The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP033360	Salmonella enterica subsp. enterica strain EQAS2016S1 chromosome, complete genome	4636747	370883	389039	4636747	plate,tail	Burkholderia_phage(45.0%)	22	NA	NA
WP_001177097.1|370883_371399_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	41.2	3.4e-34
WP_000368203.1|371408_372890_-|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
WP_021001011.1|372892_373525_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	54.7	4.3e-23
WP_001749150.1|373517_374633_-	bacteriophage protein	NA	Q6QI99	Burkholderia_phage	52.0	4.1e-101
WP_021001012.1|374623_374983_-|plate	baseplate	plate	Q6QIA0	Burkholderia_phage	63.3	1.1e-34
WP_000632053.1|375146_376694_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_021001013.1|376693_377623_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000593182.1|377619_377982_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679393.1|378309_379032_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000818154.1|379041_380085_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|380072_380282_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|380281_381235_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262499.1|381234_383589_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_001185654.1|383685_383814_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|383773_384091_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|384142_384667_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|384666_386094_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|386083_386281_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000777266.1|386891_387206_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|387218_387824_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_021001015.1|387826_388114_-	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	49.1	3.9e-16
WP_000615248.1|388691_389039_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 2
NZ_CP033360	Salmonella enterica subsp. enterica strain EQAS2016S1 chromosome, complete genome	4636747	1717581	1724894	4636747	protease	Dickeya_phage(16.67%)	7	NA	NA
WP_001201751.1|1717581_1718700_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|1718696_1720643_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|1720772_1720994_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1721317_1721638_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|1721668_1723945_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_001117984.1|1724157_1724355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531374.1|1724516_1724894_-	hypothetical protein	NA	A0A077KET4	Ralstonia_phage	40.2	1.7e-19
>prophage 3
NZ_CP033360	Salmonella enterica subsp. enterica strain EQAS2016S1 chromosome, complete genome	4636747	1776723	1878417	4636747	capsid,terminase,tRNA,integrase,tail,lysis,portal,head,protease	Salmonella_phage(41.67%)	104	1779632:1779651	1854305:1854324
WP_001154025.1|1776723_1777527_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1777519_1778842_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1778822_1779527_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572746.1|1779526_1783993_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
1779632:1779651	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_021000127.1|1784337_1786185_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1786444_1786993_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1787020_1787668_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1787729_1788920_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977709.1|1789104_1790196_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	1.7e-99
WP_000117870.1|1790802_1792203_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1792403_1792865_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544852.1|1793181_1794396_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893197.1|1794641_1796075_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191406.1|1796155_1797358_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262311.1|1797552_1798845_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.3e-252
WP_000065276.1|1798889_1799138_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1799178_1799418_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|1799460_1800618_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_051124479.1|1800580_1803508_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	98.8	0.0e+00
WP_022742800.1|1803634_1803985_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	98.3	6.4e-61
WP_000917563.1|1804006_1804165_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	100.0	2.4e-23
WP_038988958.1|1804793_1805165_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	50.0	1.5e-31
WP_051124478.1|1805142_1806204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015406390.1|1806273_1806669_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	72.5	3.5e-47
WP_051124477.1|1806773_1807010_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	71.8	2.6e-26
WP_010835408.1|1806975_1807350_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_072208318.1|1807441_1807630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077946708.1|1807644_1808700_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	53.2	4.9e-40
WP_000800016.1|1808702_1809452_+	DNA replication protein DnaC	NA	H6WRX8	Salmonella_phage	100.0	6.6e-140
WP_000113626.1|1809462_1809810_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	100.0	4.5e-59
