The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP033387	Salmonella enterica subsp. enterica strain CFSA1007 chromosome, complete genome	4760681	137868	146136	4760681	transposase	Prochlorococcus_phage(16.67%)	7	NA	NA
WP_000587771.1|137868_138801_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	36.4	8.5e-36
WP_023227672.1|139003_140200_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	30.1	1.6e-34
WP_000645990.1|140209_141235_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_023227671.1|141527_142562_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.3	1.4e-07
WP_001627139.1|142548_143511_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001339197.1|143528_144737_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_001214125.1|144852_146136_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	30.3	6.1e-08
>prophage 2
NZ_CP033387	Salmonella enterica subsp. enterica strain CFSA1007 chromosome, complete genome	4760681	1152570	1235209	4760681	tail,tRNA,head,transposase,portal,capsid,terminase,holin,integrase	Cronobacter_phage(51.22%)	81	1160547:1160562	1188237:1188252
WP_000469807.1|1152570_1153338_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|1153378_1153726_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001030985.1|1153881_1155102_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_089541747.1|1155094_1155613_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|1156052_1157123_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_023227266.1|1157132_1158254_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000210991.1|1158311_1159220_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200077.1|1159180_1160341_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|1160440_1160488_-	hypothetical protein	NA	NA	NA	NA	NA
1160547:1160562	attL	AAAACGCGCCCGAAGG	NA	NA	NA	NA
WP_077944531.1|1160651_1161671_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.5	6.3e-109
WP_000085723.1|1161710_1162010_-	helix-turn-helix domain-containing protein	NA	Q1JS21	Enterobacteria_phage	53.2	3.8e-22
WP_002954289.1|1162118_1162457_+	phage regulatory protein	NA	NA	NA	NA	NA
WP_000645096.1|1162482_1162815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681786.1|1162824_1163394_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.8	1.2e-43
WP_000922120.1|1163396_1163615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054175272.1|1163653_1166311_+	toprim domain protein	NA	A0A077K8T2	Ralstonia_phage	47.6	7.1e-245
WP_000088096.1|1166338_1166662_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	73.1	1.3e-36
WP_054175273.1|1166661_1167681_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	67.8	2.5e-134
WP_054175274.1|1167677_1169462_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	69.5	1.9e-246
WP_000273112.1|1169519_1170509_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.3	2.5e-46
WP_001176503.1|1170543_1171572_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	3.7e-133
WP_001177276.1|1171583_1172282_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.6	3.6e-63
WP_000491223.1|1172380_1172833_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	64.7	1.2e-48
WP_000080871.1|1172829_1173312_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	2.3e-37
WP_001534848.1|1173308_1174013_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.9	1.8e-70
WP_001748058.1|1174009_1175137_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.5	2.1e-174
WP_054175275.1|1175133_1175589_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	70.9	2.3e-58
WP_001154426.1|1175601_1175898_+|holin	holin	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
WP_054175276.1|1175894_1176236_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	93.1	7.6e-51
WP_054175277.1|1176235_1176568_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	69.1	9.7e-35
WP_000411500.1|1176714_1176972_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	2.3e-20
WP_000811098.1|1177159_1179127_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	4.3e-271
WP_001002797.1|1179123_1179453_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_054175278.1|1179449_1180634_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	1.1e-178
WP_001001824.1|1180626_1181214_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
WP_054175279.1|1181223_1183236_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001215677.1|1183238_1183769_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_054175280.1|1183758_1184484_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_000200789.1|1184455_1185001_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_054175283.1|1185003_1186704_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	2.2e-223
WP_001748131.1|1187737_1188124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178449.1|1188281_1188620_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
1188237:1188252	attR	AAAACGCGCCCGAAGG	NA	NA	NA	NA
WP_000197660.1|1188891_1189629_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079130.1|1189760_1190741_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000992640.1|1190737_1191469_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_023227274.1|1200120_1200576_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.9e-34
