The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP033384	Salmonella enterica subsp. enterica strain CFSA300 chromosome, complete genome	4784833	137859	146127	4784833	transposase	Prochlorococcus_phage(16.67%)	7	NA	NA
WP_000587771.1|137859_138792_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	36.4	8.5e-36
WP_023227672.1|138994_140191_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	30.1	1.6e-34
WP_000645990.1|140200_141226_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_023227671.1|141518_142553_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.3	1.4e-07
WP_001627139.1|142539_143502_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001339197.1|143519_144728_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_001214125.1|144843_146127_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	30.3	6.1e-08
>prophage 2
NZ_CP033384	Salmonella enterica subsp. enterica strain CFSA300 chromosome, complete genome	4784833	648896	705377	4784833	portal,tRNA,tail,head,transposase,holin,integrase,terminase,capsid	Cronobacter_phage(61.54%)	60	638765:638786	687847:687868
638765:638786	attL	TAAGCGCAGCGCCATCAGGCAA	NA	NA	NA	NA
WP_001748617.1|648896_649934_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	65.6	7.1e-124
WP_001748619.1|649920_650814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001748620.1|650842_651421_-	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	39.5	1.5e-27
WP_001247709.1|651540_651762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460877.1|651792_652296_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_000643375.1|652305_652533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024139063.1|652522_652948_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.9e-23
WP_001748623.1|652947_653349_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.9e-48
WP_071592686.1|653495_653672_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000422609.1|653662_654259_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	72.3	3.8e-74
WP_000153512.1|654255_654585_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	45.2	3.0e-12
WP_001748626.1|654574_655435_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	82.4	4.9e-131
WP_001748628.1|657574_657781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001552031.1|657754_658078_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_001650413.1|658074_659136_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.3	3.0e-162
WP_051129117.1|659132_660908_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	83.3	7.5e-291
WP_000018798.1|661068_661869_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	54.8	3.2e-76
WP_000550496.1|661930_662953_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_001218534.1|662956_663661_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	67.4	1.0e-86
WP_000398492.1|663664_663859_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	58.6	3.3e-11
WP_000447490.1|663919_664408_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	81.3	4.3e-63
WP_000084220.1|664404_664911_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
WP_000560081.1|664907_665615_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.5	3.4e-101
WP_000220205.1|665611_666739_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	3.3e-175
WP_000166743.1|666735_667191_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|667200_667494_+|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|667490_667832_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376374.1|667831_668164_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	2.0e-35
WP_000411340.1|668310_668568_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_051129153.1|668755_670726_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	69.8	3.6e-270
WP_001002797.1|670722_671052_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_054175278.1|671048_672233_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	1.1e-178
WP_001001824.1|672225_672813_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
WP_001215677.1|674836_675367_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_000267954.1|675356_676082_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	3.8e-68
WP_000200791.1|676053_676599_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
WP_001747522.1|676601_678302_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	1.7e-223
WP_000237776.1|679473_679980_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001519776.1|680103_681951_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000918865.1|682100_683846_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001144069.1|684081_684297_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_023200351.1|684524_685538_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	8.2e-109
WP_001272784.1|685787_686399_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_000355776.1|686505_686865_+	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_001281933.1|686962_687784_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_023226571.1|687888_689130_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	47.9	6.5e-92
687847:687868	attR	TAAGCGCAGCGCCATCAGGCAA	NA	NA	NA	NA
WP_001125344.1|689192_689807_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_000046224.1|690048_691350_+	inorganic triphosphatase	NA	NA	NA	NA	NA
WP_023226570.1|691467_694311_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_051129145.1|694358_695792_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	28.6	7.4e-39
WP_105887527.1|695951_696170_-	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_000342879.1|696249_697929_-	flotillin family protein	NA	NA	NA	NA	NA
WP_000171739.1|697947_698568_-	YqiJ family protein	NA	NA	NA	NA	NA
WP_000928927.1|698825_699035_+	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
WP_000566824.1|699108_699405_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_001076978.1|699841_700495_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.8	1.6e-44
