The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039227	Piscirickettsia salmonis strain SR1 chromosome, complete genome	3562064	8320	67215	3562064	transposase	unidentified_phage(33.33%)	54	NA	NA
WP_155079413.1|8320_9490_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079415.1|9631_9940_+	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_155066245.1|9945_10401_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_155066246.1|10468_11398_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_155066247.1|11403_11724_+	cell division protein FtsL	NA	NA	NA	NA	NA
WP_155066248.1|11723_13448_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_155081463.1|13404_14937_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_155079417.1|14902_16297_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_155079419.1|16290_17331_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_155079421.1|17332_18706_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_155079422.1|18702_19866_+	putative lipid II flippase FtsW	NA	NA	NA	NA	NA
WP_155081464.1|19882_20965_+	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_155079424.1|20939_22397_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_155079426.1|22393_23431_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_155066256.1|23432_24152_+	FtsQ-type POTRA domain-containing protein	NA	NA	NA	NA	NA
WP_016209355.1|24197_25445_+	cell division protein FtsA	NA	NA	NA	NA	NA
WP_016209342.1|25489_26623_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_155066257.1|26701_27562_+	UDP-3-O-acyl-N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
WP_155079429.1|27703_30436_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_155066259.1|30645_31779_+	acyl-CoA desaturase	NA	F2NZ38	Diadromus_pulchellus_ascovirus	31.8	2.4e-40
WP_155068597.1|31808_32081_-	acylphosphatase	NA	NA	NA	NA	NA
WP_155066260.1|32188_33001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079431.1|33014_33236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079433.1|33442_34798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066264.1|35391_35760_-	(2Fe-2S) ferredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_155079435.1|36875_38651_+	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_155079437.1|39552_39693_-	phosphatase	NA	NA	NA	NA	NA
WP_155066936.1|39760_40111_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081465.1|40142_40595_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079439.1|41134_42021_-|transposase	IS630 family transposase	transposase	A0A2P0VP61	Tetraselmis_virus	28.8	1.7e-09
WP_155079441.1|44356_47050_-	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	31.0	5.2e-70
WP_155068598.1|47081_47669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079443.1|47713_48754_+	beta-eliminating lyase	NA	NA	NA	NA	NA
WP_155066269.1|48874_49099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|49384_50359_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155079447.1|50707_51442_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_155079448.1|52065_53592_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_155068599.1|53731_54805_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_027242742.1|54844_56152_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.4	1.2e-24
WP_155079450.1|56126_57296_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_155079452.1|57350_58076_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_155079454.1|58513_58705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079457.1|58815_59745_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079459.1|59796_59997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079461.1|60133_61108_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	7.5e-27
WP_155079463.1|61572_62376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079465.1|62601_63090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068622.1|63098_63551_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079467.1|63582_63828_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079470.1|64312_65167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079472.1|65342_65687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079474.1|65828_66272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|66287_66674_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|66657_67215_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP039227	Piscirickettsia salmonis strain SR1 chromosome, complete genome	3562064	75064	131164	3562064	protease,transposase	Hokovirus(15.38%)	56	NA	NA
WP_155079487.1|75064_76114_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079488.1|76130_76250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079490.1|76327_77302_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.5	2.3e-28
WP_155079492.1|77325_77559_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|77590_78043_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079495.1|78293_79247_-	glutathione synthase	NA	NA	NA	NA	NA
WP_155079497.1|79291_80455_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_155079499.1|80460_81060_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_155081467.1|81247_81739_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.2	1.0e-19
WP_155079501.1|81765_82854_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_155079503.1|82992_84237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079505.1|84233_85076_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_155079507.1|85055_85859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068602.1|86057_86273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079509.1|86273_87242_+	TonB family protein	NA	NA	NA	NA	NA
WP_155081468.1|87297_87849_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_155066294.1|87975_88398_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_155081469.1|88390_89152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066295.1|89206_89905_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_155079511.1|89915_90740_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	2.1e-25
WP_155066936.1|90954_91305_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081470.1|91336_91789_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079513.1|92316_92601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079515.1|92824_92962_-	phosphatase	NA	NA	NA	NA	NA
WP_155066301.1|93305_94520_-	aromatic amino acid transport family protein	NA	NA	NA	NA	NA
WP_155068606.1|94831_95893_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_155066302.1|95906_97634_+	oxaloacetate-decarboxylating malate dehydrogenase	NA	NA	NA	NA	NA
WP_155066303.1|97666_98398_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_155068607.1|98397_99186_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_155079519.1|99290_99914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079521.1|100103_100292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066306.1|100379_101132_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155066307.1|106811_107435_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_155081471.1|107474_107957_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_155066308.1|108005_109151_+	lipoprotein	NA	NA	NA	NA	NA
WP_155079523.1|109152_111423_+	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_155081472.1|111424_112273_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.1	1.0e-67
WP_155079524.1|112279_113152_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.3	3.9e-91
WP_155079526.1|113148_114153_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	48.5	5.7e-78
WP_155066313.1|114172_114580_+	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	48.9	1.8e-27
WP_155079528.1|114607_115996_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_155079530.1|115992_117165_+	glycerophosphotransferase	NA	NA	NA	NA	NA
WP_155079533.1|117196_118048_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_155079535.1|118063_119221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068609.1|119295_120225_+	glycosyltransferase	NA	B6EFC4	Stygiolobus_rod-shaped_virus	34.2	2.7e-05
WP_155066318.1|120221_121358_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_155066319.1|121354_122281_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	45.0	1.7e-57
WP_155066320.1|122370_123768_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.4	9.7e-52
WP_155079537.1|124042_125455_+	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_155079539.1|125536_126364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|126431_126989_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|126972_127359_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079541.1|127527_128532_+	OmpA family protein	NA	NA	NA	NA	NA
WP_155066325.1|128583_128814_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	40.7	1.7e-06
WP_036771588.1|128822_129701_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.9	2.0e-39
WP_155066327.1|130063_131164_+|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.1	3.1e-21
>prophage 4
NZ_CP039227	Piscirickettsia salmonis strain SR1 chromosome, complete genome	3562064	197123	240461	3562064	transposase	unidentified_phage(75.0%)	50	NA	NA
WP_155079617.1|197123_197777_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_155079619.1|198291_199080_-	MFS transporter	NA	NA	NA	NA	NA
WP_155589541.1|199956_200409_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|200558_201116_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|201099_201486_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079622.1|201554_201833_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155066404.1|201894_202780_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079624.1|202807_203164_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155079626.1|203287_204547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079627.1|205035_206073_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079629.1|206201_206795_+	CDP-alcohol phosphatidyltransferase	NA	NA	NA	NA	NA
WP_155066393.1|206763_207417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079631.1|207595_208585_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_155066395.1|208607_209504_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_017377592.1|209663_210107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066396.1|210103_210745_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_155066397.1|210855_211434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|212010_212361_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079634.1|212287_212527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081475.1|213026_213305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079635.1|213357_213546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|213600_213951_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|213982_214435_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079638.1|215072_215534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079640.1|215819_216290_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079642.1|216332_216734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079644.1|216791_217382_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155589542.1|217463_217799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079648.1|218315_218522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085302.1|218560_219664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079655.1|219741_220716_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.7	9.8e-27
WP_155079657.1|220920_221181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081476.1|221208_223215_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155079659.1|223351_225682_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_155079660.1|225812_226655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|226655_227213_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|227196_227583_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079662.1|227762_228158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|228297_229272_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155068789.1|229503_230763_+	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.1	6.1e-13
WP_155068500.1|231011_231536_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_155068499.1|231643_232645_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_155079663.1|232732_233629_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155079665.1|233772_234990_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_155068496.1|235453_236770_+	MFS transporter	NA	NA	NA	NA	NA
WP_155079667.1|236868_237177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079669.1|237787_238762_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.7	7.5e-27
WP_155079671.1|238799_239417_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_155068622.1|239626_240079_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|240110_240461_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP039227	Piscirickettsia salmonis strain SR1 chromosome, complete genome	3562064	280938	313241	3562064	protease,transposase	Faustovirus(25.0%)	29	NA	NA
WP_155079478.1|280938_281496_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155068461.1|281966_282821_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_017378137.1|283295_283514_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_155079703.1|283615_284866_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_155079705.1|284921_285404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079706.1|285748_286105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|287668_288226_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079708.1|288209_288596_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079710.1|288997_289963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079712.1|291145_291970_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_155079713.1|292172_293249_+	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_155079714.1|293333_294320_+	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_155079716.1|294338_294983_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_155589543.1|294994_296104_+	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.5	1.2e-17
WP_155079720.1|296216_296948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068448.1|297443_299327_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_155068447.1|299640_301140_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_155079722.1|301229_302012_+	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.3	4.1e-31
WP_155068445.1|302139_303060_+	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_155068444.1|303083_303542_+	NfeD family protein	NA	NA	NA	NA	NA
WP_155079724.1|304172_305354_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079726.1|306339_307314_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.8	1.4e-28
WP_155079728.1|307874_308480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079730.1|308580_308742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079731.1|309006_309255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|309238_309796_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079733.1|309929_310979_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068441.1|311305_312283_+	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_155068440.1|312392_313241_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
>prophage 6
NZ_CP039227	Piscirickettsia salmonis strain SR1 chromosome, complete genome	3562064	424483	486964	3562064	tRNA,protease,transposase	unidentified_phage(44.44%)	71	NA	NA
WP_155079478.1|424483_425041_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079803.1|425021_425240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066524.1|425502_425805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079804.1|426386_427556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|427970_428357_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|428340_428898_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|428955_429342_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|429325_429883_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155589545.1|429883_430432_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_155079806.1|430735_431821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079807.1|431804_432671_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079808.1|432744_433053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079809.1|433095_434070_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	5.8e-27
WP_155079810.1|434109_434901_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079811.1|434967_435141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079812.1|435259_437026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079813.1|437404_438103_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_155079445.1|438179_439154_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155079814.1|439177_439483_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_155079815.1|439502_440477_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.2	4.0e-28
WP_017376982.1|440704_441178_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_155079816.1|441219_441735_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_155079817.1|441734_442751_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_155079818.1|443158_443944_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155079819.1|444007_444622_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210574.1|444762_445182_+	prokaryotic dksA/traR C4-type zinc finger family protein	NA	NA	NA	NA	NA
WP_155079820.1|445237_445861_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_155079821.1|446083_447841_+|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_155081480.1|447962_448946_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376975.1|449026_449578_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_017376974.1|449588_450956_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.9	1.6e-43
WP_155068778.1|451106_451343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079822.1|451401_452145_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_155079823.1|452144_452786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079824.1|452785_454450_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.5	1.1e-33
WP_155079825.1|454477_454813_+	HIT domain-containing protein	NA	NA	NA	NA	NA
WP_155081481.1|454940_456539_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.3	1.5e-08
WP_155079741.1|456594_457569_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.0e-27
WP_155079826.1|457858_458745_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079827.1|458808_459750_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068353.1|459818_460109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081482.1|460321_460753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079828.1|460815_463296_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.0	5.9e-193
WP_155079829.1|463383_463863_+	lipopolysaccharide-assembly family protein	NA	NA	NA	NA	NA
WP_155079830.1|463835_464876_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_155068349.1|464812_465529_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_016210374.1|465541_465877_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_155079831.1|465913_466384_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_155081483.1|466429_468265_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_155068346.1|468261_469398_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_155068345.1|469419_470481_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_155068344.1|470558_471074_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376955.1|471114_472392_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_155079832.1|472406_473258_+	aminotransferase class IV family protein	NA	NA	NA	NA	NA
WP_155079833.1|473283_473934_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_155081484.1|473930_474890_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_155079834.1|476440_476626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|476690_477248_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|477231_477618_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079835.1|477728_478001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079836.1|478080_478287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079837.1|479190_480174_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155079838.1|480334_481537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079839.1|481689_482265_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_155079478.1|482265_482823_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|482806_483193_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079840.1|483925_484804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079841.1|485313_485496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079842.1|485587_485980_-	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_155079476.1|486036_486423_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|486406_486964_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP039227	Piscirickettsia salmonis strain SR1 chromosome, complete genome	3562064	508600	593125	3562064	tRNA,transposase	Acinetobacter_phage(28.57%)	97	NA	NA
WP_155066278.1|508600_509650_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079445.1|510011_510986_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155079851.1|511207_511948_-	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_155079852.1|512051_512780_-	DUF541 domain-containing protein	NA	NA	NA	NA	NA
WP_155079445.1|513175_514150_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155079853.1|514192_515236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210764.1|515552_515813_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_155079854.1|515986_517525_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_155068776.1|517703_518630_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	33.6	7.2e-11
WP_155068307.1|518769_521583_+|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	26.7	3.9e-76
WP_155068306.1|521575_522085_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_017377277.1|522088_522532_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_155079855.1|522618_523938_-	MFS transporter	NA	NA	NA	NA	NA
WP_155068304.1|524200_524581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068303.1|524572_525295_-	aquaporin family protein	NA	M1H9L8	Acanthocystis_turfacea_Chlorella_virus	37.6	2.1e-26
WP_155067805.1|526277_527156_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|528044_528395_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|528426_528879_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079478.1|529171_529729_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|529712_530099_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079856.1|531131_531461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079857.1|531846_532212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068300.1|532335_533196_+	DUF692 family protein	NA	NA	NA	NA	NA
WP_155079858.1|533182_533962_+	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_016210168.1|534038_534722_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079859.1|534882_535413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377265.1|535704_536208_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_155068297.1|536409_536664_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_155079860.1|537165_537633_+	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_155079861.1|537868_538012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079862.1|538648_539002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079863.1|539570_540035_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	45.9	5.9e-30
WP_155079864.1|540103_541259_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.4e-50
WP_155079864.1|541567_542724_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.4e-50
WP_155079865.1|543726_544344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079866.1|544750_545818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079867.1|546101_546353_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079868.1|546309_547466_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_155079869.1|547682_548492_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.1	2.4e-47
WP_155079627.1|548507_549545_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079870.1|549587_549926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079871.1|549897_550194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079872.1|550383_551004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079826.1|551041_551927_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079873.1|551891_552401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|552876_553434_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|553417_553804_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079874.1|554158_554548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079875.1|554474_554825_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079476.1|555249_555636_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|555619_556177_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155068292.1|556329_557490_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	1.1e-120
WP_155079876.1|557783_557924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068291.1|558073_560077_+	transketolase	NA	NA	NA	NA	NA
WP_155079877.1|560145_561153_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_155079878.1|561226_562411_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_155079879.1|562420_563875_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_017376008.1|563905_564943_+	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_155079476.1|565359_565746_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079880.1|565729_566239_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079478.1|566340_566898_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|566881_567268_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079881.1|567290_567704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|567687_568074_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079882.1|568089_568404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079883.1|568349_568925_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079884.1|569053_569872_+	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_155081485.1|570034_570559_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	58.4	1.5e-50
WP_155068294.1|570558_571089_+	ferric uptake regulator family protein	NA	NA	NA	NA	NA