WP_000807818.1|1200679_1201981_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.2e-43
WP_001264473.1|1201977_1202301_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949286.1|1202345_1203701_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082642.1|1203815_1206476_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_023227275.1|1206529_1207210_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_023227276.1|1207282_1207702_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000997368.1|1207905_1208943_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1209058_1209748_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1210066_1210450_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_023227277.1|1210511_1211099_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_023227278.1|1211201_1212101_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023227279.1|1212118_1213453_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083338.1|1213582_1214320_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_023227280.1|1214304_1215927_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1216190_1216355_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1216351_1216927_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1216958_1217609_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812021.1|1217608_1218565_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589049.1|1218561_1219041_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000790154.1|1219292_1221092_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1221108_1222083_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1222356_1223037_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102230.1|1223033_1223939_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399380.1|1223950_1224679_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818964.1|1224690_1225422_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1225421_1225802_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196291.1|1225913_1226174_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
WP_001022463.1|1226211_1227138_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001339197.1|1227711_1228920_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_023227281.1|1229809_1230727_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|1230764_1231613_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048531.1|1231728_1232622_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361660.1|1232632_1233994_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_000253558.1|1233997_1234633_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_023216173.1|1234657_1235209_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP033387	Salmonella enterica subsp. enterica strain CFSA1007 chromosome, complete genome	4760681	1446948	1453809	4760681	transposase	Salmonella_virus(42.86%)	7	NA	NA
WP_106417237.1|1446948_1447095_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	73.9	1.1e-14
WP_109166850.1|1447110_1447254_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	85.4	2.6e-13
WP_023226601.1|1448243_1450166_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.8	3.9e-301
WP_000703601.1|1450172_1450439_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.3e-25
WP_023226602.1|1450407_1450797_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	97.5	1.3e-59
WP_001067855.1|1450908_1451613_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001590337.1|1452867_1453809_-	transporter protein	NA	E7DYY8	Enterobacteria_phage	87.8	4.1e-147
>prophage 4
NZ_CP033387	Salmonella enterica subsp. enterica strain CFSA1007 chromosome, complete genome	4760681	1685377	1694548	4760681	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1685377_1686325_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824854.1|1686308_1687040_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1687020_1687128_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1687187_1687919_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1688141_1689827_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1689823_1690543_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950415.1|1690589_1691057_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	6.7e-74
WP_023226723.1|1691113_1691644_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1691815_1692274_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_023226722.1|1692514_1694548_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 5
NZ_CP033387	Salmonella enterica subsp. enterica strain CFSA1007 chromosome, complete genome	4760681	1931189	1942479	4760681	integrase	Burkholderia_phage(25.0%)	12	1925443:1925458	1939790:1939805
1925443:1925458	attL	GAACAGGTGGATAAGG	NA	NA	NA	NA
WP_023226634.1|1931189_1932371_+	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	26.9	2.4e-35
WP_023226633.1|1932371_1933118_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_023226632.1|1933219_1934476_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	41.3	3.4e-80