WP_000345576.1|700665_701343_-	protein-disulfide oxidoreductase DsbI	NA	NA	NA	NA	NA
WP_000096232.1|701357_702029_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_000460259.1|702048_703845_-	aryl-sulfate sulfotransferase	NA	NA	NA	NA	NA
WP_001339197.1|704168_705377_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
>prophage 3
NZ_CP033384	Salmonella enterica subsp. enterica strain CFSA300 chromosome, complete genome	4784833	1182719	1264021	4784833	portal,tRNA,tail,head,holin,integrase,terminase,capsid	Cronobacter_phage(51.22%)	82	1190696:1190711	1218386:1218401
WP_000469807.1|1182719_1183487_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|1183527_1183875_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001030985.1|1184030_1185251_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_089541747.1|1185243_1185762_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|1186201_1187272_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_023227266.1|1187281_1188403_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000210991.1|1188460_1189369_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200077.1|1189329_1190490_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|1190589_1190637_-	hypothetical protein	NA	NA	NA	NA	NA
1190696:1190711	attL	AAAACGCGCCCGAAGG	NA	NA	NA	NA
WP_077944531.1|1190800_1191820_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.5	6.3e-109
WP_000085723.1|1191859_1192159_-	helix-turn-helix domain-containing protein	NA	Q1JS21	Enterobacteria_phage	53.2	3.8e-22
WP_002954289.1|1192267_1192606_+	phage regulatory protein	NA	NA	NA	NA	NA
WP_000645096.1|1192631_1192964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681786.1|1192973_1193543_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.8	1.2e-43
WP_000922120.1|1193545_1193764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054175272.1|1193802_1196460_+	toprim domain protein	NA	A0A077K8T2	Ralstonia_phage	47.6	7.1e-245
WP_000088096.1|1196487_1196811_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	73.1	1.3e-36
WP_054175273.1|1196810_1197830_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	67.8	2.5e-134
WP_054175274.1|1197826_1199611_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	69.5	1.9e-246
WP_000273112.1|1199668_1200658_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.3	2.5e-46
WP_001176503.1|1200692_1201721_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	3.7e-133
WP_001177276.1|1201732_1202431_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.6	3.6e-63
WP_000491223.1|1202529_1202982_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	64.7	1.2e-48
WP_000080871.1|1202978_1203461_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	2.3e-37
WP_001534848.1|1203457_1204162_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.9	1.8e-70
WP_001748058.1|1204158_1205286_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.5	2.1e-174
WP_054175275.1|1205282_1205738_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	70.9	2.3e-58
WP_001154426.1|1205750_1206047_+|holin	holin	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
WP_054175276.1|1206043_1206385_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	93.1	7.6e-51
WP_054175277.1|1206384_1206717_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	69.1	9.7e-35
WP_000411500.1|1206863_1207121_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	2.3e-20
WP_000811098.1|1207308_1209276_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	4.3e-271
WP_001002797.1|1209272_1209602_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_054175278.1|1209598_1210783_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	1.1e-178
WP_001001824.1|1210775_1211363_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
WP_054175279.1|1211372_1213385_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001215677.1|1213387_1213918_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_054175280.1|1213907_1214633_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_000200789.1|1214604_1215150_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_054175283.1|1215152_1216853_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	2.2e-223
WP_001748131.1|1217886_1218273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178449.1|1218430_1218769_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
1218386:1218401	attR	AAAACGCGCCCGAAGG	NA	NA	NA	NA
WP_000197660.1|1219040_1219778_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079130.1|1219909_1220890_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000992640.1|1220886_1221618_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235094.1|1221747_1224321_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	9.0e-128
WP_023227274.1|1230270_1230726_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.9e-34
WP_000807818.1|1230829_1232131_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.2e-43
WP_001264473.1|1232127_1232451_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949286.1|1232495_1233851_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082642.1|1233965_1236626_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_023227275.1|1236679_1237360_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_023227276.1|1237432_1237852_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000997368.1|1238055_1239093_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1239208_1239898_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1240216_1240600_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_023227277.1|1240661_1241249_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_023227278.1|1241351_1242251_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023227279.1|1242268_1243603_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083338.1|1243732_1244470_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_023227280.1|1244454