WP_155079885.1|571209_571917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079886.1|572118_572487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079887.1|572710_573253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079888.1|573227_573374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079889.1|573349_573892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079890.1|573998_574649_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_155068276.1|574749_575409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081486.1|575638_576091_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|576122_576473_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068773.1|577352_577634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079891.1|578516_579644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066488.1|580644_580995_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079892.1|580921_581389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079612.1|581502_582732_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155079893.1|582831_583119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079730.1|583134_583296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079731.1|583560_583809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|583792_584350_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079894.1|584634_585753_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079895.1|585767_585983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079896.1|585986_586541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|586521_587079_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079897.1|587062_587449_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079898.1|587547_588276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079899.1|588304_588931_-	ribonuclease T	NA	NA	NA	NA	NA
WP_155079900.1|588960_590160_-	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_155068263.1|590397_591495_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	2.8e-06
WP_155079901.1|591607_593125_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.1	1.7e-86
>prophage 8
NZ_CP039227	Piscirickettsia salmonis strain SR1 chromosome, complete genome	3562064	597788	647426	3562064	protease,transposase	unidentified_phage(22.22%)	56	NA	NA
WP_155079478.1|597788_598346_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079908.1|598711_599344_-	riboflavin synthase subunit alpha	NA	A0A1V0SE20	Indivirus	32.8	8.1e-14
WP_155068250.1|599547_600498_-	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_155079909.1|600494_602027_-	transglutaminase	NA	NA	NA	NA	NA
WP_155079910.1|602023_602554_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_155068247.1|602731_602872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079911.1|602889_603537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|603654_604212_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|604195_604582_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079912.1|604820_605525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079913.1|605819_606044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068241.1|606123_606579_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155079914.1|606547_607489_-	EamA family transporter	NA	NA	NA	NA	NA
WP_155079915.1|607737_608925_+	Bcr/CflA family efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.6	2.2e-20
WP_016210937.1|609016_609298_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_027242634.1|609383_610061_-	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_155079916.1|610106_611366_-	phosphate permease	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	4.5e-24
WP_155079917.1|611563_612613_+	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_155068236.1|612691_613498_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_155079918.1|613519_614314_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	66.7	1.2e-102
WP_155068769.1|614412_615432_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_155079919.1|615478_616090_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_155079920.1|616093_616780_+	acireductone synthase	NA	NA	NA	NA	NA
WP_155068232.1|616776_617319_+	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_155079921.1|617400_618588_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_155079922.1|618833_619571_+	D-Ala-D-Ala dipeptidase	NA	NA	NA	NA	NA
WP_155068768.1|620529_620826_-	nucleic acid-binding protein	NA	NA	NA	NA	NA
WP_155081487.1|621544_621721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079923.1|621892_622294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079924.1|622350_622635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|622734_623709_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155079925.1|624183_626007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079926.1|626457_627717_-	diphosphate--fructose-6-phosphate 1-phosphotransferase	NA	NA	NA	NA	NA
WP_155068224.1|628330_629713_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_155068767.1|629705_630323_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_155079927.1|630401_631118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068222.1|631289_633614_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	47.1	1.7e-21
WP_155079634.1|634469_634709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|634635_634986_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079928.1|635040_635790_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	29.8	1.3e-10
WP_155079929.1|636565_637987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079930.1|638173_639265_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155079931.1|639298_639937_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_155068218.1|639975_640248_-	DUF1315 family protein	NA	NA	NA	NA	NA
WP_144420763.1|640328_640571_-	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_155068216.1|640588_640891_-	YciI family protein	NA	NA	NA	NA	NA
WP_155068215.1|640974_641517_-	septation protein A	NA	NA	NA	NA	NA
WP_016210074.1|641678_642305_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_155079932.1|642310_643150_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.8	3.6e-09
WP_155079933.1|643139_643790_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	32.9	1.1e-18
WP_155068213.1|643793_644627_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_155079934.1|645087_645294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079874.1|645580_645970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066739.1|645896_646247_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066936.1|646591_646942_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|646973_647426_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP039227	Piscirickettsia salmonis strain SR1 chromosome, complete genome	3562064	651145	746410	3562064	tRNA,integrase,transposase	Vibrio_phage(14.29%)	108	646522:646581	698059:698542
646522:646581	attL	TATAGCTAAATCCTAAATATATGGCATAATAACTTATTGAATAATTGTAGAATCAAACAA	NA	NA	NA	NA
WP_155068208.1|651145_652342_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1V0SHQ2	Klosneuvirus	24.8	1.6e-10
WP_155079938.1|652362_652959_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_155079939.1|655072_655741_-	BAX inhibitor (BI)-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	6.1e-28
WP_155068206.1|655888_657190_-	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_155081488.1|657446_658265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777829.1|658691_659096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079941.1|659329_660412_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.2	1.7e-19
WP_155068204.1|660396_660999_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155079942.1|661063_661939_+	6-pyruvoyl tetrahydropterin synthase	NA	A0A140B3P3	Vibrio_phage	24.0	1.8e-11
WP_122942894.1|662016_662592_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_155079943.1|663322_664456_+	DUF4102 domain-containing protein	NA	A0A1V0E8G8	Vibrio_phage	48.5	1.9e-90
WP_155081489.1|664456_664726_+|integrase	integrase	integrase	A0A1V0E8G8	Vibrio_phage	55.1	1.2e-14
WP_155079476.1|664945_665332_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|665315_665873_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079944.1|665880_666525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079945.1|666607_666982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079946.1|667086_667275_+	AlpA family phage regulatory protein	NA	A0A0R6PC61	Moraxella_phage	49.1	1.1e-06
WP_155079947.1|667231_668290_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	35.5	5.0e-32
WP_155079948.1|668286_669492_+	hypothetical protein	NA	A0A1L6BZE6	Pasteurella_phage	29.9	1.0e-17
WP_155079487.1|669538_670588_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079949.1|670604_670850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079950.1|671300_671993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079951.1|672035_673085_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079952.1|673101_673485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079953.1|673522_673864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079954.1|673974_674343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066278.1|674385_675435_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155589548.1|675606_676026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|676453_677011_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|676994_677381_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079956.1|678267_678756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079957.1|679045_679198_-	phosphatase	NA	NA	NA	NA	NA
WP_155079958.1|679473_679782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079959.1|679778_680129_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	38.2	7.6e-14
WP_155079960.1|680171_681569_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	32.6	5.9e-65
WP_155079961.1|681932_682586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079962.1|683368_684427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079963.1|684705_685095_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079476.1|685091_685478_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|685461_686019_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079964.1|687238_688030_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155079965.1|688570_689137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|689805_690780_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155079966.1|690839_691238_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079967.1|691283_691913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079968.1|692279_693920_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_155068160.1|694032_695382_+	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	37.0	1.8e-74
WP_155068159.1|695378_696248_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.2	1.2e-68
WP_155079969.1|696994_697309_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079970.1|697305_698013_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.1	4.8e-47
WP_155066936.1|698128_698479_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079971.1|698405_698576_+	hypothetical protein	NA	NA	NA	NA	NA
698059:698542	attR	TATAGCTAAATCCTAAATATATGGCATAATAACTTATTGAATAATTGTAGAATCAAACAAGGAGTGTGTCATGGGATATCCAGTTGAATTCAGACGGAAGGTCTTTAAGTTAAAAGAAAAGAAAGGGCTAACTTATGAGGAAGTTTCAGAGCTCTTTGGCGTTTCAATGAGGACGCTGTTTCGATGGAATACAAGAATAGAAATAAAAAAGAAGGCACCAAAACCTCGAGTGATTAACTTAGAAGAGCTAAAGAATGATGTAAAAAATTATCCGGATAGTTATCAATGGGAACGTGCGCAACGTTTTGGTGTAAGTCAACACTGTATTCAGCATTGGTTGAATTTCCTTGCAATCAGCTGTAAAAAAAACACTAAAACACCCAAAAGCCAACGAAAATACACGTACAAGCTTCCAGAATAAAATCAAGCGCTACGCCGGCTATGGTCGACCCATTGTTTATTTAGATGAAAGTGGTTTTGCAAC	NA	NA	NA	NA
WP_155067991.1|698834_699251_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155589549.1|700113_700944_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068155.1|701456_701903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081490.1|701989_702490_+	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_155079973.1|702599_702794_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066278.1|702790_703840_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079974.1|704164_704530_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079975.1|704475_705051_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|705236_705623_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|705606_706164_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079976.1|706214_706826_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	35.0	4.1e-23
WP_155068600.1|707082_707307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079977.1|709469_710462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079978.1|711523_712345_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377842.1|712491_712746_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_155068763.1|712846_714631_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_155068124.1|714719_715439_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_155068123.1|715597_715804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079979.1|715803_716040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079980.1|716052_716430_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_155079981.1|716926_717778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068119.1|717870_718068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079982.1|718161_719547_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_155068117.1|719673_720264_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_155081491.1|720705_721158_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068097.1|721189_721540_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079983.1|722505_723294_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_155079906.1|723297_723570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|723656_724007_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|724038_724491_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|724840_725227_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|725210_725768_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079984.1|726054_727536_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	32.9	1.4e-69
WP_155079959.1|727578_727929_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	38.2	7.6e-14
WP_155079958.1|727925_728234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079986.1|728282_728948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079987.1|729275_730250_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155079988.1|730496_731447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|731469_731856_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|731839_732397_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079989.1|732399_733389_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_155079990.1|734259_735024_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_155079478.1|735004_735562_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079897.1|735545_735932_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079991.1|736000_736606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066404.1|736819_737706_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155068114.1|738028_738694_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_155079992.1|738753_739710_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	1.8e-33
WP_155067468.1|740051_740198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|740294_740852_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|740835_741222_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079993.1|741240_742191_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068112.1|742293_742911_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155079994.1|742950_744087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079995.1|744563_745412_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155079741.1|745435_746410_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.0e-27
>prophage 10
NZ_CP039227	Piscirickettsia salmonis strain SR1 chromosome, complete genome	3562064	766584	802259	3562064	tRNA,integrase,transposase	unidentified_phage(33.33%)	41	771835:771894	802612:802750
WP_155080005.1|766584_767470_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080006.1|767434_767707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081491.1|768939_769392_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068097.1|769423_769774_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080007.1|769967_770942_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	5.8e-27
WP_155080008.1|771080_771545_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080009.1|771574_772258_-	hypothetical protein	NA	NA	NA	NA	NA
771835:771894	attL	CATCAATCGCTAAGGGTCTGATTCCCCGCAGCTTGCTGCGAAAAAAAACAAAGCGCATTA	NA	NA	NA	NA
WP_155079478.1|772283_772841_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|772824_773211_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080010.1|773207_773714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080011.1|773839_774007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081465.1|774652_775105_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|775136_775487_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080012.1|775686_777123_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_155068095.1|777199_778660_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_155068094.1|778780_779068_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210526.1|779257_780301_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_155068093.1|780316_781216_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_155068092.1|781212_781731_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_155080013.1|781800_782418_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_155080014.1|782427_783915_+	ribonuclease G	NA	NA	NA	NA	NA
WP_155080015.1|783924_787605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080016.1|787678_788491_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_155068087.1|788487_789168_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_155080017.1|790081_791311_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080018.1|792047_792503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080019.1|792728_792914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081492.1|792840_793230_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|793261_793612_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080020.1|793677_794604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|795554_795941_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|795924_796482_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|796578_796965_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|796948_797506_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080021.1|797591_797858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081493.1|799510_799687_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066936.1|799720_800071_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|800102_800555_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080022.1|800549_800795_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	47.9	5.3e-14
WP_155079868.1|800861_802017_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_155080023.1|801974_802259_-|transposase	transposase	transposase	NA	NA	NA	NA
802612:802750	attR	CATCAATCGCTAAGGGTCTGATTCCCCGCAGCTTGCTGCGAAAAAAAACAAAGCGCATTACGACCCGAAGGGGTAATTTTCCGAAATACCTCGTAGCTTGCTGCGAGGATAGGTAAATTGAGTTTTGCGCAAATTTATT	NA	NA	NA	NA
>prophage 12
NZ_CP039227	Piscirickettsia salmonis strain SR1 chromosome, complete genome	3562064	875485	912265	3562064	integrase,transposase	unidentified_phage(28.57%)	42	878038:878097	899492:900451
WP_155068622.1|875485_875938_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|875969_876320_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155589554.1|877471_878068_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
878038:878097	attL	TATAGCTGACACGGTTGAGTTAACCTTTTGATTTTGCTATTATTCTTACATGAAAAATAT	NA	NA	NA	NA
WP_155079476.1|878064_878451_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|878434_878992_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080055.1|879674_881141_+	protein kinase	NA	NA	NA	NA	NA
WP_155080056.1|882623_883127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079487.1|883245_884295_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079487.1|884565_885615_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080057.1|885629_886451_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155085254.1|886595_887069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|887175_888150_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155080058.1|888887_889163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|890472_890823_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081465.1|890854_891307_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080059.1|891471_891864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080060.1|891967_893002_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_155068017.1|892998_893709_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	1.3e-31
WP_155080061.1|893917_894385_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6H9S3	Enterobacteria_phage	30.9	7.3e-12
WP_155080062.1|894351_894519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080063.1|894575_894749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080064.1|894890_895094_-	phosphatase	NA	NA	NA	NA	NA
WP_155079612.1|895234_896464_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080065.1|896563_896758_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080066.1|896989_897574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080067.1|897539_897686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080068.1|897844_898327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080069.1|898330_898807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080070.1|899028_899559_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|899518_899905_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|899888_900446_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|900527_900914_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
899492:900451	attR	TATAGCTGACACGGTTGAGTTAACCTTTTGATTTTGCTATTATTCTTACATGAAAAATATAGCAGGATTTTAGAATTGCAAGCTTATAGTCAGGATTTGCGAGAGCGCGTTATTGAAGCTTATAAAGATGGGCTTAGCCGAAGAGAAATATCCACTCTTTTCAAGGTGCATTATGATACAGCTTGTGAATGGATTCGACGTTATTTATCAACAGGTGACTACTCTTCAAAACAAGGAGTTGGCTGTGGCGCACAAATAAGGTTTAATGACAAACAAACTATTCTAGATTTCATAAAGAAAAATCCAGATGCAAATGGGATTGCCATTCGTGATGGCATTGCTCCTGACCTCCCTATGTCAACCTTTTATGACGCATTGAAACGATTAAAAGTCACATATAAAAAAAGAGCCTAAGTATAAGCAAAGACGTGACGCCGAAAGATCTGAATTTATAGAAAAGCTAACAGGAATTGATTTGAGCCAATTAGTTTATCTTGATGAGGTTGGCGTTGATGATAATATCGTTGTTGAATATGGCTGGTCAGCTGCCGGAGTGCGAAGTTATGCTGAACAAGCAGGCTTCAAGAGGAAAAGGTTAAGCCTTGTTGCTGGCTTGAAGTATAGTGATAAAAGTTTGGTTGCTCCTTTCGAATTTTCAGGTGCAATGAATAAGGATTTGTTTTTAGGCTGGTTTGAACAGGAATTATGTCCGAAGCTAAATCCTGGGCAAGTAATTATCATGGATAATGCAAGCTTCCATAAAAGCCCTGAACTTTATGATATGGTTGAAGCTGTTGATTGTGAACTATTATACTTGCCAGCCTACTCACCAGACTTAAATCCAATTGAAAAATTCTGGGCTAATTTTAAACGAAATATAAGAAAGGTGATTAAAAAACATGAGCATCTTTGCAACGCAATTACTGACGCATTAATTAAGACTCTTCCGGGTTAGCTATA	NA	NA	NA	NA
WP_155080071.1|901081_902235_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	2.6e-58
WP_155079612.1|903121_904351_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155589555.1|904425_904653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068012.1|904771_905104_-	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	35.4	2.8e-05
WP_155080073.1|905139_908091_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_155080074.1|908137_908644_-	chagasin	NA	NA	NA	NA	NA
WP_155079461.1|909190_910165_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	7.5e-27
WP_155066936.1|910361_910712_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081465.1|910743_911196_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080075.1|911200_912265_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP039227	Piscirickettsia salmonis strain SR1 chromosome, complete genome	3562064	932206	975528	3562064	tRNA,transposase	Staphylococcus_phage(14.29%)	46	NA	NA
WP_155066936.1|932206_932557_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|932588_933041_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080087.1|933321_934171_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066440.1|934247_935222_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	1.2e-29
WP_155080088.1|935432_935822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080089.1|936483_937533_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080090.1|938190_938601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080091.1|938687_939338_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	50.3	1.5e-47
WP_155080092.1|939334_940045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080093.1|941482_941698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081498.1|942076_942865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079887.1|943607_944150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080094.1|944124_944403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080243.1|944378_944921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|945234_945585_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081465.1|945616_946069_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080096.1|946341_947055_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_155080097.1|947144_948236_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_155080098.1|948307_948889_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_155080099.1|948894_949521_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_155067986.1|949618_950566_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	34.3	2.6e-40
WP_155068753.1|950912_951575_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_017377908.1|951748_952408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080100.1|952576_953836_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_017377906.1|953832_954918_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_155589556.1|954910_955792_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_155068752.1|955780_957037_-	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_155079887.1|957240_957783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080102.1|957821_958274_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_155080103.1|958330_958846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080104.1|959566_960616_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080105.1|961031_961601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068903.1|961736_961934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080106.1|963108_964080_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080107.1|963947_964343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067975.1|965209_967663_+	kinase	NA	NA	NA	NA	NA
WP_155080108.1|967750_968800_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067973.1|968913_969273_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