WP_023226631.1|1934956_1935118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394197.1|1935244_1935664_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_023194544.1|1935666_1936935_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.7	3.8e-228
WP_000208509.1|1937389_1937602_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1937612_1937801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024154957.1|1938059_1939238_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.2	8.6e-110
WP_023227458.1|1939888_1940200_+	hypothetical protein	NA	NA	NA	NA	NA
1939790:1939805	attR	GAACAGGTGGATAAGG	NA	NA	NA	NA
WP_023227459.1|1940279_1940975_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	1.6e-07
WP_001157305.1|1941048_1942479_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 6
NZ_CP033387	Salmonella enterica subsp. enterica strain CFSA1007 chromosome, complete genome	4760681	2256716	2262528	4760681		Escherichia_phage(33.33%)	8	NA	NA
WP_000230462.1|2256716_2257523_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
WP_001128869.1|2257524_2258517_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_001146150.1|2258516_2259407_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_023227163.1|2259530_2259932_+	DUF4102 domain-containing protein	NA	K7PGY1	Enterobacteria_phage	58.4	3.8e-33
WP_051129228.1|2260231_2261119_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	38.5	5.6e-37
WP_023227161.1|2261425_2261695_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	92.1	1.8e-26
WP_071525147.1|2262049_2262190_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	74.3	1.1e-08
WP_071601154.1|2262228_2262528_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	57.1	2.2e-14
>prophage 7
NZ_CP033387	Salmonella enterica subsp. enterica strain CFSA1007 chromosome, complete genome	4760681	2731261	2738724	4760681	transposase	Escherichia_phage(42.86%)	9	NA	NA
WP_000497451.1|2731261_2731501_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_001036668.1|2731712_2731877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023226907.1|2732374_2733184_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	9.2e-63
WP_001277616.1|2733256_2733634_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_023226906.1|2733781_2734324_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	66.5	1.1e-70
WP_023218771.1|2734515_2735244_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	1.4e-62
WP_023226904.1|2735260_2735674_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
WP_023226903.1|2736624_2737749_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_000502119.1|2738265_2738724_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
>prophage 8
NZ_CP033387	Salmonella enterica subsp. enterica strain CFSA1007 chromosome, complete genome	4760681	3562097	3609417	4760681	coat,transposase,protease,portal,lysis,terminase,integrase	Enterobacteria_phage(73.44%)	66	3564180:3564225	3605526:3605571
WP_085948316.1|3562097_3563370_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
WP_023227314.1|3563590_3563785_-	hypothetical protein	NA	NA	NA	NA	NA
3564180:3564225	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000915528.1|3564513_3564876_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_000703639.1|3564872_3565805_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
WP_000671496.1|3565794_3567252_+	hypothetical protein	NA	A8CG94	Salmonella_phage	100.0	1.3e-240
WP_000129933.1|3567310_3569314_-	endorhamnosidase	NA	Q76H47	Enterobacteria_phage	100.0	0.0e+00
WP_000532177.1|3569449_3569698_+	Arc family DNA-binding protein	NA	Q76H48	Enterobacteria_phage	100.0	1.8e-38
WP_071533035.1|3569718_3570012_-	hypothetical protein	NA	Q76H12	Enterobacteria_phage	100.0	3.2e-50
WP_001029860.1|3570150_3572127_-	hypothetical protein	NA	Q76H13	Enterobacteria_phage	100.0	0.0e+00
WP_000246977.1|3572126_3573563_-	DNA transfer protein	NA	Q76H14	Enterobacteria_phage	100.0	7.7e-246
WP_000964904.1|3573573_3574263_-	hypothetical protein	NA	A0A2H5BFK5	Salmonella_phage	100.0	2.9e-118
WP_000627593.1|3574265_3574721_-	DUF2824 family protein	NA	Q76H16	Enterobacteria_phage	100.0	1.8e-87
WP_000774917.1|3574720_3575422_-	hypothetical protein	NA	Q76H17	Enterobacteria_phage	100.0	1.7e-76
WP_001122420.1|3575425_3576844_-	Packaged DNA stabilization protein gp10	NA	Q76H18	Enterobacteria_phage	100.0	6.4e-277
WP_001166103.1|3576803_3577304_-	packaged DNA stabilization protein p27	NA	Q76H19	Enterobacteria_phage	100.0	4.2e-90
WP_000538670.1|3577287_3577848_-	hypothetical protein	NA	C6ZR11	Salmonella_phage	100.0	9.8e-104
WP_001196937.1|3577888_3579181_-|coat	coat protein	coat	Q76H21	Enterobacteria_phage	100.0	1.1e-243
WP_051129359.1|3579180_3580089_-	scaffolding protein	NA	A0A2D1GLN7	Escherichia_phage	94.1	4.3e-149
WP_051129358.1|3580102_3582268_-|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	99.6	0.0e+00
WP_051129357.1|3582268_3583768_-|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	99.4	9.1e-306
WP_000729923.1|3583745_3584234_-	hypothetical protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_001687044.1|3584237_3584642_-	hypothetical protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