_1246077_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1246340_1246505_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1246501_1247077_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1247108_1247759_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812021.1|1247758_1248715_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589049.1|1248711_1249191_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000790154.1|1249442_1251242_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1251258_1252233_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1252506_1253187_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102230.1|1253183_1254089_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399380.1|1254100_1254829_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818964.1|1254840_1255572_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1255571_1255952_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196291.1|1256063_1256324_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
WP_001022463.1|1256361_1257288_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276364.1|1257403_1258600_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_023227281.1|1258621_1259539_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|1259576_1260425_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048531.1|1260540_1261434_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361660.1|1261444_1262806_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_000253558.1|1262809_1263445_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_023216173.1|1263469_1264021_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP033384	Salmonella enterica subsp. enterica strain CFSA300 chromosome, complete genome	4784833	1475760	1482621	4784833	transposase	Salmonella_virus(42.86%)	7	NA	NA
WP_106417237.1|1475760_1475907_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	73.9	1.1e-14
WP_109166850.1|1475922_1476066_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	85.4	2.6e-13
WP_155683522.1|1477055_1478978_-	acyltransferase family protein	NA	A0A1R3Y5Q6	Salmonella_virus	77.8	5.1e-301
WP_000703601.1|1478984_1479251_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.3e-25
WP_023226602.1|1479219_1479609_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	97.5	1.3e-59
WP_001067855.1|1479720_1480425_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001590337.1|1481679_1482621_-	transporter protein	NA	E7DYY8	Enterobacteria_phage	87.8	4.1e-147
>prophage 5
NZ_CP033384	Salmonella enterica subsp. enterica strain CFSA300 chromosome, complete genome	4784833	1714189	1723359	4784833	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1714189_1715137_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824854.1|1715120_1715852_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1715832_1715940_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1715999_1716731_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1716953_1718639_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1718635_1719355_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950415.1|1719401_1719869_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	6.7e-74
WP_023226723.1|1719925_1720456_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1720626_1721085_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_023226722.1|1721325_1723359_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 6
NZ_CP033384	Salmonella enterica subsp. enterica strain CFSA300 chromosome, complete genome	4784833	1838907	1849414	4784833		Enterobacteria_phage(37.5%)	10	NA	NA
WP_023226691.1|1838907_1840311_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|1840488_1841382_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1841758_1842844_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_023226690.1|1842843_1843743_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.8e-30
WP_023226689.1|1843790_1844669_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|1844669_1845221_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_023200991.1|1845226_1846201_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1846216_1846990_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565903.1|1846994_1848074_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|1848100_1849414_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 7
NZ_CP033384	Salmonella enterica subsp. enterica strain CFSA300 chromosome, complete genome	4784833	1959536	1970826	4784833	integrase	Burkholderia_phage(25.0%)	12	1953790:1953805	1968137:1968152
1953790:1953805	attL	GAACAGGTGGATAAGG	NA	NA	NA	NA
WP_023226634.1|1959536_1960718_+	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	26.9	2.4e-35
WP_023226633.1|1960718_1961465_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_023226632.1|1961566_1962823_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	41.3	3.4e-80
WP_023226631.1|1963303_1963465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394197.1|1963591_1964011_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_023194544.1|1964013_1965282_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.7	3.8e-228
WP_000208509.1|1965736_1965949_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1965959_1966148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024154957.1|1966406_1967585_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.2	8.6e-110
WP_023227458.1|1968235_1968547_+	hypothetical protein	NA	NA	NA	NA	NA
1968137:1968152	attR	GAACAGGTGGATAAGG	NA	NA	NA	NA
WP_023227459.1|1968626_1969322_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	1.6e-07
WP_001157305.1|1969395_1970826_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 8
NZ_CP033384	Salmonella enterica subsp. enterica strain CFSA300 chromosome, complete genome	4784833	2285056	2290868	4784833		Escherichia_phage(33.33%)	8	NA	NA
WP_000230462.1|2285056_2285863_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