WP_155067972.1|969269_969587_+	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
WP_155080109.1|969651_970761_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_155080110.1|970787_971873_-	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_155067968.1|971995_973036_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SR00	Cyanophage	45.3	7.7e-70
WP_155067967.1|973050_973701_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.7	1.1e-21
WP_155080111.1|973818_974361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080112.1|974335_974509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|974553_975528_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
>prophage 14
NZ_CP039227	Piscirickettsia salmonis strain SR1 chromosome, complete genome	3562064	989625	1228049	3562064	tRNA,integrase,transposase	unidentified_phage(20.0%)	236	1056724:1056783	1094804:1095430
WP_155079445.1|989625_990600_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155080120.1|990585_991017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080121.1|991371_992517_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	41.7	1.9e-61
WP_016211408.1|992725_994072_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_155066807.1|994186_995179_+	AAA family ATPase	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_155066808.1|995181_995679_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_155066809.1|995675_996515_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_155080122.1|996547_998080_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_155079413.1|998588_999758_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080131.1|1000030_1000417_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080132.1|1000710_1001334_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.3	4.2e-23
WP_155080133.1|1001513_1002398_-	DUF2608 domain-containing protein	NA	NA	NA	NA	NA
WP_155080134.1|1002527_1003349_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_155080135.1|1003350_1004388_-	asparaginase	NA	NA	NA	NA	NA
WP_155080136.1|1004388_1007046_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_155080137.1|1007123_1007933_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_017376219.1|1008342_1009110_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_155066817.1|1009289_1010168_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_064004235.1|1010171_1010909_+	UMP kinase	NA	NA	NA	NA	NA
WP_017376216.1|1010912_1011470_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_155080138.1|1011477_1012224_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.3	3.3e-22
WP_155066819.1|1012231_1013038_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_155080139.1|1013129_1014005_+	lipid A biosynthesis acyltransferase	NA	NA	NA	NA	NA
WP_155080140.1|1014706_1015924_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080141.1|1015988_1017248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080142.1|1017724_1019677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066825.1|1020218_1020758_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_155080143.1|1020754_1021783_-	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_155080144.1|1021772_1022837_-	GHMP kinase	NA	NA	NA	NA	NA
WP_155080145.1|1022824_1025053_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_155080146.1|1025039_1026107_-	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_155080147.1|1026394_1028794_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_155066831.1|1028880_1029417_+	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_155066832.1|1029465_1030515_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_075275393.1|1030532_1030979_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_016209377.1|1030978_1031752_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_155080148.1|1031770_1032925_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_155080149.1|1033139_1033709_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	42.9	3.4e-27
WP_155080150.1|1033732_1037239_+	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	38.5	1.4e-192
WP_155080151.1|1037316_1038276_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_155080152.1|1038250_1039696_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_155080153.1|1040019_1041549_+	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.6	1.5e-85
WP_155080154.1|1042125_1043823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080155.1|1044365_1045334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080156.1|1045689_1046538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080157.1|1046829_1049520_+	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_155080158.1|1049766_1050930_+	MFS transporter	NA	NA	NA	NA	NA
WP_155079724.1|1051660_1052842_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080159.1|1052991_1054632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080160.1|1055220_1056447_+	MFS transporter	NA	NA	NA	NA	NA
WP_155079445.1|1056644_1057619_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
1056724:1056783	attL	TTGCTAGAGCACTTGGCTTTGCTCCTAGCACAGTCAGTCGTGAGACTAAACGGCATACCC	NA	NA	NA	NA
WP_155079974.1|1057831_1058197_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080161.1|1058253_1058469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066848.1|1058821_1059361_-	superoxide dismutase	NA	Q9MC02	Salmonella_phage	53.8	2.4e-35
WP_155080162.1|1059525_1060863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|1061327_1061714_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155589557.1|1061697_1062216_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080163.1|1063007_1063517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|1064193_1065168_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155066852.1|1066432_1066846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155589558.1|1067463_1068438_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	6.8e-28
WP_155080165.1|1068624_1069092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079826.1|1069153_1070039_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080166.1|1070036_1071347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080167.1|1071349_1072078_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.2	1.5e-43
WP_155068622.1|1072269_1072722_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|1072753_1073104_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067991.1|1073187_1073604_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080168.1|1074675_1075404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080169.1|1076143_1076326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079487.1|1076432_1077482_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080170.1|1077625_1078285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079741.1|1078790_1079765_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.0e-27
WP_155067098.1|1079898_1080219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080171.1|1080164_1080740_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155068846.1|1080803_1080965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068847.1|1080974_1082429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080172.1|1082529_1083504_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.0	8.9e-28
WP_155080173.1|1083703_1084288_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|1084362_1084713_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079958.1|1084973_1085282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079959.1|1085278_1085629_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	38.2	7.6e-14
WP_155080463.1|1085671_1087153_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	32.7	8.4e-70
WP_155079487.1|1087523_1088573_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080174.1|1088746_1089289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066278.1|1089303_1090353_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080175.1|1090394_1090772_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_155080176.1|1090937_1092425_+	sodium/solute symporter	NA	NA	NA	NA	NA
WP_155079478.1|1093334_1093892_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1093875_1094262_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079836.1|1094627_1094834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|1095455_1095842_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
1094804:1095430	attR	TTGCTAGAGCACTTGGCTTTGCTCCTAGCACAGTCAGTCGTGAGACTAAACGGCATACCCCAAGCGATTTTAACGGTCTTTATTGCCATCGCTTGGCCTCGCGTTGTGCGCAAGAAAAACGGTCTAATGCTAAGCAAGGGCAGGATTTTCAGAAAATTTCAGAGAAAGCAAAAGTATTAATTCATGAGCGGTTAAGCACCCATACGTCACCCGATGTTATTAGTAAAGAGCTTATACAGGAGCATAATATCCAAGTGAGTGAGAGCACCATCTACCGTTATATTCATGAGGATCGAGAGAAAGGAGGAGAGCTTTACAAAAGCCTGCCCCACTCTGGAAAACCTTATAAGAAGAAGGTGAAAAGTGGTGATAAAACTAAAATACCGAACCGCGTTGGTATTGAACAAAGGCCCGCTATTGCTGACGAAAAGACTGAATTTGGACATTTTGAAATTGATACCATAGTAGGTCGAGATCACAAATCTTACTTGTTAACCCTTGTTGATAAAGCCAATAAGATGTGTTGTATAAGGAAAATGGCTAACAAATGTGCAGAAACCGTTGTTGAGACCTTCAGAAGTATAGTCGCCTCAACTTTCTTTGACTTTAAAACGATTACCTCAGATA	NA	NA	NA	NA
WP_155079478.1|1095825_1096383_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080177.1|1096619_1097153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080178.1|1097010_1097862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080179.1|1098306_1099359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080180.1|1101082_1101472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080181.1|1101668_1102061_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126790.1|1102065_1102971_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155080161.1|1103093_1103309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081500.1|1103465_1103690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079612.1|1104212_1105442_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080182.1|1105541_1105937_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080183.1|1106056_1106200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420711.1|1106283_1106709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080184.1|1106865_1107795_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.6	4.8e-31
WP_155067789.1|1108026_1108557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080185.1|1109514_1109916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080186.1|1111844_1112765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067783.1|1112765_1113617_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.1e-12
WP_155080187.1|1114038_1115085_+	glutathione synthase	NA	NA	NA	NA	NA
WP_155080188.1|1115068_1117066_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_155067781.1|1117244_1117550_+	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_155080189.1|1117779_1117986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080190.1|1118247_1118949_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080191.1|1118949_1119417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080192.1|1119746_1120532_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	34.2	1.2e-14
WP_155067557.1|1121747_1121981_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080193.1|1122053_1122281_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	45.5	3.1e-08
WP_155080194.1|1122498_1125252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080195.1|1125487_1126780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066370.1|1128496_1128778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067770.1|1128998_1129271_-	metal-sensing transcriptional repressor	NA	NA	NA	NA	NA
WP_155080196.1|1131828_1132266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080197.1|1132690_1133758_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080198.1|1134242_1134395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080019.1|1135142_1135328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081492.1|1135254_1135644_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|1135675_1136026_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155085237.1|1136483_1137767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080200.1|1137776_1139315_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_155080201.1|1139327_1140371_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_155080202.1|1140866_1141034_-	phosphatase	NA	NA	NA	NA	NA
WP_155080203.1|1140994_1141880_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1142078_1142465_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|1142448_1143006_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079887.1|1143085_1143628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080204.1|1143767_1144151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080205.1|1144424_1144571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080206.1|1145736_1146732_-	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_155067762.1|1146901_1147864_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_155080207.1|1148042_1148522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079883.1|1148518_1149094_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080208.1|1149039_1149405_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080209.1|1149732_1149924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|1149920_1150478_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1150461_1150848_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080210.1|1150912_1151233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080211.1|1151207_1151396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079868.1|1151392_1152549_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_155080212.1|1152599_1152899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080213.1|1152986_1154468_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_155081502.1|1154472_1154925_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067136.1|1154956_1155307_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079974.1|1155424_1155790_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080161.1|1155846_1156062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080214.1|1156158_1156419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080215.1|1156478_1157453_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.1	1.3e-26
WP_155080216.1|1157942_1159025_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.7	3.8e-144
WP_155080217.1|1159106_1160212_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.4	1.9e-50
WP_155080218.1|1160324_1160858_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066278.1|1160874_1161924_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080220.1|1161966_1162521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080221.1|1162563_1163646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|1163735_1164293_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079868.1|1164454_1165611_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_155589559.1|1165576_1165897_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080222.1|1166369_1167947_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	25.3	3.7e-15
WP_155067751.1|1168082_1168472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067750.1|1168657_1169473_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_155080219.1|1169792_1170842_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080223.1|1170908_1171739_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079487.1|1171753_1172803_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080224.1|1172901_1173780_-|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	35.8	1.5e-26
WP_155079478.1|1173787_1174345_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1174328_1174715_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080225.1|1174711_1175341_-|transposase	transposase	transposase	S5VLC8	Leptospira_phage	41.1	5.9e-33
WP_155080226.1|1175383_1175542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080227.1|1175558_1176170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068622.1|1176211_1176664_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|1176695_1177046_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080228.1|1177107_1177341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|1177348_1177906_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1177889_1178276_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155085229.1|1178272_1178614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080230.1|1178656_1178887_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.4	3.5e-07
WP_155079958.1|1178883_1179192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080231.1|1179247_1179496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080232.1|1179528_1180434_-	polyprenyl synthetase	NA	NA	NA	NA	NA
WP_016211119.1|1180587_1181349_+	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_155080233.1|1181352_1182219_+	OmpA family protein	NA	NA	NA	NA	NA
WP_155067747.1|1182301_1182913_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_155067746.1|1183293_1184541_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	70.4	2.5e-14
WP_155080234.1|1184677_1185394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080235.1|1185527_1186181_-	hypothetical protein	NA	R4ZFK6	Choristoneura_rosaceana_entomopoxvirus	27.2	1.5e-07
WP_155080236.1|1186728_1187823_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_027242998.1|1187904_1188426_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	3.8e-25
WP_155080237.1|1188477_1188954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067739.1|1189009_1189312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080238.1|1189376_1190084_-	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_155067737.1|1190449_1190848_+	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_027242993.1|1190893_1191325_+	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_027242992.1|1191335_1192019_+	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_016210285.1|1192094_1194290_+	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_155080239.1|1194393_1195131_+	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_064005418.1|1195158_1195944_+	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_155068730.1|1196012_1196717_+	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_155080240.1|1196704_1197874_+	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_155067733.1|1197928_1198756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080241.1|1198825_1201813_+	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_155080242.1|1201854_1203246_+	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_155067730.1|1203259_1203976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080243.1|1204668_1205211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079888.1|1205186_1205333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079887.1|1205307_1205850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066278.1|1206404_1207454_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080244.1|1207496_1208456_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_155067727.1|1208510_1210523_+	TRAP transporter fused permease subunit	NA	NA	NA	NA	NA
WP_155067726.1|1210575_1210869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080245.1|1211122_1212322_+	enoyl-[acyl-carrier-protein] reductase FabV	NA	NA	NA	NA	NA
WP_155080246.1|1212397_1213981_-	amino acid permease	NA	NA	NA	NA	NA
WP_155079445.1|1214081_1215056_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155080247.1|1215539_1215887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079487.1|1215929_1216979_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080248.1|1216995_1218078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080249.1|1218720_1218885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080250.1|1218969_1219389_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080251.1|1219571_1219718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080208.1|1219850_1220216_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066610.1|1220161_1220737_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080252.1|1220740_1221892_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080253.1|1222045_1223827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080254.1|1223939_1225178_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.3	1.2e-93
WP_155067720.1|1225167_1225830_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_155080255.1|1226104_1227361_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_155080256.1|1227491_1228049_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP039227	Piscirickettsia salmonis strain SR1 chromosome, complete genome	3562064	1234003	1357566	3562064	tRNA,transposase	Leptospira_phage(21.74%)	115	NA	NA
WP_155080262.1|1234003_1234888_-|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	37.0	4.0e-27
WP_155080263.1|1235032_1235773_-|transposase	transposase	transposase	S5VLC8	Leptospira_phage	42.2	4.0e-36
WP_155079476.1|1235939_1236326_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|1236309_1236867_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080264.1|1236863_1237124_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.0	3.8e-10
WP_155068622.1|1237196_1237649_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|1237680_1238031_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080265.1|1238096_1238252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080266.1|1238392_1239622_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080267.1|1239721_1239877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080268.1|1239932_1240745_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080269.1|1240741_1241224_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_155080270.1|1242280_1243528_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_155080271.1|1244314_1245277_-	hypothetical protein	NA	A0A160DHD3	Gordonia_phage	26.5	8.0e-13
WP_155079445.1|1245300_1246275_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155080272.1|1246334_1247309_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.1	8.3e-26
WP_155080273.1|1248196_1248409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081503.1|1248647_1249175_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_155080274.1|1249347_1249632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|1250724_1251111_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|1251094_1251652_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067718.1|1251667_1252327_+	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155067717.1|1252401_1253103_+	cyclase family protein	NA	NA	NA	NA	NA
WP_155067716.1|1253126_1253933_-	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	42.9	7.7e-09
WP_155080276.1|1254193_1254676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080277.1|1254820_1255597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080278.1|1255741_1256083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080279.1|1256390_1256570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|1256550_1257108_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1257091_1257478_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155068622.1|1257592_1258045_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155589560.1|1259140_1259482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|1259536_1259887_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|1259918_1260371_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067714.1|1260950_1261100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067713.1|1261452_1261821_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_017376425.1|1261817_1262636_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_155080281.1|1262736_1263552_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_155081504.1|1263835_1265896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067710.1|1265895_1266318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068728.1|1266503_1267997_-	neurotransmitter symporter family protein	NA	NA	NA	NA	NA
WP_155080282.1|1268129_1268945_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_155067708.1|1269040_1269457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080283.1|1269802_1270342_-	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_155068727.1|1271108_1272371_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.3	9.2e-25
WP_155080284.1|1272846_1274670_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	1.3e-43
WP_016209821.1|1274759_1275092_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_155067705.1|1275122_1275719_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_155067704.1|1275715_1276840_+	hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_155067703.1|1276975_1277623_+	methyltransferase	NA	W8CYT3	Bacillus_phage	31.5	3.6e-09
WP_155080285.1|1277671_1279585_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.3	2.6e-116
WP_155066936.1|1280886_1281237_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081465.1|1281268_1281721_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080286.1|1281715_1282246_-|transposase	transposase	transposase	S5VTP8	Leptospira_phage	37.1	2.7e-23
WP_155080287.1|1283210_1283597_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080288.1|1283580_1283955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080289.1|1283929_1284148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080290.1|1284252_1284642_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080291.1|1284912_1285560_-|transposase	transposase	transposase	S5VLC8	Leptospira_phage	41.2	2.7e-33
WP_155079959.1|1285602_1285953_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	38.2	7.6e-14
WP_155079958.1|1285949_1286258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080292.1|1286398_1289701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080293.1|1290401_1291370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080294.1|1291478_1291967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080295.1|1292408_1292825_+	response regulator	NA	NA	NA	NA	NA
WP_155080296.1|1292881_1293757_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155080297.1|1294110_1295472_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155079741.1|1295978_1296953_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.0e-27
WP_155080298.1|1296990_1297488_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_155080299.1|1297517_1298843_-	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.7e-37
WP_155080300.1|1298865_1299513_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155080301.1|1299706_1301653_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.8	4.7e-44
WP_155080302.1|1301796_1304727_+	peptidase M16	NA	NA	NA	NA	NA