WP_001140562.1|3584641_3585031_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_000808099.1|3585034_3585277_-	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_000877028.1|3585499_3586030_-	KilA-N domain-containing protein	NA	Q76H61	Enterobacteria_phage	100.0	1.3e-94
WP_001687043.1|3586242_3586710_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	100.0	1.7e-77
WP_024136257.1|3586706_3587204_-	lysozyme	NA	B8K1G9	Salmonella_phage	100.0	4.5e-92
WP_000286100.1|3587181_3587385_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_001047566.1|3587815_3588589_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	100.0	8.1e-133
WP_000219133.1|3588585_3588765_-	hypothetical protein	NA	Q76H67	Enterobacteria_phage	100.0	1.9e-24
WP_000149882.1|3588745_3588949_-	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
WP_000036320.1|3588945_3589170_-	hypothetical protein	NA	Q76H69	Enterobacteria_phage	100.0	6.3e-38
WP_001108073.1|3589166_3589778_-	recombination protein NinG	NA	Q76H70	Enterobacteria_phage	100.0	7.9e-99
WP_000950963.1|3589770_3589947_-	protein ninF	NA	Q76H71	Enterobacteria_phage	100.0	6.7e-27
WP_001532927.1|3589939_3590281_-	DUF2591 domain-containing protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
WP_000113770.1|3590283_3590460_-	NinE family protein	NA	Q76H73	Enterobacteria_phage	100.0	1.0e-27
WP_000736891.1|3590596_3591034_-	recombination protein NinB	NA	Q76H49	Enterobacteria_phage	100.0	4.5e-80
WP_001036030.1|3591107_3591377_-	hypothetical protein	NA	Q76H50	Enterobacteria_phage	100.0	4.9e-45
WP_001248410.1|3591373_3592750_-	AAA family ATPase	NA	Q76H51	Enterobacteria_phage	100.0	1.9e-254
WP_000539342.1|3592746_3593568_-	replication protein	NA	Q76H52	Enterobacteria_phage	100.0	5.2e-154
WP_001103492.1|3593750_3594032_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000182204.1|3594142_3594358_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_000712403.1|3594468_3595158_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
WP_001532928.1|3595322_3596402_+	hypothetical protein	NA	A0A192Y6S0	Salmonella_phage	100.0	1.5e-193
WP_000834175.1|3596440_3596644_-	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	100.0	2.0e-27
WP_000216178.1|3597007_3597310_+	hypothetical protein	NA	Q76H58	Enterobacteria_phage	100.0	9.7e-50
WP_001066179.1|3597322_3597910_-	superinfection exclusion protein B	NA	Q76H59	Enterobacteria_phage	100.0	1.4e-100
WP_000213982.1|3598123_3598318_+	Restriction inhibitor protein ral	NA	Q76H34	Enterobacteria_phage	100.0	1.9e-30
WP_072097849.1|3598401_3599016_+	pentapeptide repeat-containing protein	NA	Q76H35	Enterobacteria_phage	94.4	7.0e-47
WP_000713613.1|3599049_3599337_+	hypothetical protein	NA	Q76H36	Enterobacteria_phage	100.0	2.7e-49
WP_000776963.1|3599612_3599927_+	Superinfection exclusion protein	NA	Q76H37	Enterobacteria_phage	100.0	1.5e-56
WP_000141641.1|3600011_3600170_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_001046968.1|3600468_3601176_+	recombinase	NA	Q76H40	Enterobacteria_phage	100.0	3.1e-139
WP_001253476.1|3601175_3601460_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_001111291.1|3601506_3601800_+	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	100.0	1.4e-48
WP_001214777.1|3601810_3601981_+	DUF2737 family protein	NA	Q76H43	Enterobacteria_phage	100.0	1.6e-25
WP_000812203.1|3601977_3602487_+	hypothetical protein	NA	Q76H44	Enterobacteria_phage	100.0	2.8e-89
WP_071533029.1|3602483_3602717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025617570.1|3602703_3603348_+	DUF551 domain-containing protein	NA	Q76H45	Enterobacteria_phage	99.5	1.4e-122
WP_000371199.1|3603347_3603632_+	DUF4752 family protein	NA	Q76H46	Enterobacteria_phage	100.0	1.6e-49
WP_000002104.1|3603624_3603909_+	ASCH domain-containing protein	NA	Q76H28	Enterobacteria_phage	100.0	1.4e-50
WP_155675089.1|3603977_3604118_+	hypothetical protein	NA	A0A0M4QWX3	Salmonella_phage	97.8	4.2e-16
WP_000051897.1|3604347_3605511_+|integrase	site-specific integrase	integrase	Q76H30	Enterobacteria_phage	100.0	3.7e-230
WP_000893225.1|3605716_3606967_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	4.7e-98
3605526:3605571	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285275.1|3606978_3608082_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043667.1|3608364_3609417_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	2.6e-113
>prophage 9
NZ_CP033387	Salmonella enterica subsp. enterica strain CFSA1007 chromosome, complete genome	4760681	3618405	3681071	4760681	plate,transposase	Caulobacter_phage(33.33%)	51	NA	NA
WP_023226548.1|3618405_3619392_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000284051.1|3619705_3620284_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	30.8	1.3e-13
WP_000973041.1|3620523_3622968_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_023226791.1|3623076_3623844_+	amidohydrolase	NA	NA	NA	NA	NA
WP_000788200.1|3624214_3624622_+	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_023226792.1|3624952_3625672_+	adhesin/invasin protein PagN	NA	NA	NA	NA	NA