WP_001128869.1|2285864_2286857_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_001146150.1|2286856_2287747_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_023227163.1|2287870_2288272_+	DUF4102 domain-containing protein	NA	K7PGY1	Enterobacteria_phage	58.4	3.8e-33
WP_051129228.1|2288571_2289459_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	38.5	5.6e-37
WP_023227161.1|2289765_2290035_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	92.1	1.8e-26
WP_071525147.1|2290389_2290530_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	74.3	1.1e-08
WP_071601154.1|2290568_2290868_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	57.1	2.2e-14
>prophage 9
NZ_CP033384	Salmonella enterica subsp. enterica strain CFSA300 chromosome, complete genome	4784833	2756932	2764395	4784833	transposase	Escherichia_phage(42.86%)	9	NA	NA
WP_000497451.1|2756932_2757172_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_001036668.1|2757383_2757548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023226907.1|2758045_2758855_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	9.2e-63
WP_001277616.1|2758927_2759305_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_023226906.1|2759452_2759995_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	66.5	1.1e-70
WP_023218771.1|2760186_2760915_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	1.4e-62
WP_023226904.1|2760931_2761345_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
WP_023226903.1|2762295_2763420_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_000502119.1|2763936_2764395_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
>prophage 10
NZ_CP033384	Salmonella enterica subsp. enterica strain CFSA300 chromosome, complete genome	4784833	3589122	3636449	4784833	portal,coat,lysis,protease,transposase,integrase,terminase	Enterobacteria_phage(72.58%)	64	3591205:3591250	3632558:3632603
WP_085948316.1|3589122_3590395_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
WP_023227314.1|3590615_3590810_-	hypothetical protein	NA	NA	NA	NA	NA
3591205:3591250	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000915528.1|3591538_3591901_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_000703639.1|3591897_3592830_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
WP_000671496.1|3592819_3594277_+	hypothetical protein	NA	A8CG94	Salmonella_phage	100.0	1.3e-240
WP_000129933.1|3594335_3596339_-	endorhamnosidase	NA	Q76H47	Enterobacteria_phage	100.0	0.0e+00
WP_000532177.1|3596474_3596723_+	Arc family DNA-binding protein	NA	Q76H48	Enterobacteria_phage	100.0	1.8e-38
WP_071533035.1|3596743_3597037_-	hypothetical protein	NA	Q76H12	Enterobacteria_phage	100.0	3.2e-50
WP_001029860.1|3597175_3599152_-	hypothetical protein	NA	Q76H13	Enterobacteria_phage	100.0	0.0e+00
WP_000246977.1|3599151_3600588_-	DNA transfer protein	NA	Q76H14	Enterobacteria_phage	100.0	7.7e-246
WP_000964904.1|3600598_3601288_-	hypothetical protein	NA	A0A2H5BFK5	Salmonella_phage	100.0	2.9e-118
WP_000627593.1|3601290_3601746_-	DUF2824 family protein	NA	Q76H16	Enterobacteria_phage	100.0	1.8e-87
WP_000774917.1|3601745_3602447_-	hypothetical protein	NA	Q76H17	Enterobacteria_phage	100.0	1.7e-76
WP_001122420.1|3602450_3603869_-	Packaged DNA stabilization protein gp10	NA	Q76H18	Enterobacteria_phage	100.0	6.4e-277
WP_001166103.1|3603828_3604329_-	packaged DNA stabilization protein p27	NA	Q76H19	Enterobacteria_phage	100.0	4.2e-90
WP_000538670.1|3604312_3604873_-	hypothetical protein	NA	C6ZR11	Salmonella_phage	100.0	9.8e-104
WP_001196937.1|3604913_3606206_-|coat	coat protein	coat	Q76H21	Enterobacteria_phage	100.0	1.1e-243
WP_051129359.1|3606205_3607114_-	scaffolding protein	NA	A0A2D1GLN7	Escherichia_phage	94.1	4.3e-149
WP_051129358.1|3607127_3609293_-|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	99.6	0.0e+00
WP_051129357.1|3609293_3610793_-|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	99.4	9.1e-306
WP_000729923.1|3610770_3611259_-	hypothetical protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_001687044.1|3611262_3611667_-	hypothetical protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
WP_001140562.1|3611666_3612056_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_000808099.1|3612059_3612302_-	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_000877028.1|3612524_3613055_-	KilA-N domain-containing protein	NA	Q76H61	Enterobacteria_phage	100.0	1.3e-94
WP_001687043.1|3613267_3613735_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	100.0	1.7e-77
WP_024136257.1|3613731_3614229_-	lysozyme	NA	B8K1G9	Salmonella_phage	100.0	4.5e-92
WP_000286100.1|3614206_3614410_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_001047566.1|3614840_3615614_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	100.0	8.1e-133
WP_000219133.1|3615610_3615790_-	hypothetical protein	NA	Q76H67	Enterobacteria_phage	100.0	1.9e-24
WP_000149882.1|3615770_3615974_-	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
WP_000036320.1|3615970_3616195_-	hypothetical protein	NA	Q76H69	Enterobacteria_phage	100.0	6.3e-38
WP_001108073.1|3616191_3616803_-	recombination protein NinG	NA	Q76H70	Enterobacteria_phage	100.0	7.9e-99
WP_000950963.1|3616795_3616972_-	protein ninF	NA	Q76H71	Enterobacteria_phage	100.0	6.7e-27
WP_001532927.1|3616964_3617306_-	DUF2591 domain-containing protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
WP_000113770.1|3617308_3617485_-	NinE family protein	NA	Q76H73	Enterobacteria_phage	100.0	1.0e-27
WP_000736891.1|3617621_3618059_-	recombination protein NinB	NA	Q76H49	Enterobacteria_phage	100.0	4.5e-80
WP_001036030.1|3618132_3618402_-	hypothetical protein	NA	Q76H50	Enterobacteria_phage	100.0	4.9e-45
WP_001248410.1|3618398_3619775_-	AAA family ATPase	NA	Q76H51	Enterobacteria_phage	100.0	1.9e-254
WP_000539342.1|3619771_3620593_-	replication protein	NA	Q76H52	Enterobacteria_phage	100.0	5.2e-154
