006812526.1|36916_37399_+	hypothetical protein	NA	J9Q805	Salmonella_phage	97.5	2.5e-87
WP_016051712.1|38042_38246_-	hypothetical protein	NA	J9Q7I3	Salmonella_phage	100.0	1.3e-29
WP_040110254.1|38296_38947_-	hypothetical protein	NA	J9Q754	Salmonella_phage	99.1	2.1e-113
WP_006812523.1|39269_39797_-	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	99.3	2.6e-82
WP_000683475.1|39801_40224_-	hypothetical protein	NA	J9Q806	Salmonella_phage	85.7	8.2e-63
WP_001291547.1|40283_40562_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	98.9	3.4e-41
WP_058652472.1|40564_42124_-	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.4	2.2e-294
WP_023316007.1|42206_42887_+	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	99.1	1.3e-121
WP_040110316.1|42886_43555_+	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	99.1	4.3e-114
WP_016051719.1|43551_44190_+	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	100.0	3.8e-112
WP_001113021.1|44182_44437_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	98.8	4.1e-41
WP_058652471.1|44442_45333_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.3	3.1e-168
WP_000176291.1|45342_45609_+	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_058652470.1|45806_46448_+	hypothetical protein	NA	J9Q6D4	Salmonella_phage	97.7	7.5e-108
WP_058652469.1|46450_47707_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	99.8	4.1e-251
WP_058652468.1|47740_49315_+|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	99.0	1.2e-300
WP_040110314.1|49337_50234_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	98.0	5.1e-147
WP_040110313.1|50260_51136_+	hypothetical protein	NA	J9Q710	Salmonella_phage	99.7	1.9e-162
WP_001115046.1|51210_52134_+	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	100.0	3.3e-157
WP_000801184.1|52177_52612_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	100.0	2.1e-74
WP_000057119.1|52611_53445_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	100.0	2.6e-153
WP_001027662.1|53542_53887_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
WP_000523626.1|53877_54351_+	hypothetical protein	NA	J9Q711	Salmonella_phage	100.0	2.3e-82
WP_000469441.1|54352_54736_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	100.0	1.7e-67
WP_058652467.1|54810_55557_+	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	89.1	8.7e-116
WP_000163862.1|55617_55935_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_000952684.1|56060_56285_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	4.2e-34
WP_058652466.1|56292_60873_+	tape measure protein	NA	J9Q712	Salmonella_phage	90.1	0.0e+00
WP_000440566.1|60914_61250_+|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	97.3	5.7e-59
WP_016051624.1|61339_62038_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	100.0	3.7e-137
WP_058652465.1|62030_62828_+|tail	phage tail protein	tail	J9Q7R4	Salmonella_phage	95.1	8.6e-154
WP_023316017.1|62815_63403_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	92.3	1.9e-102
>prophage 2
NZ_CP046272	Enterobacter hormaechei strain E70 plasmid pE70-A, complete sequence	114701	68176	90849	114701	tail,transposase	Salmonella_phage(91.67%)	27	NA	NA
WP_058652464.1|68176_72358_+|tail	phage tail protein	tail	J9Q6E3	Salmonella_phage	79.7	0.0e+00
WP_040110304.1|72422_73211_+	receptor-recognizing protein	NA	E5DHZ0	Enterobacter_phage	63.5	3.9e-58
WP_000064173.1|73285_73609_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	92.5	1.4e-46
WP_006812500.1|73622_74315_+	membrane protein	NA	J9Q7Y7	Salmonella_phage	96.1	3.9e-126
WP_000147960.1|74316_74568_+	hypothetical protein	NA	J9Q7R6	Salmonella_phage	89.2	1.9e-30
WP_080399007.1|74518_74725_+	hypothetical protein	NA	J9Q7G2	Salmonella_phage	78.5	3.1e-23
WP_016582627.1|74752_75277_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016582626.1|75280_75550_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_023315962.1|75966_76632_+	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	95.0	4.7e-113
WP_160956455.1|76637_76991_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	100.0	2.2e-45
WP_077990606.1|77032_77830_-	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	26.1	2.1e-11
WP_058652463.1|78093_78819_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	98.8	1.1e-139
WP_006812582.1|78879_80220_+	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	99.8	1.3e-247
WP_058652462.1|80309_81494_+	hypothetical protein	NA	J9Q720	Salmonella_phage	94.6	4.3e-210
WP_117308951.1|81485_82367_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_087451024.1|82437_83558_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_006812537.1|83962_84166_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	97.0	6.8e-31
WP_117308952.1|84221_84920_-	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	89.2	2.7e-111
WP_072643031.1|84958_85510_-	hypothetical protein	NA	J9Q748	Salmonella_phage	91.3	6.7e-97
WP_072643032.1|85506_86148_-	HD domain-containing protein	NA	J9Q7H7	Salmonella_phage	97.2	6.5e-112
WP_047055004.1|86239_86611_-	hypothetical protein	NA	J9Q7T4	Salmonella_phage	96.7	2.0e-60
WP_006812541.1|86613_86895_-	hypothetical protein	NA	J9Q801	Salmonella_phage	100.0	6.5e-48
WP_117308953.1|86891_87581_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	97.8	6.1e-124
WP_162339402.1|87639_89325_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	98.0	0.0e+00
WP_072643034.1|89466_90039_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	97.9	4.5e-96
WP_117308955.1|90156_90345_-	hypothetical protein	NA	J9Q800	Salmonella_phage	93.5	1.3e-23
WP_047055014.1|90354_90849_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	95.1	6.2e-78