WP_155080303.1|1304980_1305556_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080304.1|1305501_1305669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067991.1|1305713_1306130_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080305.1|1307031_1307187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|1307113_1307464_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080306.1|1307540_1307945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080307.1|1308204_1309335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081465.1|1309339_1309792_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|1309823_1310174_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080308.1|1310681_1311701_-	FUSC family protein	NA	NA	NA	NA	NA
WP_155080309.1|1311693_1312740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080310.1|1313714_1313879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079612.1|1314486_1315716_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080311.1|1316741_1317776_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079478.1|1318180_1318738_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1318721_1319108_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155067684.1|1319453_1321394_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	2.1e-73
WP_155080312.1|1321531_1322185_+	glutaredoxin 2	NA	NA	NA	NA	NA
WP_155080313.1|1322353_1323529_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_155067681.1|1323897_1325223_+	fimbrial protein FimV	NA	NA	NA	NA	NA
WP_155081505.1|1325313_1326096_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_155080314.1|1326197_1327070_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_155080315.1|1327256_1328519_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_155067678.1|1328592_1329123_+	colicin V production family protein	NA	NA	NA	NA	NA
WP_155080316.1|1329144_1330650_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.4	4.5e-87
WP_155080317.1|1330662_1331328_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_155080318.1|1331421_1333182_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_155080319.1|1333540_1333822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066278.1|1334433_1335483_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080321.1|1337882_1338932_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080322.1|1338968_1341644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080323.1|1343287_1344187_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.1e-23
WP_155080266.1|1344300_1345530_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080324.1|1346023_1346686_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_155080325.1|1346712_1347942_-	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_155080326.1|1348098_1350870_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.1	1.3e-148
WP_017376400.1|1350940_1351384_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_155080327.1|1351536_1353009_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.4	1.8e-43
WP_155067662.1|1353120_1354182_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_027242800.1|1354178_1355213_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_155080328.1|1355215_1356256_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_026063528.1|1356450_1357566_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.2	2.2e-94
>prophage 16
NZ_CP039227	Piscirickettsia salmonis strain SR1 chromosome, complete genome	3562064	1361294	1402904	3562064	tRNA,integrase,transposase	Acinetobacter_phage(37.5%)	38	1377912:1377971	1383232:1383329
WP_155079612.1|1361294_1362524_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016209938.1|1362756_1363395_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_155080329.1|1363369_1364794_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	33.9	3.5e-41
WP_155067657.1|1364984_1365662_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_155067656.1|1365782_1367057_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.5	8.8e-92
WP_155080330.1|1367124_1367880_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_155080331.1|1369248_1370139_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155081506.1|1370278_1371661_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.4	1.9e-39
WP_155080332.1|1371860_1372049_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_122942662.1|1372062_1373196_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_155080333.1|1373394_1377240_+	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_155080334.1|1377277_1377937_-	hypothetical protein	NA	NA	NA	NA	NA
1377912:1377971	attL	TGAAATGACCCCCTTCCTTCCGACAAAAAGGAACCTCAATTAAGAAATTATTTTTGCCTC	NA	NA	NA	NA
WP_155080335.1|1379100_1379322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|1379442_1379793_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081465.1|1379824_1380277_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080336.1|1380271_1380595_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q716C2	Shigella_phage	45.6	9.8e-16
WP_155080337.1|1380739_1381345_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.2	5.2e-26
WP_155080338.1|1381404_1381692_-|transposase	transposase	transposase	A9YX41	Burkholderia_phage	38.3	2.2e-06
WP_155080339.1|1381745_1382030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080340.1|1382118_1383144_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	31.0	2.6e-25
WP_155068722.1|1383370_1383724_-	hypothetical protein	NA	NA	NA	NA	NA
1383232:1383329	attR	GAGGCAAAAATAATTTCTTAATTGAGGTTCCTTTTTGTCGGAAGGAAGGGGGTCATTTCAAGTAGTTAGGTGGTAGGTTTATTTTTGAGAGGTAAGAC	NA	NA	NA	NA
WP_107517381.1|1383937_1384132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080341.1|1384199_1384712_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155080342.1|1384848_1385598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080343.1|1385652_1386249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080344.1|1386282_1387098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067640.1|1387867_1388215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080345.1|1388330_1389113_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_155081507.1|1389195_1390146_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_155080346.1|1390684_1393534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080347.1|1393551_1394133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080348.1|1394252_1394981_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_155080349.1|1395345_1396449_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080350.1|1396463_1397240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080351.1|1398318_1399065_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155081508.1|1399977_1400466_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080352.1|1400615_1401695_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155079864.1|1401748_1402904_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.4e-50
>prophage 17
NZ_CP039227	Piscirickettsia salmonis strain SR1 chromosome, complete genome	3562064	1449157	1484679	3562064	tRNA,transposase	unidentified_phage(22.22%)	33	NA	NA
WP_155067991.1|1449157_1449574_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081465.1|1449743_1450196_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|1450227_1450578_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080372.1|1450715_1451945_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080182.1|1452044_1452440_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067584.1|1453133_1454480_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_155080373.1|1454627_1455926_-	PAS domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.3	7.5e-14
WP_155080374.1|1456103_1456955_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_155080375.1|1456963_1457635_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_155081511.1|1458044_1459319_+	endonuclease/exonuclease/phosphatase	NA	NA	NA	NA	NA
WP_155080376.1|1459383_1461306_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	34.4	9.2e-85
WP_155080377.1|1461312_1462242_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_155589562.1|1462338_1465071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067577.1|1465605_1466082_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_155080379.1|1466152_1467016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081512.1|1467143_1467962_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_155067571.1|1468068_1468530_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_155080380.1|1468546_1469470_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_155080381.1|1469493_1470555_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_155068713.1|1470692_1471286_+	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	31.4	8.1e-16
WP_155067568.1|1471308_1471779_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_155080382.1|1471867_1473139_+	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	27.4	2.5e-14
WP_155067544.1|1473255_1474419_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	31.0	2.2e-25
WP_155080383.1|1474462_1475437_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.7	4.4e-27
WP_155080698.1|1476119_1477073_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079445.1|1477132_1478107_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155080697.1|1478324_1478636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080696.1|1478780_1479092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|1479153_1479540_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211840.1|1479880_1480345_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_155067563.1|1480496_1481969_+	catalase	NA	A0A2K9L572	Tupanvirus	46.6	3.8e-99
WP_155080695.1|1482085_1482538_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_155080442.1|1483551_1484679_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP039227	Piscirickettsia salmonis strain SR1 chromosome, complete genome	3562064	1489767	1549358	3562064	transposase	Streptococcus_phage(22.22%)	54	NA	NA
WP_155080693.1|1489767_1490421_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.9	1.0e-35
WP_155080692.1|1490635_1491184_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_155067552.1|1491311_1492040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080691.1|1492099_1495591_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_155080690.1|1495648_1496902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067549.1|1497011_1497914_-	acyltransferase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	41.0	7.2e-56
WP_155080689.1|1497967_1499005_-	agmatine deiminase	NA	M1H3B1	Paramecium_bursaria_Chlorella_virus	29.1	8.3e-40
WP_155067547.1|1499142_1500381_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_155067546.1|1500373_1501099_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.2	2.9e-31
WP_155080688.1|1501202_1502930_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_155589563.1|1503230_1503584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211833.1|1504166_1504667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080687.1|1504754_1505723_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080686.1|1505686_1506262_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079974.1|1506207_1506573_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080383.1|1507047_1508022_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.7	4.4e-27
WP_155080685.1|1508045_1508273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079974.1|1508308_1508674_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080684.1|1508619_1509177_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079445.1|1509173_1510148_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155589564.1|1510327_1510927_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	34.1	2.8e-16
WP_155589565.1|1511035_1511407_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080682.1|1512184_1514551_+	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_155080681.1|1514598_1515795_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_155080680.1|1515932_1516139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080679.1|1516332_1518762_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_155080678.1|1518854_1520357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080677.1|1520465_1521038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|1522018_1522405_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|1522388_1522946_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080675.1|1523419_1523608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080674.1|1523529_1524888_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_155079476.1|1524991_1525378_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079881.1|1525361_1525775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|1525840_1526191_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|1526222_1526675_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080673.1|1528031_1528805_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_155067540.1|1528903_1529854_-	EamA family transporter	NA	NA	NA	NA	NA
WP_155085323.1|1529990_1531433_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A1X9I5H2	Streptococcus_phage	24.2	5.9e-20
WP_155067539.1|1531648_1532833_+	aminoacetone oxidase family FAD-binding enzyme	NA	NA	NA	NA	NA
WP_155067538.1|1532956_1533643_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.5	1.6e-28
WP_155067537.1|1533778_1534363_+	superoxide dismutase [Fe]	NA	NA	NA	NA	NA
WP_155067536.1|1534452_1534797_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017377969.1|1535118_1535358_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_155080671.1|1535389_1535596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|1536833_1537220_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|1537203_1537761_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080670.1|1537741_1538125_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155067532.1|1538845_1539898_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_155080669.1|1539915_1543014_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_155080668.1|1545774_1546743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080465.1|1548272_1548593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081533.1|1548619_1549072_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080581.1|1549103_1549358_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP039227	Piscirickettsia salmonis strain SR1 chromosome, complete genome	3562064	1553559	1666069	3562064	tRNA,transposase	Acinetobacter_phage(15.38%)	113	NA	NA
WP_155080663.1|1553559_1554675_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155589566.1|1554838_1555093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080660.1|1555108_1556047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080659.1|1556061_1556862_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079868.1|1556912_1558068_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_155080658.1|1558096_1558411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080657.1|1558354_1558570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080656.1|1558615_1558885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080655.1|1558844_1559015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081532.1|1560610_1561351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067510.1|1561331_1561766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080654.1|1561810_1562440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080653.1|1562514_1563429_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_155080652.1|1563459_1566762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080651.1|1566758_1568582_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_155067505.1|1568621_1569020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080650.1|1569142_1570147_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_155080649.1|1570579_1572028_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_155080648.1|1572109_1575166_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_155080647.1|1575162_1575336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067468.1|1575867_1576014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080646.1|1576097_1576391_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	37.5	2.2e-06
WP_155080645.1|1576507_1577071_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.5	1.9e-35
WP_155080644.1|1577095_1577251_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155080643.1|1577243_1577942_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066936.1|1578011_1578362_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081465.1|1578393_1578846_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080642.1|1578840_1579080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080641.1|1579445_1579859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080640.1|1580135_1580600_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_155080639.1|1580668_1582189_-	NOL1/NOP2/sun family putative RNA methylase	NA	NA	NA	NA	NA
WP_155067496.1|1582276_1582879_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_155067495.1|1582875_1583223_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_155067494.1|1583358_1584357_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	2.2e-34
WP_155079487.1|1584381_1585431_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080638.1|1585871_1586033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080637.1|1586126_1587107_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_155081531.1|1587380_1587605_-	hypothetical protein	NA	A0A2P0VP61	Tetraselmis_virus	45.8	8.3e-06
WP_155080161.1|1587761_1587977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067835.1|1588033_1588201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068622.1|1588233_1588686_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|1588717_1589068_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080636.1|1589129_1589315_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080635.1|1589350_1590010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080634.1|1590038_1590782_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.9	2.2e-18
WP_155066404.1|1590977_1591864_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067487.1|1592428_1593304_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_155081530.1|1593469_1597384_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.5	6.1e-51
WP_155080630.1|1599020_1599830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067484.1|1599879_1600701_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_155080629.1|1600904_1602131_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	26.9	4.4e-32
WP_155067482.1|1602340_1603066_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_155080628.1|1603108_1604647_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_155080627.1|1604653_1606039_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.8	3.4e-49
WP_155080626.1|1606458_1607433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080625.1|1607416_1607974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|1608018_1608993_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155080624.1|1609012_1609573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079958.1|1609953_1610262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079959.1|1610258_1610609_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	38.2	7.6e-14
WP_155081529.1|1610738_1611125_+	hypothetical protein	NA	S5VLC8	Leptospira_phage	37.2	2.1e-09
WP_155080623.1|1611269_1612421_+|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	37.0	5.2e-27
WP_155080622.1|1612507_1612867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080621.1|1613085_1613700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079888.1|1613674_1613821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080620.1|1613796_1614051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079906.1|1614354_1614627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080618.1|1614650_1615217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|1615686_1616073_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|1616056_1616614_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081465.1|1616830_1617283_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080617.1|1617287_1618289_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080616.1|1619296_1619560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080615.1|1619674_1620403_-	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_155081528.1|1620776_1623596_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.1	5.2e-312
WP_155068706.1|1624145_1625279_+	MFS transporter	NA	S4TR35	Salmonella_phage	23.0	1.6e-15
WP_155080614.1|1625485_1627258_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	39.5	6.4e-08
WP_155080613.1|1627390_1628434_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_155080612.1|1628447_1629191_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_155080611.1|1629268_1629625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619422.1|1629686_1629866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080610.1|1629940_1630642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080609.1|1632155_1633544_+	protein kinase	NA	NA	NA	NA	NA
WP_155067466.1|1633599_1634424_-	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	28.3	8.1e-06
WP_155079868.1|1635675_1636831_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_155080608.1|1638509_1638647_-	phosphatase	NA	NA	NA	NA	NA
WP_155067541.1|1638583_1639582_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080607.1|1639706_1640513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080606.1|1640768_1641596_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_155080605.1|1641625_1642480_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_155080604.1|1642993_1644187_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080603.1|1645791_1646097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300641.1|1646158_1646524_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080161.1|1646580_1646796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080602.1|1647912_1648746_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_155068622.1|1648740_1649193_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|1649224_1649575_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080601.1|1649651_1650227_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080600.1|1650172_1650493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079741.1|1650569_1651544_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.0e-27
WP_155080599.1|1651968_1652265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080598.1|1652547_1653906_-	AAA family ATPase	NA	G3MBE0	Bacillus_virus	37.1	1.2e-70
WP_155067283.1|1654187_1654547_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_016210111.1|1654948_1656583_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	9.7e-144
WP_155067284.1|1656589_1657426_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	7.6e-52
WP_155080597.1|1657447_1658725_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	61.2	3.3e-139
WP_155080596.1|1658811_1659132_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_155080595.1|1659155_1660247_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_155080594.1|1660445_1662035_+	amino acid permease	NA	NA	NA	NA	NA
WP_155067289.1|1662095_1662869_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	1.5e-65
WP_155080593.1|1663039_1664089_+	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	31.1	1.0e-29
WP_155080592.1|1664539_1664785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080591.1|1664875_1666069_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP039227	Piscirickettsia salmonis strain SR1 chromosome, complete genome	3562064	1686574	1738408	3562064	transposase	Adoxophyes_honmai_entomopoxvirus(14.29%)	52	NA	NA
WP_155080584.1|1686574_1687804_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080583.1|1687903_1688128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080582.1|1688441_1688648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080581.1|1688669_1688924_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|1688955_1689408_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079731.1|1690203_1690452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080580.1|1690435_1690993_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081527.1|1691495_1691876_+	cell envelope biogenesis protein OmpA	NA	NA	NA	NA	NA
WP_155080579.1|1692021_1692798_-	methyltransferase domain-containing protein	NA	R4ZD91	Adoxophyes_honmai_entomopoxvirus	25.5	1.5e-14
WP_155080578.1|1693201_1693768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068622.1|1694347_1694800_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|1694831_1695182_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080577.1|1695919_1696498_+	nucleoside deaminase	NA	S4VYT2	Pandoravirus	34.7	1.5e-14
WP_155067314.1|1696525_1696921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080576.1|1697026_1698484_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_155080575.1|1698545_1700033_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_155079906.1|1701315_1701588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068622.1|1702071_1702524_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|1702555_1702906_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080042.1|1703149_1703500_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080574.1|1703561_1704329_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377201.1|1704872_1705343_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|1707570_1708128_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1708111_1708498_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079487.1|1710665_1711715_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067321.1|1712972_1714778_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_017378301.1|1715246_1716044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067322.1|1716213_1716675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080573.1|1717033_1718395_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155589568.1|1718923_1719325_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080572.1|1719284_1719629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081526.1|1719773_1719926_-	phosphatase	NA	NA	NA	NA	NA
WP_054300641.1|1720093_1720459_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080571.1|1720704_1721229_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	33.5	5.3e-19
WP_155080570.1|1721232_1722315_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079826.1|1722311_1723198_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1723440_1723827_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080569.1|1723810_1724275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080568.1|1724317_1725292_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.1	1.7e-26