WP_001103492.1|3620775_3621057_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000182204.1|3621167_3621383_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_000712403.1|3621493_3622183_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
WP_001532928.1|3622347_3623427_+	hypothetical protein	NA	A0A192Y6S0	Salmonella_phage	100.0	1.5e-193
WP_000834175.1|3623465_3623669_-	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	100.0	2.0e-27
WP_000216178.1|3624032_3624335_+	hypothetical protein	NA	Q76H58	Enterobacteria_phage	100.0	9.7e-50
WP_001066179.1|3624347_3624935_-	superinfection exclusion protein B	NA	Q76H59	Enterobacteria_phage	100.0	1.4e-100
WP_000213982.1|3625148_3625343_+	Restriction inhibitor protein ral	NA	Q76H34	Enterobacteria_phage	100.0	1.9e-30
WP_072097849.1|3625426_3626041_+	pentapeptide repeat-containing protein	NA	Q76H35	Enterobacteria_phage	94.4	7.0e-47
WP_000776963.1|3626641_3626956_+	Superinfection exclusion protein	NA	Q76H37	Enterobacteria_phage	100.0	1.5e-56
WP_000141641.1|3627040_3627199_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_001046968.1|3627499_3628207_+	recombinase	NA	Q76H40	Enterobacteria_phage	100.0	3.1e-139
WP_001253476.1|3628206_3628491_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_001111291.1|3628537_3628831_+	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	100.0	1.4e-48
WP_001214777.1|3628841_3629012_+	DUF2737 family protein	NA	Q76H43	Enterobacteria_phage	100.0	1.6e-25
WP_071533029.1|3629515_3629749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025617570.1|3629735_3630380_+	DUF551 domain-containing protein	NA	Q76H45	Enterobacteria_phage	99.5	1.4e-122
WP_000371199.1|3630379_3630664_+	DUF4752 family protein	NA	Q76H46	Enterobacteria_phage	100.0	1.6e-49
WP_000002104.1|3630656_3630941_+	ASCH domain-containing protein	NA	Q76H28	Enterobacteria_phage	100.0	1.4e-50
WP_155675089.1|3631009_3631150_+	hypothetical protein	NA	A0A0M4QWX3	Salmonella_phage	97.8	4.2e-16
WP_000051897.1|3631379_3632543_+|integrase	site-specific integrase	integrase	Q76H30	Enterobacteria_phage	100.0	3.7e-230
WP_000893225.1|3632748_3633999_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	4.7e-98
3632558:3632603	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285275.1|3634010_3635114_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043667.1|3635396_3636449_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	2.6e-113
>prophage 1
NZ_CP033382	Salmonella enterica subsp. enterica strain CFSA300 plasmid pCFSA300-1, complete sequence	209815	49810	171860	209815	protease,transposase	Escherichia_phage(41.18%)	118	NA	NA
WP_042634304.1|49810_50890_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
WP_001040059.1|50891_51665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285478.1|51657_52800_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
WP_001035162.1|52809_53868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042634303.1|54191_54773_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054787.1|54772_55930_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007448.1|55952_56408_+	Tellurite resistance protein TerB	NA	NA	NA	NA	NA
WP_000255079.1|56430_57471_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116677.1|57519_58098_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	3.3e-06
WP_000301242.1|58165_58741_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053338.1|59169_60411_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_000077926.1|60973_61255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000398480.1|61304_61496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371937.1|61587_61959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|62301_62694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024136327.1|63297_63591_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088046.1|63595_64921_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000134171.1|64981_65188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985911.1|65289_65700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572439.1|65712_66528_+	HNH endonuclease	NA	G0X580	Salmonella_phage	36.5	1.1e-15
WP_001043843.1|66781_67207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572440.1|67955_68255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123872853.1|68244_68565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032192809.1|68567_70607_-	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	24.8	2.5e-24
WP_001572342.1|70603_71590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194555.1|72620_72824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287392.1|73165_73570_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_000175476.1|74067_74304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572344.1|74345_74801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000490638.1|74860_75526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001426317.1|75583_75964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193209.1|76606_77425_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001572381.1|77421_78627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000078514.1|78906_80226_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_000833382.1|80476_81904_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_001572389.1|82118_82634_+	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000975182.1|82636_83533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015059496.1|83754_83988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572393.1|84649_84880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185304.1|85216_85678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074418.1|85707_86115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029698059.1|86165_86483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031613424.1|86859_87210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|88899_89604_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_155683505.1|91460_91913_-	NAD(+)--rifampin ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_001334766.1|92771_93602_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_001067855.1|94434_95139_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001199192.1|95252_96029_+	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