WP_000065089.1|1809806_1810127_+	hypothetical protein	NA	H6WRY0	Salmonella_phage	65.5	6.7e-25
WP_000974174.1|1810126_1810372_+	hypothetical protein	NA	Q5G8U9	Enterobacteria_phage	88.9	3.0e-33
WP_000132543.1|1810682_1811900_+	hypothetical protein	NA	J9Q803	Salmonella_phage	53.3	3.1e-118
WP_107251218.1|1811880_1811949_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_000802853.1|1812042_1812369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217669.1|1812616_1812850_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|1812966_1813215_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_000929790.1|1813249_1813852_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_051124475.1|1814060_1814672_+	protein ninG	NA	A0A0M4RU10	Salmonella_phage	96.6	7.9e-91
WP_000801757.1|1814668_1814809_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_051124474.1|1814805_1815486_+	antiterminator	NA	I6PDF8	Cronobacter_phage	53.1	1.4e-59
WP_001534381.1|1815795_1815984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001526513.1|1816186_1816489_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_024798992.1|1816466_1816955_+	lysozyme	NA	M9P0E5	Enterobacteria_phage	68.1	1.0e-56
WP_099800562.1|1816975_1817416_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	78.0	6.2e-53
WP_000867564.1|1817884_1818430_+|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	61.3	4.5e-53
WP_021000150.1|1818401_1820336_+|terminase	phage terminase large subunit family protein	terminase	E4WL19	Enterobacteria_phage	66.1	7.0e-258
WP_000224407.1|1820319_1820523_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	80.0	1.0e-18
WP_000820305.1|1820519_1822106_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.7	6.4e-185
WP_023233092.1|1822095_1823610_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	51.8	2.1e-100
WP_000143301.1|1823609_1823957_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	4.6e-19
WP_001048356.1|1824011_1825040_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	58.4	2.4e-108
WP_000448213.1|1825103_1825478_+	DNA breaking-rejoining protein	NA	A0A2R9YJP4	Escherichia_phage	34.9	4.8e-06
WP_000083787.1|1825488_1825845_+|tail	tail attachment protein	tail	K7P6U9	Enterobacteria_phage	58.5	1.8e-31
WP_000053601.1|1825854_1826454_+|tail	phage tail protein	tail	A0A291AWZ0	Escherichia_phage	68.7	8.3e-69
WP_001032919.1|1826453_1826855_+	hypothetical protein	NA	A0A291AWY2	Escherichia_phage	59.8	8.1e-44
WP_000126419.1|1826867_1827620_+|tail	tail protein	tail	A5LH35	Enterobacteria_phage	70.0	1.9e-94
WP_000478854.1|1827668_1828058_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	58.9	1.5e-31
WP_001175132.1|1828078_1828381_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	58.6	2.8e-25
WP_051124473.1|1828364_1831457_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	57.3	2.4e-268
WP_000978295.1|1831453_1831786_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
WP_000410972.1|1831884_1832409_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	35.3	1.8e-19
WP_000877926.1|1832498_1833032_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152416.1|1833121_1833817_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_051124472.1|1833826_1834564_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	75.2	3.4e-112
WP_020867839.1|1834461_1835166_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	2.0e-66
WP_000178849.1|1838626_1838869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058799442.1|1838922_1841094_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	79.8	1.2e-128
WP_058799441.1|1841093_1841675_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.0	8.6e-95
WP_072208320.1|1841681_1841912_-|tail	phage tail protein	tail	A0A1B0VCD0	Salmonella_phage	64.3	2.0e-18
WP_058799428.1|1842152_1843121_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	98.8	7.4e-192
WP_000334547.1|1843768_1844395_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001525490.1|1844754_1845441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1845711_1845903_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_021000154.1|1846329_1848942_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	4.8e-20
WP_000291723.1|1849149_1850160_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1850325_1850868_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_024792695.1|1850864_1851974_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1852072_1854181_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_021000156.1|1854193_1856101_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1854305:1854324	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000333152.1|1856115_1857369_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1857373_1859014_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1859010_1859574_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1859829_1859997_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1860096_1860615_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_024792698.1|1860683_1862444_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1862629_1863082_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001670727.1|1863153_1864206_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1864562_1865072_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1865288_1865894_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950876.1|1865880_1868034_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_021000158.1|1868052_1868499_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_021000159.1|1868622_1870677_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