WP_155068678.1|1725547_1725667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080567.1|1725905_1726925_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155079588.1|1726986_1727352_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079586.1|1727297_1727873_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080566.1|1727869_1728094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079612.1|1728396_1729626_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155067325.1|1729789_1731745_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_155079612.1|1732050_1733280_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155067326.1|1733643_1733829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067327.1|1734165_1735155_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_155080565.1|1737130_1737529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068622.1|1737573_1738026_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|1738057_1738408_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP039227	Piscirickettsia salmonis strain SR1 chromosome, complete genome	3562064	1743820	1792479	3562064	protease,transposase	unidentified_phage(33.33%)	58	NA	NA
WP_155080558.1|1743820_1744369_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080557.1|1745026_1745365_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|1745348_1745906_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080556.1|1746035_1746584_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080555.1|1746903_1747197_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079445.1|1747376_1748351_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155080554.1|1748481_1749060_+	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	35.5	1.3e-05
WP_155080553.1|1749345_1749600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080552.1|1749686_1750505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079826.1|1750508_1751395_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080551.1|1751458_1751887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|1752017_1752404_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|1752387_1752945_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080550.1|1753107_1754259_-	amino acid permease	NA	NA	NA	NA	NA
WP_155080549.1|1754370_1754835_-	amino acid permease	NA	NA	NA	NA	NA
WP_155067332.1|1754970_1755798_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_155067333.1|1756165_1756777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080548.1|1756887_1757862_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	4.9e-26
WP_144420684.1|1758066_1758315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081525.1|1758483_1759437_+	response regulator	NA	NA	NA	NA	NA
WP_155080547.1|1759879_1760176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080546.1|1760205_1760934_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155080545.1|1760902_1762021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|1762036_1762423_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080544.1|1762406_1762964_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080543.1|1763093_1763300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067435.1|1763419_1763518_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155067434.1|1763753_1764383_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_155067433.1|1764366_1764789_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_155080542.1|1764795_1766535_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.0	7.6e-54
WP_155080541.1|1766535_1767600_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_155080540.1|1767603_1767957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080539.1|1768079_1769048_+	ferrochelatase	NA	NA	NA	NA	NA
WP_155080538.1|1769057_1769369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080537.1|1769384_1769954_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	38.4	1.4e-28
WP_155080536.1|1770217_1771546_+	amino acid carrier protein	NA	NA	NA	NA	NA
WP_155080535.1|1772030_1772381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080534.1|1772382_1772958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079612.1|1773057_1774287_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155067343.1|1774666_1775605_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_027242821.1|1775668_1777663_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_032127067.1|1777659_1778262_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_155080533.1|1778258_1778597_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_155080532.1|1778672_1779905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080531.1|1780616_1781231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080530.1|1781652_1782057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|1782040_1782427_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079487.1|1782529_1783579_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081523.1|1783607_1783967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080529.1|1784111_1784528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211856.1|1785674_1785860_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_017377178.1|1785987_1786455_+	bacterioferritin	NA	NA	NA	NA	NA
WP_017377177.1|1786451_1787330_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_155081522.1|1787581_1788889_+	MFS transporter	NA	NA	NA	NA	NA
WP_155085186.1|1789179_1790673_+	IraAB	NA	NA	NA	NA	NA
WP_155080527.1|1790658_1791633_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	4.1e-25
WP_155080526.1|1791709_1792132_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	35.3	4.1e-14
WP_155080338.1|1792191_1792479_-|transposase	transposase	transposase	A9YX41	Burkholderia_phage	38.3	2.2e-06
>prophage 22
NZ_CP039227	Piscirickettsia salmonis strain SR1 chromosome, complete genome	3562064	1801395	1825586	3562064	transposase	Hokovirus(25.0%)	27	NA	NA
WP_155081465.1|1801395_1801848_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|1801879_1802230_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080521.1|1802291_1802978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079826.1|1803015_1803901_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080520.1|1803865_1804447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067361.1|1805525_1805732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080519.1|1805899_1806814_-	EamA family transporter	NA	NA	NA	NA	NA
WP_155080518.1|1806993_1808442_+	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_155079612.1|1808831_1810061_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155067364.1|1811029_1811704_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_155079478.1|1811806_1812364_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080516.1|1812569_1812734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155589569.1|1812730_1812994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080516.1|1813210_1813375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|1813580_1814138_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080515.1|1814138_1814468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080514.1|1814608_1815061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081521.1|1815832_1816384_+	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	26.3	8.4e-07
WP_155080513.1|1816680_1817865_+	MFS transporter	NA	NA	NA	NA	NA
WP_155080512.1|1818031_1819630_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	3.3e-56
WP_155080511.1|1820239_1820407_-	phosphatase	NA	NA	NA	NA	NA
WP_155080510.1|1820367_1820703_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080509.1|1820847_1821021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080508.1|1820966_1821632_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080507.1|1821800_1822424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067370.1|1822469_1824413_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A223LD43	Bacillus_phage	34.0	1.7e-14
WP_155079445.1|1824611_1825586_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
>prophage 23
NZ_CP039227	Piscirickettsia salmonis strain SR1 chromosome, complete genome	3562064	1851520	1905194	3562064	integrase,transposase	unidentified_phage(45.45%)	52	1862239:1862298	1910707:1911151
WP_155079586.1|1851520_1852096_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080102.1|1852223_1852676_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_155080498.1|1852721_1853252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080497.1|1853543_1854095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080496.1|1854105_1855293_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.1	4.4e-21
WP_017376484.1|1855442_1856069_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.2e-33
WP_155080495.1|1856114_1857344_+	nucleoside:proton symporter	NA	B2YG43	Musca_hytrovirus	22.1	3.4e-08
WP_155080494.1|1857538_1858102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067392.1|1858176_1859535_+	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_155080493.1|1859988_1860696_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_155080492.1|1860742_1861705_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079996.1|1861841_1862255_+	hypothetical protein	NA	NA	NA	NA	NA
1862239:1862298	attL	CGCCCTCCGTCATATGAAGTGCAACACCACTCTACACTAAGCCGCCATTAAATTCTCTAA	NA	NA	NA	NA
WP_155079612.1|1862824_1864054_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155589570.1|1864825_1865710_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155067991.1|1865935_1866352_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080491.1|1866644_1867265_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_155067398.1|1867338_1868622_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_155079741.1|1870118_1871093_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.0e-27
WP_155080490.1|1871664_1873041_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_155079655.1|1873169_1874144_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.7	9.8e-27
WP_155080489.1|1874341_1875442_-	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_155067413.1|1875610_1876912_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.3	8.2e-29
WP_155067412.1|1876988_1877492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|1877605_1877956_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081519.1|1877987_1878413_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079655.1|1878409_1879384_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.7	9.8e-27
WP_155079487.1|1879693_1880743_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080488.1|1880796_1881714_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_155080487.1|1881779_1882244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067409.1|1882727_1882916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080486.1|1883240_1884137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067407.1|1884260_1885334_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_155085173.1|1885563_1886289_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_054300641.1|1886352_1886718_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079612.1|1886930_1888160_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080485.1|1888306_1888771_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080484.1|1888774_1889284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067405.1|1889432_1890146_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.5	1.0e-36
WP_155081518.1|1890333_1891746_+	MFS transporter	NA	NA	NA	NA	NA
WP_155080483.1|1891951_1892920_+	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_155080482.1|1892956_1893508_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079868.1|1893574_1894730_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_155080481.1|1894658_1894979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|1895023_1895998_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155080480.1|1896017_1896347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080442.1|1896571_1897699_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080478.1|1899958_1900960_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.2	5.4e-28
WP_155067415.1|1901247_1901490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067416.1|1901483_1901801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080477.1|1901911_1902790_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155080476.1|1902905_1904123_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_155068701.1|1904414_1905194_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1910707:1911151	attR	TTAGAGAATTTAATGGCGGCTTAGTGTAGAGTGGTGTTGCACTTCATATGACGGAGGGCGGAGTAGAAATTAAGGGTAAAACATTTGTACATCGATATTCCCGCGATACTTGCCAGGAGCTGTATGCTCAGGTACGGTTAACACTCCTCCAAAACAAATTTGCCCCCGCCCCCGGTTATTTAATTGAAGCACTTTTCCCTGACCATCGATAGATGAGCTGACAGTAACAGCAAGTGAGTTTGAGCGATTTTTCATAACTGCTTGTACAGGATAACTAATTTTTACATTATTACGATTCTCACCATTAATAGCAACGCAACCTGCGCGTGTATCATTCGAGGATGCCCTAACTCTCACTTGATTTTGGATATCTCCTGAAATAATCTGTCCAAAATCAAGGTTACGCAATACATTTGCTCTGATTCTAGCAAACACATTCACAATA	NA	NA	NA	NA
>prophage 24
NZ_CP039227	Piscirickettsia salmonis strain SR1 chromosome, complete genome	3562064	1916537	1963156	3562064	transposase	unidentified_phage(36.36%)	52	NA	NA
WP_155080470.1|1916537_1917404_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080469.1|1917515_1917899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080468.1|1918295_1919084_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_155080467.1|1919752_1920905_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	6.8e-59
WP_155080466.1|1920914_1921121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|1921183_1921570_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081465.1|1921731_1922184_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|1922215_1922566_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079478.1|1922704_1923262_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1923245_1923632_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080465.1|1923664_1923985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067341.1|1924637_1925078_+	universal stress family protein	NA	NA	NA	NA	NA
WP_155080251.1|1925294_1925441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079958.1|1925527_1925836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080464.1|1925832_1926183_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	39.2	5.8e-14
WP_155080463.1|1926225_1927707_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	32.7	8.4e-70
WP_155080462.1|1927711_1927942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|1928042_1929017_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_047927692.1|1929139_1929328_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079445.1|1929347_1930322_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155080461.1|1930366_1931542_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	1.6e-18
WP_155080460.1|1931591_1931774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080459.1|1932059_1933832_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.6	8.1e-27
WP_155080458.1|1934061_1934469_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	56.0	4.2e-32
WP_155080457.1|1934521_1934722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079612.1|1934862_1936092_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080456.1|1936191_1936332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067337.1|1936880_1937852_+	glycine/betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155067336.1|1937833_1938805_+	glycine/betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155079445.1|1938954_1939929_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155080455.1|1940025_1940832_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155080219.1|1940923_1941973_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067334.1|1942362_1942563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080408.1|1942878_1944108_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080454.1|1944252_1945227_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.5	3.1e-28
WP_155068704.1|1945571_1946252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420790.1|1946338_1946554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081516.1|1946650_1947772_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_036771628.1|1949563_1950685_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_155066936.1|1951296_1951647_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081492.1|1951678_1952068_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080019.1|1951994_1952180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080452.1|1952427_1952841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|1952824_1953211_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080451.1|1956155_1956719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079612.1|1956832_1958062_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080450.1|1958158_1958413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080372.1|1958512_1959742_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080449.1|1959907_1960168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067446.1|1960956_1961340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080448.1|1961355_1962246_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_155079439.1|1962269_1963156_-|transposase	IS630 family transposase	transposase	A0A2P0VP61	Tetraselmis_virus	28.8	1.7e-09
>prophage 25
NZ_CP039227	Piscirickettsia salmonis strain SR1 chromosome, complete genome	3562064	1966367	2004573	3562064	tRNA,transposase	Leptospira_phage(25.0%)	47	NA	NA
WP_155079478.1|1966367_1966925_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1966908_1967295_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080447.1|1967313_1967670_-	DUF4131 domain-containing protein	NA	NA	NA	NA	NA
WP_155080446.1|1967687_1968224_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_155067454.1|1968265_1968451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080445.1|1968680_1969586_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155079612.1|1969858_1971088_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080444.1|1971968_1973450_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	32.9	8.4e-70
WP_155079959.1|1973492_1973843_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	38.2	7.6e-14
WP_155079958.1|1973839_1974148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080443.1|1974992_1976042_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080442.1|1976766_1977894_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080441.1|1978074_1978923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080440.1|1979193_1979592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080439.1|1979814_1981128_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	1.0e-50
WP_155080438.1|1981361_1982507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080437.1|1982581_1982758_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_155080436.1|1982793_1983426_-	NAAT family transporter	NA	NA	NA	NA	NA
WP_155080435.1|1983537_1984266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080434.1|1984254_1986540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067468.1|1986713_1986860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080433.1|1986910_1987381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080432.1|1987546_1987828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080431.1|1987915_1988299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080430.1|1988443_1988962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080429.1|1989096_1989243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079612.1|1989559_1990789_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155079653.1|1991048_1991519_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079588.1|1991582_1991948_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066610.1|1991893_1992469_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|1992548_1992935_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080428.1|1993117_1993390_-	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	53.4	2.5e-12
WP_155067266.1|1993501_1993849_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_155067265.1|1993866_1994646_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_017377443.1|1994645_1995155_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_016211283.1|1995190_1995439_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_155067264.1|1995750_1996086_+	DUF3470 domain-containing protein	NA	NA	NA	NA	NA
WP_155067263.1|1996377_1997628_+	MFS transporter	NA	NA	NA	NA	NA
WP_155080427.1|1997710_1999738_-	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_155067259.1|2000285_2000504_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_155067258.1|2000674_2001055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080426.1|2001360_2001675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081514.1|2002116_2002278_+	phosphatase	NA	NA	NA	NA	NA
WP_155080425.1|2002522_2003408_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080424.1|2003405_2003744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081465.1|2003738_2004191_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|2004222_2004573_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP039227	Piscirickettsia salmonis strain SR1 chromosome, complete genome	3562064	2022566	2254558	3562064	tRNA,integrase,protease,transposase	unidentified_phage(15.38%)	229	2097188:2097247	2129332:2130291
WP_155081513.1|2022566_2023046_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080412.1|2024139_2024433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080411.1|2024641_2025175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080410.1|2026527_2027334_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	29.3	3.3e-12
WP_155080409.1|2027491_2027731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080408.1|2027844_2029074_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080402.1|2029218_2030193_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.2	2.6e-27
WP_155080407.1|2030353_2031169_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080406.1|2031364_2031625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080405.1|2031621_2031738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|2031738_2032296_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2032279_2032666_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080404.1|2032681_2032930_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	37.3	5.8e-08
WP_155080403.1|2032972_2034070_+|transposase	IS66 family transposase	transposase	S5VLC8	Leptospira_phage	38.1	4.9e-51
WP_155589573.1|2034195_2035170_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.0	1.7e-26
WP_155079476.1|2035239_2035626_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2035609_2036167_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080401.1|2036272_2036749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|2036749_2037307_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2037290_2037677_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080400.1|2037692_2038460_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080399.1|2038656_2038962_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080398.1|2039224_2039458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067241.1|2040191_2040950_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_155085161.1|2040946_2043346_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	1.0e-69
WP_155080396.1|2043359_2044637_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	32.9	3.4e-51
WP_155067239.1|2044725_2046024_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	33.8	3.2e-65
WP_155067238.1|2046221_2047115_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_155080395.1|2047114_2048329_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_155067236.1|2048348_2049635_-	GTPase HflX	NA	NA	NA	NA	NA
WP_026063533.1|2049650_2049905_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_155080394.1|2050130_2051498_-	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_155080393.1|2051828_2052851_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_155067233.1|2052943_2053138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080392.1|2053373_2054849_+	amino acid permease	NA	NA	NA	NA	NA
WP_155080391.1|2055059_2055518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080390.1|2055698_2056577_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081465.1|2056757_2057210_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080389.1|2057577_2057880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080388.1|2058070_2059633_+	peptide-binding protein	NA	NA	NA	NA	NA
WP_155589574.1|2059710_2059917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155589575.1|2060124_2060448_+	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_155079826.1|2060509_2061395_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2061427_2061814_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079612.1|2062113_2063343_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080385.1|2063488_2063887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|2063963_2064314_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080338.1|2064691_2064979_+|transposase	transposase	transposase	A9YX41	Burkholderia_phage	38.3	2.2e-06
WP_155068622.1|2065127_2065580_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|2065611_2065962_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080384.1|2066029_2066764_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.4	1.3e-44
WP_155079487.1|2067105_2068155_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080699.1|2068231_2068486_+	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_155080700.1|2068764_2069028_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_155080701.1|2069334_2071929_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	1.8e-88
WP_155080702.1|2071925_2072408_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_122941088.1|2072385_2073426_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	5.8e-118
WP_155080703.1|2073597_2074083_-	nicotinamide-nucleotide amidohydrolase family protein	NA	B5TK85	Pseudomonas_phage	55.6	8.9e-37
WP_155067220.1|2074190_2076761_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.8	3.5e-31
WP_155080704.1|2076833_2077295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067218.1|2077453_2077609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080705.1|2077622_2078093_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	47.5	5.8e-33
WP_155080706.1|2078318_2078480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|2078583_2079558_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155079868.1|2080149_2081305_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_155080443.1|2081840_2082890_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067214.1|2083341_2084826_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_155080707.1|2084950_2086486_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_155080708.1|2086508_2086949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080709.1|2086965_2087826_-	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_155080710.1|2088291_2088477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155589576.1|2089066_2089738_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.8	7.8e-07