>prophage 3
NZ_CP046272	Enterobacter hormaechei strain E70 plasmid pE70-A, complete sequence	114701	93940	113957	114701		Salmonella_phage(95.0%)	20	NA	NA
WP_016245729.1|93940_95938_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.2	2.6e-21
WP_000262979.1|96777_97008_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	100.0	2.1e-36
WP_004109976.1|97210_97804_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	100.0	2.1e-112
WP_072643035.1|97989_98916_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	93.2	2.2e-108
WP_000208226.1|98960_99518_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	99.5	7.0e-102
WP_004109992.1|99527_99947_-	hypothetical protein	NA	J9Q743	Salmonella_phage	97.8	6.4e-68
WP_000386471.1|100010_100655_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	100.0	5.2e-117
WP_160859086.1|100654_101125_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	100.0	2.0e-89
WP_160956520.1|101127_101523_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	97.7	3.6e-68
WP_022649915.1|101542_102646_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	99.2	1.1e-218
WP_057102246.1|102835_103705_-	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	99.0	2.1e-161
WP_058652544.1|103787_104930_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	99.7	4.9e-219
WP_058652543.1|105037_107353_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	99.6	0.0e+00
WP_058652542.1|107430_108000_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	99.5	1.3e-103
WP_058652541.1|108011_108758_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	98.4	1.5e-136
WP_162339403.1|108747_109251_-	SMC family ATPase	NA	J9Q741	Salmonella_phage	98.8	8.2e-86
WP_058652539.1|110893_111979_-	exonuclease	NA	J9Q7S9	Salmonella_phage	98.9	1.6e-206
WP_000832167.1|112207_112711_+	hypothetical protein	NA	J9Q7Z6	Salmonella_phage	98.2	5.5e-90
WP_058652538.1|112742_113237_-	hypothetical protein	NA	J9Q6J3	Salmonella_phage	97.0	3.3e-87
WP_058652537.1|113312_113957_-	hypothetical protein	NA	J9Q739	Salmonella_phage	98.6	1.1e-122
>prophage 1
NZ_CP046273	Enterobacter hormaechei strain E70 plasmid pE70-sul2, complete sequence	67220	34283	57016	67220	integrase,transposase	Escherichia_phage(28.57%)	20	45324:45383	54108:54928
WP_015572054.1|34283_35060_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.2	7.0e-52
WP_015572055.1|35762_36773_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	55.2	6.3e-85
WP_023327689.1|37513_38680_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	94.3	5.5e-218
WP_013087134.1|38679_39645_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	76.9	9.8e-136
WP_072199628.1|40294_40975_-	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	62.8	1.6e-79
WP_001067855.1|41042_41747_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_023352616.1|41793_42402_-	tetracycline resistance transcriptional repressor TetR(D)	NA	NA	NA	NA	NA
WP_001039466.1|42497_43682_+	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
WP_000842134.1|43776_44886_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	2.8e-33
45324:45383	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067855.1|45375_46080_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845048.1|46150_47164_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|47319_47793_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001144737.1|48013_48280_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_001389365.1|48422_49187_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004098817.1|49447_50662_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001288432.1|50695_52129_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_001749967.1|52510_52717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000893479.1|52721_53231_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_001067855.1|53410_54115_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000427619.1|56011_57016_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
54108:54928	attR	AAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCAGCTGCGGGCCGCTCCCGCCGCGAAGGACGTGCTCGACGCCATCGAGGTGCTGCGCGGCATGAACAGCGACAACGCCCGCAAGGTGCCCGCCGACGCGCCGACCGAGTTCATCAAGCCGCGCTGGCAGAAGCTGGTCATGACCGACACCGGCATCGACCGGCGCTACTACGAACTGTGCGCGCTGTCGGAGATGAAGAACGCGTTGCGTTCCGGCGACATCTGGGTGCAGGGGTCGCGCCAGTTCAAGGACTTCGAGGACTACCTGGTGCCGCCCGCGAAATTCGCCAGCCTCAAGCAGGCCAGCGAATTGCCGCTGGCCGTGGCCACCGACTGCAACCGGTACCTGAACGACCGGCTGACGCTGCTGGAAACACAGCTTGCCACCGTCAACCGTATGGCGACGGCCAACGAGCTGCCGGACGCCATCATCACCGAGTCAGGCTTGAAGATCACGCCGCTCGACGCGGCGGTACCCGACACCGCCCAAGCGCTGATCGACCAGACGGCAATGATCCTGCCGCACGTCAAGATCACCGAACTGCTGCTGGAGGTGGACGAATGGACGGGCTTCACTCGGCATTTCGCGCATCTGAAATCGGGCGACCCGGCCAAAGACAAGAACCTGTTGCTGACCACGATCCTCGCCGACGCGATCAACCTGGGCCTGACCAAGATGGCGGAGTCTTGCCCCGGCACGACCTACGCCAAGCTGGCTTGGCTGCAAGCCTGGCACATCCGCGACGAAACCTACGGGGCGGCG	NA	NA	NA	NA
>prophage 1
NZ_CP046274	Enterobacter hormaechei strain E70 plasmid pE70-NDM1, complete sequence	53773	36834	44611	53773	transposase	Escherichia_phage(57.14%)	8	NA	NA
WP_001067855.1|36834_37539_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002904004.1|37675_38536_+	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|38556_39318_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_001067855.1|40158_40863_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001549892.1|41255_41495_-	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.1	4.4e-21
WP_000343760.1|41596_42817_+|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_001549893.1|42905_43568_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
WP_000516402.1|43948_44611_+	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