WP_000424187.1|1870712_1871171_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1871265_1871928_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000975203.1|1872098_1872515_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1872559_1872877_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1872934_1874146_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859429.1|1874360_1874909_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548080.1|1874934_1875714_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|1875762_1876044_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1876040_1876370_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374046.1|1876456_1877116_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_024152562.1|1877736_1878417_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	72.0	2.3e-83
>prophage 4
NZ_CP033360	Salmonella enterica subsp. enterica strain EQAS2016S1 chromosome, complete genome	4636747	2782963	2793547	4636747		Morganella_phage(25.0%)	12	NA	NA
WP_001157315.1|2782963_2784394_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_021000456.1|2784467_2785163_-	phosphohydrolase	NA	S4W232	Pandoravirus	28.0	1.6e-07
WP_000107435.1|2785242_2785554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080668.1|2786203_2787382_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.2	6.6e-110
WP_024131109.1|2787642_2787831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2787841_2788054_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_051124435.1|2788508_2789777_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	2.1e-226
WP_000394197.1|2789779_2790199_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_001537372.1|2790325_2790487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000598920.1|2790967_2791765_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_021000459.1|2792136_2792427_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	49.1	3.0e-08
WP_001219015.1|2793073_2793547_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
>prophage 5
NZ_CP033360	Salmonella enterica subsp. enterica strain EQAS2016S1 chromosome, complete genome	4636747	2882510	2893017	4636747		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126351.1|2882510_2883824_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	9.1e-52
WP_000565902.1|2883850_2884930_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.3e-16
WP_000648783.1|2884934_2885708_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018224.1|2885723_2886698_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973714.1|2886703_2887255_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.0e-52
WP_000857530.1|2887255_2888134_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	5.1e-107
WP_001023661.1|2888181_2889081_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.7	3.0e-30
WP_024792480.1|2889080_2890166_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_000981469.1|2890542_2891436_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_021000489.1|2891613_2893017_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.3	1.5e-20
>prophage 6
NZ_CP033360	Salmonella enterica subsp. enterica strain EQAS2016S1 chromosome, complete genome	4636747	2961324	2970495	4636747	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195338.1|2961324_2963358_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
WP_000703137.1|2963598_2964057_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_024799053.1|2964228_2964759_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_021000506.1|2964815_2965283_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	5.1e-74
WP_000598637.1|2965329_2966049_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_021000507.1|2966045_2967731_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	1.1e-278
WP_001240418.1|2967953_2968685_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2968744_2968852_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2968832_2969564_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_021000508.1|2969547_2970495_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
>prophage 7
NZ_CP033360	Salmonella enterica subsp. enterica strain EQAS2016S1 chromosome, complete genome	4636747	3499826	3508760	4636747	integrase	Enterobacteria_phage(83.33%)	10	3497197:3497212	3503977:3503992
3497197:3497212	attL	GCAGCAGGTGAAAGCG	NA	NA	NA	NA
WP_107251204.1|3499826_3501020_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.4	8.2e-108
WP_021000667.1|3501050_3501488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107251205.1|3501655_3502549_-	DUF4747 family protein	NA	NA	NA	NA	NA
WP_023196288.1|3502956_3503523_-	hypothetical protein	NA	Q7M2A1	Enterobacteria_phage	62.7	4.5e-56
WP_000984211.1|3503539_3503785_-	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	76.5	6.3e-31
WP_021000671.1|3503781_3504519_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	64.4	4.4e-80
3503977:3503992	attR	CGCTTTCACCTGCTGC	NA	NA	NA	NA
WP_023196289.1|3505319_3505871_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	71.3	8.6e-36
WP_001604623.1|3505867_3506095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000743150.1|3506091_3506412_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_021000674.1|3506426_3508760_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	84.5	0.0e+00