WP_155067210.1|2089765_2089987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081534.1|2089979_2090963_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	2.8e-53
WP_155067209.1|2091058_2091985_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155080712.1|2092151_2093834_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.7	6.5e-26
WP_155080713.1|2093841_2094870_-	YHYH protein	NA	NA	NA	NA	NA
WP_155080714.1|2095038_2095737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079826.1|2095758_2096644_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080715.1|2096798_2096996_+	hypothetical protein	NA	NA	NA	NA	NA
2097188:2097247	attL	TATAGCTAACCCGGAAGAGTCTTAATTAATGCGTCAGTAATTGCGTTGCAAAGATGCTCA	NA	NA	NA	NA
WP_155079478.1|2097192_2097750_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2097733_2098120_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080716.1|2098187_2099369_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080717.1|2099552_2100869_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080718.1|2101608_2101893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079826.1|2102255_2103141_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079478.1|2103201_2103759_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080557.1|2103742_2104081_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080719.1|2104180_2104660_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0N7C035	Escherichia_phage	33.1	1.2e-12
WP_155080720.1|2104695_2105670_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.7e-29
WP_155080721.1|2105706_2105946_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_155066936.1|2106000_2106351_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|2106382_2106835_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080722.1|2107556_2109032_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_155080723.1|2109038_2109245_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_155080724.1|2109302_2110373_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155080725.1|2110570_2112541_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.2	5.5e-77
WP_155080726.1|2112893_2114453_+	amino acid permease	NA	NA	NA	NA	NA
WP_155080727.1|2114750_2115017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080728.1|2115368_2115659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080729.1|2116178_2116838_+	response regulator	NA	NA	NA	NA	NA
WP_155081535.1|2116933_2118295_+	histidine kinase	NA	NA	NA	NA	NA
WP_155066936.1|2119620_2119971_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|2120002_2120455_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080730.1|2120459_2120819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080731.1|2120861_2121080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080732.1|2121233_2121617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080733.1|2121943_2122300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079958.1|2122429_2122738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079959.1|2122734_2123085_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	38.2	7.6e-14
WP_155589577.1|2123127_2124690_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	32.5	2.6e-69
WP_155080735.1|2124888_2125554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080736.1|2125619_2126207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080737.1|2127878_2128232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|2128458_2128845_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2128828_2129386_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066918.1|2129506_2130334_+|transposase	transposase	transposase	NA	NA	NA	NA
2129332:2130291	attR	TGAGCATCTTTGCAACGCAATTACTGACGCATTAATTAAGACTCTTCCGGGTTAGCTATACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCGTTGGTTAAAAATTAAGGCTGATGTTCGTGAGTATGAGGGACTTGATGATGGAGTTTTAGCCTTAGATGATATGATTGCTGAAAAACCCTACAGCGATGAAAATGATATTATCGCCTGGCATTATGACCATAGTAAAGGTCGAACAGTGAAGGGCATTAATATCTTGACAGCGATGGTGCGCTACGGAGACGTACGCTTGCCTATCGCTTATGAAGTGATAGAGAAAACCATTCGTTATAGTGACCTTCAAACCAAAAAAGAACGAAGAAAGTCTTCTTTTACAAAAAATGACCTTTTTCTAAAACTTCTGAATGTCGCTATTCGTAACGACTTAAAGTTTGCATATGTGCTTGCAGATCGCTGGTTTAGCAGTCAATCAAATATGAGCTATATCCACAATGTTGGAAAGAAATTTATCATGGGAATCAAAAGTAATCGATGTGTCGCACTGACTGAAAAAGATAAAGAGAATGGTAAGTATCAACAACTAAAGCAAATATCATTAGAAGACGGCATTCCTCAGACTGTGTACTTAAAAGGTATGGCTTTCAAAGTACAGGTTATGAAAAAAACATTCAAAAACGAAAATGGTAAGGAAAGTGTCTTATATCTAGTAACTAATGACTTGAGTATTGATGGCCAACCCATCCTGGATACCTATAAAAAACGCTGGAGTATTGAGGAATTTCACAAGTCAGTAAAACAAAATTCGAGCTTTGAAAAGTCGCCTACGCGGATTGTCACATCTCAGTTGAACCATATTTATTACAGTATTCTTGGGTTTTGCAGATTGGAAAGATTAAAATTGAAAAAATCTTTAAACCATTTTGCAATAAAATATAAGCTGATATTAAG	NA	NA	NA	NA
WP_155079476.1|2130548_2130935_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2130918_2131476_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155589578.1|2131456_2131684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067185.1|2131964_2132318_+	ArsC family reductase	NA	NA	NA	NA	NA
WP_155081536.1|2132310_2133456_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_155080739.1|2133864_2135112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067183.1|2135397_2135781_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_155081537.1|2135777_2136509_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_155067182.1|2136511_2137255_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_155081538.1|2137268_2138168_-	GTPase Era	NA	NA	NA	NA	NA
WP_155067181.1|2138173_2138848_-	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	34.1	1.5e-26
WP_155080740.1|2138962_2139754_-	signal peptidase I	NA	NA	NA	NA	NA
WP_155067179.1|2139820_2140762_-	signal peptidase I	NA	NA	NA	NA	NA
WP_155067178.1|2140758_2142561_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	5.1e-21
WP_155068681.1|2142861_2143431_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_155067177.1|2143585_2145160_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_155589579.1|2145167_2145602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209486.1|2145606_2145858_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_155080742.1|2145899_2146937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067174.1|2147083_2147410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067173.1|2147566_2147977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066278.1|2148032_2149082_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080743.1|2149266_2149584_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
WP_155080744.1|2150283_2150643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080745.1|2150594_2151260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080746.1|2152188_2153907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|2153903_2154290_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2154273_2154831_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080747.1|2155609_2156242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080309.1|2156234_2157281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080748.1|2157709_2158705_+	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_155081539.1|2159031_2159205_+	phosphatase	NA	NA	NA	NA	NA
WP_155080749.1|2160897_2161851_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155080750.1|2161873_2163892_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_155080751.1|2163980_2164304_-	YqcC family protein	NA	NA	NA	NA	NA
WP_155080752.1|2165647_2165887_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016209463.1|2166155_2166539_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_155068680.1|2166895_2167369_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_155080753.1|2167486_2168857_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_155080754.1|2168972_2169704_+	hypothetical protein	NA	M1IDP9	Pelagibacter_phage	35.0	3.4e-08
WP_155080755.1|2169728_2170826_-	alanine racemase	NA	NA	NA	NA	NA
WP_155068679.1|2170858_2172280_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	62.1	1.3e-152
WP_155067160.1|2172489_2172942_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_016209480.1|2172953_2173181_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_027242778.1|2173230_2173557_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_155080756.1|2174396_2175005_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155067154.1|2175153_2175642_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_155080757.1|2175682_2176786_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_155080758.1|2176828_2177911_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.4	3.5e-73
WP_155067151.1|2177900_2178467_-	shikimate kinase	NA	NA	NA	NA	NA
WP_155067150.1|2178457_2179762_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_155080759.1|2179815_2180844_-	chorismate mutase	NA	NA	NA	NA	NA
WP_155079826.1|2180951_2181837_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079826.1|2182449_2183336_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155589580.1|2183397_2183796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080760.1|2183964_2184120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080761.1|2184229_2186302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079612.1|2186525_2187755_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080762.1|2187819_2188464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|2188618_2189005_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2188988_2189546_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079741.1|2190688_2191663_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.0e-27
WP_155080716.1|2191715_2192897_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155085150.1|2193229_2193604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|2193626_2194013_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2193996_2194554_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080764.1|2194685_2195129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080765.1|2195507_2195702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080766.1|2195906_2196263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300641.1|2196319_2196685_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079868.1|2197101_2198257_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_155080767.1|2198214_2199813_-	dolichyl-phosphate-mannose-protein mannosyltransferase	NA	NA	NA	NA	NA
WP_155080768.1|2200107_2200863_+	zinc transporter	NA	NA	NA	NA	NA
WP_155080769.1|2201516_2202670_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.0	3.4e-58
WP_155067135.1|2202924_2203596_-	AT hook motif family protein	NA	NA	NA	NA	NA
WP_155079487.1|2205076_2206126_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080161.1|2206375_2206591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300641.1|2206647_2207013_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080770.1|2207263_2210665_-	AAA family ATPase	NA	S5M596	Bacillus_phage	23.1	1.0e-09
WP_155067131.1|2210661_2213355_-	DNA repair protein	NA	NA	NA	NA	NA
WP_155080771.1|2213658_2215131_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	27.8	2.4e-32
WP_155080772.1|2215790_2216612_-	DUF1338 family protein	NA	NA	NA	NA	NA
WP_155080773.1|2216683_2218216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080774.1|2218485_2220660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067125.1|2220682_2221363_-	glycosyl transferase family 2	NA	NA	NA	NA	NA
WP_155080775.1|2221679_2223668_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155067123.1|2223682_2224024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067122.1|2224028_2224466_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_155080776.1|2224491_2225877_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_155080777.1|2225996_2226428_-	flaG family protein	NA	NA	NA	NA	NA
WP_155067119.1|2226533_2228111_-	B-type flagellin	NA	NA	NA	NA	NA
WP_155589581.1|2228088_2228391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080778.1|2228335_2229928_-	B-type flagellin	NA	NA	NA	NA	NA
WP_155080779.1|2230128_2232330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080780.1|2232423_2233857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080781.1|2233899_2234415_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155080782.1|2234414_2235362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080783.1|2235345_2236020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080784.1|2236007_2236736_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155067107.1|2236725_2237472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080785.1|2237455_2238520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067105.1|2238724_2239921_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_155067104.1|2239971_2241093_-	moeZ/MoeB domain protein	NA	A0A1V0SIK8	Klosneuvirus	27.8	3.0e-11
WP_155080786.1|2241612_2243361_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155067102.1|2243412_2244672_-	threonine synthase	NA	NA	NA	NA	NA
WP_155068677.1|2244658_2245627_-	homoserine kinase	NA	NA	NA	NA	NA
WP_155081540.1|2245640_2248109_-	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_155080787.1|2248530_2249052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079868.1|2249008_2250165_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_155080788.1|2250701_2251415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080789.1|2253327_2253519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080790.1|2253583_2254558_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.0e-27
>prophage 27
NZ_CP039227	Piscirickettsia salmonis strain SR1 chromosome, complete genome	3562064	2274582	2322469	3562064	tRNA,protease,transposase	unidentified_phage(50.0%)	39	NA	NA
WP_155081541.1|2274582_2274999_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080806.1|2275838_2277209_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_155080807.1|2277824_2278016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079975.1|2279324_2279900_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079974.1|2279845_2280211_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080808.1|2280355_2280790_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080809.1|2281095_2281674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080810.1|2282867_2283137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080811.1|2283164_2284318_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	6.8e-59
WP_155080812.1|2285091_2286480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068675.1|2286647_2286941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067075.1|2287016_2287400_-	histidine phosphotransferase	NA	NA	NA	NA	NA
WP_032126790.1|2289677_2290583_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155080813.1|2290633_2291164_-	exsB family protein	NA	NA	NA	NA	NA
WP_155080814.1|2291174_2292227_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_155080815.1|2292242_2294282_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	41.2	7.1e-128
WP_155080816.1|2294268_2295099_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_155080817.1|2295166_2298706_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_155079445.1|2299051_2300026_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155080818.1|2303804_2303954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080819.1|2304154_2305438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080820.1|2305864_2307493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080821.1|2307874_2308729_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080822.1|2308747_2308969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|2309030_2309381_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081541.1|2309448_2309865_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067991.1|2309877_2310294_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080823.1|2310968_2312447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080824.1|2312884_2314201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|2314279_2314666_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2314649_2315207_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080825.1|2315273_2315969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079741.1|2316011_2316986_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.0e-27
WP_155080826.1|2317073_2317511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080608.1|2317447_2317585_+	phosphatase	NA	NA	NA	NA	NA
WP_155080827.1|2319310_2321020_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_155067055.1|2321192_2321555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081465.1|2321634_2322087_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|2322118_2322469_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP039227	Piscirickettsia salmonis strain SR1 chromosome, complete genome	3562064	2337007	2389675	3562064	tRNA,protease,transposase	unidentified_phage(21.43%)	53	NA	NA
WP_155067038.1|2337007_2338429_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_155080832.1|2338518_2340117_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_155067036.1|2340273_2340900_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_155080833.1|2340981_2343654_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_155080834.1|2344137_2345094_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_016209435.1|2345194_2345566_+	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.1e-05
WP_155067033.1|2345591_2346455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080835.1|2346444_2347233_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_155067031.1|2347520_2348006_-	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_017375750.1|2348082_2348604_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_155080836.1|2348649_2349543_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_027242840.1|2349539_2350361_-	ParA family protein	NA	H7BUL8	unidentified_phage	33.0	3.9e-16
WP_016209408.1|2350673_2350844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067028.1|2350996_2352400_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_155080837.1|2352509_2353817_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_155080838.1|2353840_2354815_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.7	2.6e-27
WP_155080839.1|2354874_2355576_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_155067025.1|2355587_2356865_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	4.8e-21
WP_017376087.1|2356964_2357339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080840.1|2357423_2358311_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080841.1|2358367_2359096_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_155081542.1|2359092_2360202_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_155067022.1|2360353_2360782_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	4.0e-17
WP_155067021.1|2360877_2361237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080842.1|2361226_2362438_-	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X7C038	Faustovirus	31.1	6.1e-34
WP_155067019.1|2362434_2363223_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_122940639.1|2363385_2364180_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_155080843.1|2364655_2365396_-	outer membrane lipocarrier LolA family protein	NA	NA	NA	NA	NA
WP_155080844.1|2365399_2367931_-	cell division protein FtsK	NA	A0A218M9A2	Mycobacterium_phage	43.1	2.2e-86
WP_155080845.1|2368198_2369155_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.3	3.5e-61
WP_155081543.1|2369138_2369894_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_016211259.1|2369983_2370229_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_155067011.1|2370288_2372562_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	2.3e-167
WP_122940630.1|2372616_2372970_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	6.7e-10
WP_016211261.1|2373159_2373453_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_155589583.1|2373623_2373803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068670.1|2373878_2374454_-	DedA family protein	NA	NA	NA	NA	NA
WP_155080846.1|2374736_2376053_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211263.1|2376063_2376432_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_155067009.1|2376462_2377125_-	adenylate kinase	NA	NA	NA	NA	NA
WP_155079476.1|2377260_2377647_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2377630_2378188_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080847.1|2378352_2379072_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.8	1.1e-19
WP_155080848.1|2379051_2379870_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_155081544.1|2379882_2382060_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_155067006.1|2382163_2383513_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	26.9	1.3e-32
WP_155080849.1|2383586_2384276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080850.1|2384408_2385596_+	MFS transporter	NA	NA	NA	NA	NA
WP_155080851.1|2385826_2387005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080852.1|2387274_2387619_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2387599_2388157_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2388140_2388527_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079445.1|2388700_2389675_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
>prophage 29
NZ_CP039227	Piscirickettsia salmonis strain SR1 chromosome, complete genome	3562064	2404407	2444832	3562064	tRNA,transposase	unidentified_phage(25.0%)	44	NA	NA
WP_155080857.1|2404407_2405382_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	3.4e-27
WP_155080858.1|2405964_2407692_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_155066993.1|2407681_2408890_+	MFS transporter	NA	NA	NA	NA	NA
WP_155080859.1|2408978_2409980_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_155080860.1|2410208_2411420_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_155080861.1|2411731_2412361_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_155080862.1|2412409_2413426_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	53.9	1.6e-99
WP_016211035.1|2413673_2413889_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_155066988.1|2413941_2414391_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	5.4e-20
WP_155080863.1|2414470_2416216_+	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	36.7	3.8e-45
WP_155080864.1|2416307_2418179_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	31.1	7.2e-34
WP_155080102.1|2418367_2418820_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_155589585.1|2419478_2420519_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300641.1|2420968_2421334_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079413.1|2421891_2423061_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080866.1|2424892_2426007_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.4	2.0e-44
WP_155080867.1|2426353_2426617_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080868.1|2426658_2427018_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080869.1|2427721_2428291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122942521.1|2428283_2428580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080870.1|2428576_2429185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080871.1|2429458_2429659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081546.1|2429670_2430006_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_016211873.1|2429999_2430257_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155067063.1|2430516_2431467_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2431482_2431869_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2431852_2432410_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080174.1|2432538_2433081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080872.1|2433612_2434098_-	RepB family plasmid replication initiator protein	NA	NA	NA	NA	NA
WP_155589586.1|2434198_2435351_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	6.8e-59
WP_155080873.1|2435360_2435618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080874.1|2435843_2436665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080875.1|2437052_2437328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079826.1|2438201_2439087_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080876.1|2439047_2439626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|2439728_2440079_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081465.1|2440110_2440563_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080877.1|2440557_2441136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079906.1|2441183_2441456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080878.1|2441433_2441577_+	phosphatase	NA	NA	NA	NA	NA
WP_155079741.1|2442236_2443211_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.0e-27
WP_155079971.1|2443555_2443726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|2443652_2444003_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080879.1|2444064_2444832_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP039227	Piscirickettsia salmonis strain SR1 chromosome, complete genome	3562064	2453451	2503801	3562064	transposase	Acinetobacter_phage(25.0%)	52	NA	NA
WP_155080885.1|2453451_2454045_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080886.1|2454327_2454792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079868.1|2455013_2456170_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_155080887.1|2456412_2456715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080888.1|2457124_2457451_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|2457482_2457935_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066610.1|2458388_2458964_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079588.1|2458909_2459275_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080889.1|2459662_2460268_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2460227_2460614_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2460597_2461155_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2461161_2461548_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080890.1|2461667_2462306_+	queuosine precursor transporter	NA	NA	NA	NA	NA
WP_155080891.1|2462330_2462897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080892.1|2462905_2464138_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_155066960.1|2464225_2465662_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155066956.1|2465886_2467134_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_036773927.1|2467569_2468205_-	peroxiredoxin C	NA	NA	NA	NA	NA
WP_155080893.1|2468757_2470260_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_155080894.1|2470246_2474083_+	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_155080895.1|2474231_2475410_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	31.9	1.2e-50
WP_016210416.1|2475482_2476013_-	prokaryotic cytochrome b561 family protein	NA	NA	NA	NA	NA