WP_000602738.1|97705_98458_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_006581703.1|100268_100754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|103035_103338_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|103231_103483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001255015.1|105119_105425_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214122.1|105452_106667_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001447541.1|106883_107768_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001067784.1|108692_109397_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_046788546.1|109481_109883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|112612_113317_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001387387.1|113363_113765_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|113914_114775_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|115359_116064_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000240536.1|116819_117671_+	replication protein	NA	NA	NA	NA	NA
WP_001043265.1|117978_118794_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
WP_001082319.1|118854_119658_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|119657_120494_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001067855.1|120554_121259_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002914189.1|121578_122754_+	multidrug efflux RND transporter periplasmic adaptor subunit OqxA	NA	NA	NA	NA	NA
WP_000347934.1|122777_125930_+	multidrug efflux RND transporter permease subunit OqxB	NA	NA	NA	NA	NA
WP_000888203.1|125999_126479_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|126570_127275_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000503573.1|127476_128265_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|128395_128869_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_001067855.1|129771_130476_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000050481.1|131329_132871_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_032492390.1|134269_135043_+	ArmA family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_077252464.1|135023_135305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155675077.1|135524_135686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|135691_136396_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_032193599.1|138407_139112_-	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	28.7	6.4e-20
WP_001067858.1|139141_139846_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000783758.1|139957_140116_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_087522250.1|140214_141584_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	6.3e-112
WP_000137793.1|141916_142522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000703843.1|142737_143019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001424621.1|143393_143705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000814954.1|143927_144128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000551490.1|144167_144392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000781545.1|144446_144650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001424592.1|145202_145694_-	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_001165367.1|145698_146010_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001133831.1|146525_146846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000276410.1|147025_147253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077248242.1|147480_148092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000241454.1|148203_148737_-	HNH endonuclease	NA	E7EKU5	Edwardsiella_phage	65.2	2.6e-45
WP_000159618.1|148797_148986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172889.1|148982_149294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053276277.1|149356_149605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000469466.1|149854_152239_-	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
WP_000182314.1|152411_152861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774870.1|152912_153704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042634392.1|153930_154188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000556022.1|154253_154580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000104323.1|155422_156673_-	site-specific DNA-methyltransferase	NA	NA	NA	NA	NA
WP_000833773.1|156841_157450_-	hypothetical protein	NA	K4JV11	Caulobacter_phage	39.8	5.4e-23
WP_001290637.1|157605_157863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001133498.1|157927_158356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000853477.1|158450_158828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001424497.1|159235_160417_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_000581857.1|160425_160722_-	toxin-plasmid maintenance system killer protein	NA	A0A222YWE2	Escherichia_phage	35.1	3.2e-05
WP_000170638.1|160771_161242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012006566.1|161676_164094_-	DUF4165 domain-containing protein	NA	NA	NA	NA	NA
WP_000803860.1|164139_164307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000277497.1|164627_165392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155683507.1|165472_166234_+	methyltransferase	NA	A0A2I7RNS1	Vibrio_phage	33.3	3.1e-20
WP_000149861.1|166327_166591_+	hypothetical protein	NA	M9UXL5	Escherichia_phage	46.5	3.2e-09
WP_001572415.1|166611_167223_+	hypothetical protein	NA	A0A248SKW5	Klebsiella_phage	71.1	1.2e-09
WP_000681217.1|167687_170108_+	DUF4165 domain-containing protein	NA	NA	NA	NA	NA
WP_085948316.1|170587_171860_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