WP_031603649.1|3625675_3625864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023226793.1|3626634_3627252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000141547.1|3627391_3627847_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_023226794.1|3627979_3629038_-	fimbrial protein TcfD	NA	NA	NA	NA	NA
WP_023226795.1|3629060_3631748_-	fimbrial outer membrane usher protein TcfC	NA	NA	NA	NA	NA
WP_000287810.1|3631856_3632432_-	fimbrial protein TcfB	NA	NA	NA	NA	NA
WP_001009507.1|3632482_3633193_-	fimbrial protein TcfA	NA	NA	NA	NA	NA
WP_001537061.1|3635084_3635210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000970302.1|3635329_3636277_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001550229.1|3636753_3637014_-	transcriptional activator PerC	NA	NA	NA	NA	NA
WP_023209688.1|3637093_3637915_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000266939.1|3638322_3638793_-	pilin structural protein SafD	NA	NA	NA	NA	NA
WP_053505593.1|3638814_3641325_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_051129375.1|3641348_3642089_-	pili assembly chaperone PapD	NA	NA	NA	NA	NA
WP_051129374.1|3642163_3642661_-	Saf-pilin pilus formation protein SafA	NA	NA	NA	NA	NA
WP_051129373.1|3642793_3643288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051129376.1|3644844_3645072_+	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
WP_127201574.1|3645117_3645582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053505599.1|3647107_3647716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000375832.1|3651859_3652306_-	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
WP_023227778.1|3652329_3654519_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_000968384.1|3654915_3655437_-	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_023227777.1|3655460_3655877_-	DUF2195 family protein	NA	NA	NA	NA	NA
WP_001668725.1|3656003_3656465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023227776.1|3656449_3656920_-	glucosaminidase domain-containing protein	NA	NA	NA	NA	NA
WP_001254127.1|3656962_3657730_-	DUF2094 domain-containing protein	NA	NA	NA	NA	NA
WP_023227775.1|3657729_3661599_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_023166851.1|3661632_3662064_-	putative Shiga-like toxin A subunit	NA	NA	NA	NA	NA
WP_001339197.1|3662796_3664005_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000132483.1|3664381_3665686_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_023227773.1|3665682_3667026_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_023227772.1|3667029_3667566_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000119443.1|3667632_3668118_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_000379146.1|3668260_3668644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001081544.1|3668628_3669114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000312802.1|3669418_3669904_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_077907151.1|3670159_3670492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000013884.1|3670791_3672300_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_023227770.1|3672323_3672869_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_023227769.1|3672968_3675608_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	30.9	5.3e-75
WP_023227768.1|3675975_3676878_+	type VI secretion system-associated protein TagK	NA	NA	NA	NA	NA
WP_000750543.1|3676864_3677689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000108007.1|3677685_3678180_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_023227767.1|3678195_3680079_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000145239.1|3680075_3681071_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 1
NZ_CP033385	Salmonella enterica subsp. enterica strain CFSA1007 plasmid pCFSA1007-1, complete sequence	181821	143365	162168	181821	transposase	Escherichia_phage(55.56%)	18	NA	NA
WP_001067855.1|143365_144070_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000376616.1|144187_144391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|144518_145358_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|145351_145699_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|145921_146374_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000186237.1|146458_147091_-	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001334766.1|147228_148059_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|148189_148744_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|148887_149592_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000503573.1|149793_150582_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|150712_151186_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_001067855.1|152088_152793_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000050481.1|153646_155188_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_032492390.1|156586_157360_+	ArmA family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_155675077.1|157845_158007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064441851.1|158764_159058_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	97.8	1.0e-51
WP_032193599.1|160729_161434_-	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	28.7	6.4e-20
WP_001067858.1|161463_162168_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