WP_155079476.1|2476289_2476676_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080896.1|2476737_2476980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080897.1|2477160_2477361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081465.1|2477369_2477822_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|2477853_2478204_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080898.1|2478728_2479250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079487.1|2479636_2480686_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080899.1|2480700_2481021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066949.1|2481651_2482788_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_155080900.1|2482806_2484762_-	HAD-IC family P-type ATPase	NA	M1HK51	Paramecium_bursaria_Chlorella_virus	29.4	2.7e-55
WP_155079476.1|2484777_2485164_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2485147_2485705_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066948.1|2486664_2487840_-	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_155080901.1|2488177_2489434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080902.1|2489511_2490753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080903.1|2490849_2491347_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066610.1|2491292_2491868_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080904.1|2491871_2492594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080905.1|2492974_2493949_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.0e-27
WP_155080906.1|2493972_2494470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080907.1|2494650_2495130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080908.1|2495400_2495736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080909.1|2495811_2496279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080910.1|2496254_2496431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068662.1|2497115_2497184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079627.1|2497339_2498377_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080912.1|2498657_2500100_-	MFS transporter	NA	NA	NA	NA	NA
WP_155068661.1|2500613_2502035_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_155080913.1|2502521_2502968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080914.1|2503144_2503801_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP039227	Piscirickettsia salmonis strain SR1 chromosome, complete genome	3562064	2525844	2568666	3562064	protease,transposase	unidentified_phage(16.67%)	42	NA	NA
WP_155080927.1|2525844_2526585_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	35.1	4.2e-22
WP_155589588.1|2526758_2527703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080929.1|2529584_2530463_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300641.1|2530484_2530850_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080930.1|2530906_2531221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080931.1|2531401_2531659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080932.1|2531837_2532323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080933.1|2532434_2533949_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_155080934.1|2534075_2535104_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_155081551.1|2535160_2536303_+	galactokinase	NA	NA	NA	NA	NA
WP_155080935.1|2536436_2538140_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	25.0	1.3e-21
WP_155080936.1|2538136_2540257_+	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.0	2.0e-16
WP_155080937.1|2540253_2541603_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_155080938.1|2541574_2543722_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.2	2.4e-25
WP_155080939.1|2544126_2544279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080940.1|2544309_2544852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080941.1|2544827_2544974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079887.1|2544948_2545491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066469.1|2545576_2545849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|2546191_2546542_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|2546573_2547026_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080942.1|2547221_2547617_+	CrcB family protein	NA	NA	NA	NA	NA
WP_155080943.1|2547625_2548510_-	lipid A biosynthesis acyltransferase	NA	A0A1W6JP29	Morganella_phage	36.0	2.2e-41
WP_155080944.1|2548542_2550441_-	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_016209655.1|2550523_2550796_-	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_155066897.1|2550899_2553332_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	1.6e-219
WP_016209663.1|2553399_2554701_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
WP_016209647.1|2554782_2555388_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_155066896.1|2555500_2556805_-	trigger factor	NA	NA	NA	NA	NA
WP_155080945.1|2557406_2558282_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.4	6.8e-35
WP_155080946.1|2558396_2558897_-	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_155066936.1|2558978_2559329_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|2559360_2559813_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081552.1|2559807_2560020_-	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_155080947.1|2560073_2560232_+	phosphatase	NA	NA	NA	NA	NA
WP_155080948.1|2560450_2561806_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_155080949.1|2561926_2562664_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_155080950.1|2562741_2563455_-	aldolase	NA	NA	NA	NA	NA
WP_155080951.1|2564106_2565381_+	MFS transporter	NA	NA	NA	NA	NA
WP_155080952.1|2565411_2565987_+	bleomycin resistance protein	NA	NA	NA	NA	NA
WP_155080953.1|2566032_2566998_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	37.8	1.1e-43
WP_155079445.1|2567691_2568666_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
>prophage 32
NZ_CP039227	Piscirickettsia salmonis strain SR1 chromosome, complete genome	3562064	2594753	2625136	3562064	tRNA,transposase	Burkholderia_phage(20.0%)	35	NA	NA
WP_155079478.1|2594753_2595311_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155589589.1|2595307_2595919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|2595878_2596265_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2596248_2596806_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2596986_2597373_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2597356_2597914_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080967.1|2597910_2598309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080968.1|2598657_2598954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080969.1|2599193_2599406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080161.1|2599326_2599542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067835.1|2599598_2599766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080970.1|2599690_2599981_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066863.1|2600197_2600653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080971.1|2600727_2601639_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079826.1|2601674_2602560_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080205.1|2602589_2602736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210741.1|2602830_2603154_+	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_155066862.1|2603160_2607057_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	2.0e-118
WP_155589590.1|2607102_2607657_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_155080973.1|2607697_2609278_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	26.8	8.8e-17
WP_155066859.1|2609346_2610804_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.3	6.5e-99
WP_155081556.1|2611248_2613207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066857.1|2613525_2614146_-	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_155080974.1|2614312_2614537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080975.1|2615094_2615343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080976.1|2615263_2616070_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.0	3.1e-10
WP_155079487.1|2616589_2617639_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080977.1|2618069_2619119_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068734.1|2619189_2619759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080978.1|2619989_2620394_+	SufE family protein	NA	NA	NA	NA	NA
WP_017377024.1|2620406_2620547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929560.1|2620641_2621841_+	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.2	2.7e-42
WP_155080979.1|2621861_2622473_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_155080980.1|2622674_2623436_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155079612.1|2623906_2625136_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 33
NZ_CP039227	Piscirickettsia salmonis strain SR1 chromosome, complete genome	3562064	2633977	2744200	3562064	tRNA,integrase,transposase	unidentified_phage(21.74%)	113	2694180:2694239	2731399:2732504
WP_155079461.1|2633977_2634952_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	7.5e-27
WP_155081560.1|2635082_2636177_-	FUSC family protein	NA	NA	NA	NA	NA
WP_155067817.1|2636301_2637618_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.6	9.4e-65
WP_155080988.1|2637672_2642559_-	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_155081561.1|2642651_2642954_-	DUF2835 family protein	NA	NA	NA	NA	NA
WP_155067819.1|2643064_2644987_+	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_155067820.1|2645008_2646304_+	DUF444 family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_155080989.1|2646300_2647923_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_155080990.1|2648029_2648296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067925.1|2648395_2649091_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.9	5.5e-40
WP_155081562.1|2649244_2649943_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_155080991.1|2650089_2650659_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_155080992.1|2650942_2651569_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_155079974.1|2652308_2652674_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079975.1|2652619_2653195_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080993.1|2653269_2654145_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155080994.1|2654233_2654947_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.8	7.9e-42
WP_155080995.1|2654943_2655210_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081563.1|2655244_2655505_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080996.1|2655527_2655830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068097.1|2655756_2656107_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155067839.1|2657663_2658503_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	34.9	1.8e-32
WP_016210463.1|2658553_2658901_-	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_155080997.1|2659091_2659979_+	ROK family protein	NA	NA	NA	NA	NA
WP_155080998.1|2660093_2660696_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_155080999.1|2660692_2661412_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_080963631.1|2661480_2663193_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_155079478.1|2664639_2665197_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2665180_2665567_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081564.1|2666256_2667306_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_155067844.1|2667305_2667581_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_155081000.1|2668639_2671231_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_155066936.1|2671554_2671905_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081465.1|2671936_2672389_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081002.1|2672671_2673214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079888.1|2673189_2673336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080210.1|2673310_2673631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081003.1|2673709_2673853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079826.1|2673922_2674808_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081005.1|2676028_2677054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081006.1|2677309_2677579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081007.1|2677853_2678777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067849.1|2678790_2679714_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_155081008.1|2679661_2680279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|2681792_2682350_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2682333_2682720_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081009.1|2682752_2682896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081010.1|2684501_2685329_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_155081011.1|2685480_2685852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068743.1|2686080_2687577_+	nuclease	NA	NA	NA	NA	NA
WP_155081012.1|2687639_2688977_-	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_155081013.1|2689119_2690586_-	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_155081014.1|2690582_2691632_-	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_155080516.1|2693582_2693747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081015.1|2694030_2694219_+	hypothetical protein	NA	NA	NA	NA	NA
2694180:2694239	attL	CGCCCTCCGTCATATGAAGTGCAACACCACTCTACACTAAGCCGCCATTAAATTCTCTAA	NA	NA	NA	NA
WP_155079445.1|2694215_2695190_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155080465.1|2695296_2695617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|2695907_2696294_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2696277_2696835_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081016.1|2696875_2697052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210305.1|2697181_2697586_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210308.1|2697646_2698372_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_155081017.1|2698457_2699351_+	YicC family protein	NA	NA	NA	NA	NA
WP_155067858.1|2699391_2700012_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	35.1	4.8e-19
WP_016210310.1|2700072_2700279_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_155081018.1|2700300_2702445_+	RelA/SpoT family protein	NA	A0A2I2L310	Orpheovirus	37.1	1.0e-12
WP_155081019.1|2702462_2702600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079741.1|2702856_2703831_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.0e-27
WP_155081020.1|2703907_2704111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081021.1|2705191_2705551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080546.1|2705632_2706361_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155081022.1|2706403_2706679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081023.1|2706987_2708229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|2709443_2710001_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2709984_2710371_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2711155_2711713_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2711696_2712083_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081024.1|2712554_2713478_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.9	2.2e-23
WP_155081025.1|2713678_2713864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081026.1|2713947_2714760_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2714756_2715143_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2715126_2715684_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081027.1|2715691_2716069_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_155081565.1|2716200_2716683_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081533.1|2717096_2717549_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080581.1|2717580_2717835_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080582.1|2717856_2718063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080172.1|2718355_2719330_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.0	8.9e-28
WP_155067098.1|2719388_2719709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066610.1|2719654_2720230_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067869.1|2720726_2721746_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_017376520.1|2721732_2722155_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_155067870.1|2722156_2722630_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	8.1e-27
WP_155081028.1|2722737_2723361_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	45.1	1.0e-40
WP_155081029.1|2723391_2724066_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	2.3e-30
WP_155067873.1|2724071_2725220_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	6.8e-43
WP_155067874.1|2725216_2725678_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_155081030.1|2725775_2727026_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A219Y950	Aeromonas_phage	54.4	4.1e-102
WP_155081031.1|2727152_2728832_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.5	1.3e-37
WP_155081032.1|2728942_2729824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081033.1|2730016_2730337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081034.1|2730364_2731108_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155079445.1|2731434_2732409_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155081035.1|2732503_2733214_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
2731399:2732504	attR	CGCCCTCCGTCATATGAAGTGCAACACCACTCTACACTAAGCCGCCATTAAATTCTCTAAAAAAACATGATTAGGTGCGCGATAATCTAAACTCGCCCTTCTTCTCGCATTCAATGTATGCTCTATTTTTGCTATTTTAGCATCACTTATTTCATTAAAGTCTGTTCCTTTAGGAAGAAAACGCCTAATCAAACCATTCGTGTGCTCATTTAGGCCTCTGTCGCAAGAGCGATAAGGTCTAGCAAAGTAGAAATCAGCATCAGTAATCTTTGAAATATCCTCATGACCAGCGAATTCTGTCCCGTTATCTGAGGTAATCGTTTTAAAGTCAAAGAAAGTTGAGGCGACTATACTTCTGAAGGTCTCAACAACGGTTTCTGCACATTTGTTAGCCATTTTCCTTATACAACACATCTTATTGGCTTTATCAACAAGGGTTAACAAGTAAGATTTGTGATCTCGACCTACTATGGTATCAATTTCAAAATGTCCAAATTCAGTCTTTTCGTCAGCAATAGCGGGCCTTTGTTCAATACCAACGCGGTTCGGTATTTTAGTTTTATCACCACTTTTCACCTTCTTCTTATAAGGTTTTCCAGAGTGGGGCAGGCTTTTGTAAAGCTCTCCTCCTTTCTCTCGATCCTCATGAATATAACGGTAGATGGTGCTCTCACTCACTTGGATATTATGCTCCTGTATAAGCTCTTTACTAATAACATCGGGTGACGTATGGGTGCTTAACCGCTCATGAATTAATACTTTTGCTTTCTCTGAAATTTTCTGAAAATCCTGCCCTTGCTTAGCATTAGACCGTTTTTCTTGCGCACAACGCGAGGCCAAGCGATGGCAATAAAGACCGTTAAAATCGCTTGGGGTATGCCGTTTAGTCTCACGACTGACTGTGCTAGGAGCAAAGCCAAGTGCTCTAGCAATTGATCTCATGGAGTCCCCTTCTGATAAACGTTGTTCGATATAAAAACGATCTTTTTCATTTAAGTGCCGATAAGCCATTTGTACCCTCTAAGTCAAAAAGGCGAACTAGAGAGTTTATCTTTATGGGAGTGAACTCTCTACTGGGTGTTGCACTTCATATGACGGAGGGCGTA	NA	NA	NA	NA
WP_155081036.1|2733849_2734161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081037.1|2734140_2734539_-	VOC family protein	NA	NA	NA	NA	NA
WP_155067882.1|2734715_2735021_-	competence protein ComEA	NA	NA	NA	NA	NA
WP_155067883.1|2735098_2735353_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_155081038.1|2735505_2737167_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_155067885.1|2737227_2737911_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_155067886.1|2737910_2738999_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.6	9.8e-76
WP_155081039.1|2739037_2741674_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.5	3.4e-98
WP_155081040.1|2743314_2744200_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 34
NZ_CP039227	Piscirickettsia salmonis strain SR1 chromosome, complete genome	3562064	2749388	2797869	3562064	tRNA,integrase,transposase	Halovirus(16.67%)	53	2795506:2795565	2796512:2796904
WP_155066936.1|2749388_2749739_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|2749770_2750223_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067895.1|2750272_2750617_-	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_155079476.1|2751929_2752316_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2752299_2752857_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081046.1|2753430_2754462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067902.1|2754662_2754929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067903.1|2754985_2755333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067904.1|2755367_2756030_-	PAS fold family protein	NA	NA	NA	NA	NA
WP_155081566.1|2756073_2756676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941797.1|2756905_2757961_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.7	2.0e-49
WP_155067906.1|2757964_2761150_+	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_155081047.1|2761227_2762184_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.9	1.4e-49
WP_155081048.1|2762232_2762769_+	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_155067909.1|2762765_2763527_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_155081049.1|2763629_2766218_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	37.2	8.8e-123
WP_155081567.1|2766934_2767585_-	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_155081050.1|2767936_2768812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155067916.1|2769047_2769449_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_155081051.1|2769465_2770014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|2770165_2770552_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2770535_2771093_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081052.1|2771283_2771661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068622.1|2772363_2772816_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|2772847_2773198_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079478.1|2773400_2773958_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2773941_2774328_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081053.1|2774324_2774960_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_155081054.1|2775213_2775405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081055.1|2775405_2777616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080005.1|2777723_2778610_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2779665_2780052_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081056.1|2780035_2780593_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081568.1|2780595_2780856_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|2780850_2781303_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|2781334_2781685_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081057.1|2783110_2783584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081058.1|2784116_2785064_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081059.1|2785244_2785634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081060.1|2785819_2787112_-	MFS transporter	NA	NA	NA	NA	NA
WP_155081061.1|2787438_2789502_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.2	5.5e-35
WP_155081062.1|2789504_2790152_+	RnfABCDGE type electron transport complex subunit B	NA	NA	NA	NA	NA
WP_017376743.1|2790167_2790800_+	endonuclease III	NA	NA	NA	NA	NA
WP_155067929.1|2790868_2791306_+	DUF1841 family protein	NA	NA	NA	NA	NA
WP_155079889.1|2791547_2792090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079888.1|2792065_2792212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081063.1|2792186_2792729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081569.1|2793129_2793285_+	phosphatase	NA	NA	NA	NA	NA
WP_155079445.1|2793653_2794628_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155085113.1|2794708_2795500_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
2795506:2795565	attL	TACAAGTGATAAGTGGAATCTTCTGTTAAATTAGCTTAGACAGGAGAGAGAAGATGAAAC	NA	NA	NA	NA
WP_155067931.1|2795558_2795825_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081064.1|2795899_2796511_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	42.3	1.1e-36
WP_155081065.1|2797680_2797869_+|transposase	transposase	transposase	NA	NA	NA	NA
2796512:2796904	attR	TACAAGTGATAAGTGGAATCTTCTGTTAAATTAGCTTAGACAGGAGAGAGAAGATGAAACGATCAAAACTAACAGAATCACAAATTGTAGCCATGCTTAATGAAGGCCAAGCGGGTATTAAAGTTGAAGATATTTGTCGCCAGTATGGTATTGCTAAAAGCAGCTACTACAAACTCAGGTCCAAGTATCAAGGCATGGGCGTTTCAGATCTACAGCGTTTAAAAGAGCTTGAAGACGAAAACCGTCGTTTGAAACAGATGTACGCAGACATTAGCCTAGAGCACAAAGTGCTCAAGGATATTGTTGAAAAAAAGCTATAACCGCAGCGAGTCGGCGTCACTTAGTTGATTATGCTGTCAAAGCTCATGCATTGAGCGGGAATAAAGCATGCAA	NA	NA	NA	NA
>prophage 35
NZ_CP039227	Piscirickettsia salmonis strain SR1 chromosome, complete genome	3562064	2810550	2852742	3562064	tRNA,transposase	Planktothrix_phage(25.0%)	36	NA	NA
WP_155079741.1|2810550_2811525_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.0e-27
WP_155067948.1|2811721_2812501_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_155081073.1|2817990_2818191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081074.1|2818416_2819334_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066800.1|2819678_2820365_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066799.1|2820429_2821716_-	na+ dependent nucleoside transporter family protein	NA	NA	NA	NA	NA
WP_155066739.1|2821872_2822223_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|2822254_2822707_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_017376633.1|2822940_2823210_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_155081075.1|2823394_2824372_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.0	1.7e-15
WP_155066797.1|2824432_2825407_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.8	3.3e-14
WP_155066796.1|2825506_2826583_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_155081076.1|2826663_2827650_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_155066795.1|2827660_2829463_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_155066794.1|2829477_2830779_-	aspartate kinase	NA	NA	NA	NA	NA
WP_155066793.1|2830794_2832078_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_155081077.1|2832210_2832600_+	RidA family protein	NA	NA	NA	NA	NA
WP_155081078.1|2832704_2833886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066790.1|2834074_2835091_-	bifunctional UDP-4-keto-pentose/UDP-xylose synthase	NA	D5GW02	Campylobacter_virus	26.1	3.2e-12
WP_155066789.1|2835093_2836101_-	glycosyltransferase	NA	B9UDL7	Salmonella_phage	34.2	1.1e-36
WP_155081570.1|2836104_2837259_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A2K9L0G1	Tupanvirus	32.1	8.6e-38
WP_016209558.1|2837273_2837636_-	small Multidrug Resistance family protein	NA	NA	NA	NA	NA
WP_155081079.1|2837632_2839348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081080.1|2839411_2840122_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_017376619.1|2840150_2840555_+	RidA family protein	NA	NA	NA	NA	NA
WP_155081571.1|2841959_2843141_-	MFS transporter	NA	NA	NA	NA	NA
WP_155080465.1|2843202_2843523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|2843541_2844099_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2844082_2844469_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080667.1|2844487_2844640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|2844701_2845088_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081081.1|2845825_2846836_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	41.6	6.6e-58
WP_155079612.1|2847864_2849094_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081082.1|2849290_2849584_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080320.1|2849649_2850705_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079868.1|2851586_2852742_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
>prophage 36
NZ_CP039227	Piscirickettsia salmonis strain SR1 chromosome, complete genome	3562064	2868165	2924588	3562064	transposase	Bacillus_virus(14.29%)	52	NA	NA
WP_155081058.1|2868165_2869113_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081092.1|2869293_2869683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081093.1|2870334_2870664_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_155081575.1|2870897_2871602_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_155081094.1|2871582_2873811_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.2	3.4e-83
WP_155066766.1|2873975_2874989_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_155066765.1|2875096_2875318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066764.1|2875322_2876960_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	4.4e-88
WP_155066763.1|2877098_2877632_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_155081095.1|2877752_2878871_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_155081096.1|2878863_2880186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066756.1|2880172_2881309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066755.1|2881539_2881965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080389.1|2884250_2884553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068622.1|2884920_2885373_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066753.1|2885677_2886031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068648.1|2886094_2886499_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155081097.1|2886646_2887822_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_155081576.1|2888370_2888874_-	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	32.8	6.2e-09
WP_155081098.1|2888913_2890398_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	2.5e-45
WP_155066747.1|2890620_2891574_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	3.8e-31
WP_155066746.1|2891554_2892646_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_155081099.1|2892733_2892976_-	response regulator SirA	NA	NA	NA	NA	NA
WP_155068647.1|2893592_2893931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081100.1|2893927_2894503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081101.1|2895075_2895348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068646.1|2895501_2895756_-	DUF493 family protein	NA	NA	NA	NA	NA
WP_155081102.1|2895870_2897274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081103.1|2897401_2897626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081577.1|2897690_2898191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081104.1|2898756_2900574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081105.1|2900643_2901693_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081106.1|2901779_2902382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064006185.1|2903933_2904650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081107.1|2905383_2905623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066739.1|2905549_2905900_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081108.1|2907262_2907871_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_155081109.1|2909038_2911027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081110.1|2912296_2913100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081111.1|2913268_2914708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066278.1|2915054_2916104_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081112.1|2916604_2917570_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_155066693.1|2917523_2918219_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	3.5e-10
WP_155079476.1|2918827_2919214_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2919197_2919755_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081113.1|2919813_2920188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066695.1|2920281_2920839_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155079815.1|2921566_2922541_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.2	4.0e-28
WP_155081114.1|2922587_2922866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081115.1|2923164_2923386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081116.1|2923414_2923555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066278.1|2923538_2924588_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 37
NZ_CP039227	Piscirickettsia salmonis strain SR1 chromosome, complete genome	3562064	2930258	3039640	3562064	transposase	unidentified_phage(35.71%)	118	NA	NA
WP_155079741.1|2930258_2931233_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.0e-27
WP_155081122.1|2931327_2931642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|2932024_2932411_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2932394_2932952_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081123.1|2933629_2934061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081124.1|2934138_2934423_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_155081125.1|2934455_2935505_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068639.1|2938521_2938923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066706.1|2938915_2939929_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.4e-15
WP_155066707.1|2939915_2940704_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_155081126.1|2940897_2941869_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_155081127.1|2941881_2942349_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_155066936.1|2942613_2942964_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081465.1|2942995_2943448_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081128.1|2943627_2944998_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.8	2.9e-109
WP_155081129.1|2945301_2945772_+	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	37.3	1.6e-22
WP_155079490.1|2945987_2946962_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.5	2.3e-28
WP_155081578.1|2947748_2948699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081130.1|2948973_2951139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081131.1|2951586_2952561_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.0	8.9e-28
WP_155081132.1|2952606_2952801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079974.1|2953313_2953679_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080686.1|2953624_2954200_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080208.1|2954686_2955052_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081133.1|2955108_2955348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079826.1|2955409_2956295_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081134.1|2956307_2956622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080716.1|2956709_2957891_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081137.1|2958076_2958226_+	phosphatase	NA	NA	NA	NA	NA
WP_155085104.1|2959327_2960557_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081139.1|2961145_2963833_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_155066714.1|2963937_2964363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066716.1|2965007_2965847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081140.1|2965849_2967043_+	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_155081141.1|2967048_2968029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081142.1|2968044_2969082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081143.1|2969096_2969519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066721.1|2969571_2970075_+	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_155066722.1|2970067_2970814_+	type IV secretion system protein DotC	NA	NA	NA	NA	NA
WP_155066723.1|2970806_2971913_+	ATPase	NA	NA	NA	NA	NA
WP_027242627.1|2971933_2972173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081579.1|2972201_2974505_+	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_155081144.1|2974513_2974987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066725.1|2974995_2976039_+	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_027242623.1|2976038_2976620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081145.1|2976651_2977077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081146.1|2977079_2980088_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_155081147.1|2980089_2980911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081148.1|2980950_2984166_+	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_155081149.1|2984210_2984717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242618.1|2985036_2985687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209685.1|2985688_2986024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081150.1|2986028_2986439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081580.1|2986429_2987383_+	PAP2 family protein	NA	NA	NA	NA	NA
WP_155066732.1|2987452_2987680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081151.1|2987828_2989244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081152.1|2989490_2990075_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.8	3.4e-35
WP_155081153.1|2990261_2990627_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|2990642_2991029_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2991012_2991570_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080338.1|2991605_2991893_-|transposase	transposase	transposase	A9YX41	Burkholderia_phage	38.3	2.2e-06
WP_155081154.1|2992023_2992743_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_155080205.1|2994304_2994451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081155.1|2994565_2994934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081156.1|2995078_2995774_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081157.1|2995766_2996926_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	6.8e-59
WP_155079476.1|2996921_2997308_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|2997291_2997849_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155067468.1|2997961_2998108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081158.1|2998104_2998302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081159.1|2998611_2999283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081160.1|2999902_3000307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|3000383_3001358_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155081161.1|3001381_3001597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080323.1|3001710_3002610_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	2.1e-23
WP_155081162.1|3003194_3004688_-	amino acid permease	NA	NA	NA	NA	NA
WP_155081163.1|3005138_3006530_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_155081164.1|3006958_3007153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081165.1|3007195_3007591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068622.1|3007595_3008048_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|3008079_3008430_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079644.1|3008570_3009161_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155066687.1|3009395_3009824_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_155589591.1|3010879_3011419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081166.1|3011615_3012008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|3012033_3012591_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|3012574_3012961_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081167.1|3012990_3013212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081168.1|3013839_3014481_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_155589592.1|3015098_3016550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|3016636_3017023_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|3017006_3017564_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081170.1|3017544_3017763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155589593.1|3017816_3017963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|3018091_3018442_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|3018473_3018926_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155589594.1|3018930_3019572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081171.1|3020094_3020955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079868.1|3020882_3022039_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_155081172.1|3022102_3022558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080029.1|3022873_3024001_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081173.1|3024459_3024705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081174.1|3024849_3025020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081175.1|3025095_3026550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081176.1|3027290_3027989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081177.1|3028081_3028318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081178.1|3028517_3029543_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	78.8	2.3e-18
WP_155081179.1|3029650_3030856_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	6.4e-36
WP_155079487.1|3031062_3032112_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155068622.1|3032163_3032616_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|3032647_3032998_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081180.1|3033177_3033591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081181.1|3033719_3034289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081182.1|3034292_3034625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081183.1|3034728_3035061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081184.1|3035053_3035707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081185.1|3036345_3037791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081186.1|3038410_3039640_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 38
NZ_CP039227	Piscirickettsia salmonis strain SR1 chromosome, complete genome	3562064	3060799	3106210	3562064	tRNA,transposase	Acinetobacter_phage(23.08%)	61	NA	NA
WP_155081198.1|3060799_3061093_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	39.6	2.6e-07
WP_155081199.1|3061209_3061656_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	2.0e-22
WP_155066936.1|3061721_3062072_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081582.1|3062103_3062571_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079487.1|3062554_3063604_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081200.1|3063690_3064017_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	49.5	6.6e-20
WP_155081201.1|3064324_3064621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068636.1|3065196_3065745_-	DUF2058 family protein	NA	NA	NA	NA	NA
WP_155081583.1|3065848_3066421_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_155081202.1|3066629_3067388_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_155081203.1|3067947_3068793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079612.1|3068867_3070097_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081204.1|3070346_3071114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081205.1|3071258_3071531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081206.1|3071741_3073319_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_155068634.1|3073452_3074394_+	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_155081207.1|3074395_3075169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081208.1|3075210_3075921_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_155081209.1|3076133_3076337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081210.1|3076605_3076890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081211.1|3076831_3077656_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081212.1|3077764_3078121_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079445.1|3078106_3079081_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155081213.1|3079180_3079897_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	33.2	2.6e-24
WP_155081214.1|3079941_3080238_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	38.5	4.5e-07
WP_155081215.1|3080206_3080401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066611.1|3080663_3081194_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_155068600.1|3081409_3081634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081465.1|3081826_3082279_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|3082310_3082661_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081216.1|3082715_3082922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067835.1|3082978_3083146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068622.1|3083178_3083631_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|3083662_3084013_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155080636.1|3084074_3084260_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211707.1|3084383_3084671_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_155081217.1|3084676_3087058_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378383.1|3087070_3088066_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	36.5	3.2e-33
WP_155081218.1|3088197_3088557_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016210493.1|3088599_3088794_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_075273353.1|3088828_3089359_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_155081219.1|3089363_3091295_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.3	7.5e-119
WP_155081220.1|3091702_3092437_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081221.1|3092510_3093110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081222.1|3093187_3094168_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	2.6e-27
WP_155081223.1|3094191_3094674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081224.1|3094853_3095531_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081225.1|3095538_3095841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081226.1|3095964_3096750_+	hypothetical protein	NA	A0A1V0SBR2	Catovirus	28.3	1.1e-07
WP_155079478.1|3097774_3098332_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|3098315_3098702_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079612.1|3098998_3100228_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|3100844_3101231_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079476.1|3101259_3101646_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|3101629_3102187_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080171.1|3102330_3102906_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080011.1|3102851_3103019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081227.1|3103398_3103539_+	phosphatase	NA	NA	NA	NA	NA
WP_155081228.1|3103814_3104783_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081229.1|3104903_3105401_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081230.1|3105709_3106210_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 39
NZ_CP039227	Piscirickettsia salmonis strain SR1 chromosome, complete genome	3562064	3181284	3215277	3562064	transposase	unidentified_phage(50.0%)	31	NA	NA
WP_155079487.1|3181284_3182334_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081269.1|3182384_3185054_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	23.9	7.9e-18
WP_155081270.1|3185353_3186499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081271.1|3186659_3187202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081586.1|3187385_3187610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080161.1|3187766_3187982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300641.1|3188038_3188404_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081272.1|3189133_3190375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085077.1|3190920_3191709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080029.1|3191905_3193033_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081274.1|3193225_3193417_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079445.1|3193476_3194451_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155589597.1|3194530_3194830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066610.1|3194775_3195351_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081276.1|3195383_3195554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081277.1|3195760_3197284_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155081278.1|3197420_3201905_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_155081279.1|3202633_3204211_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_155066543.1|3204438_3204807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066542.1|3205498_3206284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081280.1|3206587_3207532_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_155081281.1|3207550_3208735_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_155081282.1|3208850_3209684_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	29.7	3.5e-17
WP_155066936.1|3210008_3210359_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081465.1|3210390_3210843_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081283.1|3211246_3211447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081284.1|3211527_3212577_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081285.1|3212619_3212910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080172.1|3213221_3214196_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.0	8.9e-28
WP_155081286.1|3214192_3214681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|3214719_3215277_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 40
NZ_CP039227	Piscirickettsia salmonis strain SR1 chromosome, complete genome	3562064	3221621	3429655	3562064	tRNA,protease,transposase,tail	unidentified_phage(23.08%)	219	NA	NA
WP_155081293.1|3221621_3222575_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.8	6.7e-28
WP_155081294.1|3222591_3223080_-	amino acid permease	NA	NA	NA	NA	NA
WP_155066529.1|3223795_3224050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081295.1|3224773_3225970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079784.1|3226044_3226821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081296.1|3227001_3227385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080219.1|3227388_3228438_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081297.1|3228503_3228710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081298.1|3228965_3229673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|3229738_3230089_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081299.1|3230015_3230231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081300.1|3230847_3231606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|3231827_3232385_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|3232368_3232755_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081301.1|3232751_3232892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066521.1|3233008_3234307_+	MFS transporter	NA	NA	NA	NA	NA
WP_155081302.1|3234526_3235078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081303.1|3235058_3235364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068622.1|3235372_3235825_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|3235856_3236207_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081304.1|3236274_3236724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081305.1|3236757_3238056_+	MFS transporter	NA	NA	NA	NA	NA
WP_155081306.1|3238145_3239384_-	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_155066517.1|3239622_3239970_+	DUF4286 family protein	NA	NA	NA	NA	NA
WP_155066516.1|3239970_3241743_-	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1P8CX07	Bacillus_phage	25.6	2.1e-14
WP_155081307.1|3241732_3242707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066515.1|3243332_3244025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155589598.1|3244882_3245362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081309.1|3245377_3245602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|3245891_3246866_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155589599.1|3247235_3248429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081310.1|3248789_3249608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081311.1|3249642_3251070_-	amino acid permease	NA	NA	NA	NA	NA
WP_155081589.1|3251779_3254149_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.2	2.4e-159
WP_016210132.1|3254224_3255043_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_155081312.1|3255505_3256282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079487.1|3256475_3257525_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081313.1|3257521_3257710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081531.1|3257706_3257931_-	hypothetical protein	NA	A0A2P0VP61	Tetraselmis_virus	45.8	8.3e-06
WP_155080161.1|3258087_3258303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300641.1|3258359_3258725_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081314.1|3258786_3259554_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081315.1|3259774_3260089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081316.1|3260475_3261363_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_155081590.1|3261519_3262992_-	sodium/solute symporter	NA	A0A219Y9P9	Aeromonas_phage	23.9	3.9e-19
WP_155081317.1|3263090_3263972_-	ROK family protein	NA	NA	NA	NA	NA
WP_155081318.1|3263968_3264691_-	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_155081319.1|3265165_3266077_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.5	6.6e-25
WP_155079784.1|3266350_3267127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081296.1|3267307_3267691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080219.1|3267694_3268744_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081320.1|3268809_3269016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081321.1|3269339_3269729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|3269655_3270006_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081322.1|3270304_3271096_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376546.1|3271273_3271570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081323.1|3271613_3271901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081324.1|3271930_3272710_-	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
WP_155081591.1|3272735_3273041_-	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_155081325.1|3273037_3274003_-	DNA polymerase III subunit delta'	NA	S5WKH4	Pseudomonas_phage	33.1	9.5e-14
WP_016210864.1|3274256_3275555_+	MFS transporter	NA	NA	NA	NA	NA
WP_155081326.1|3276006_3276867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081327.1|3277011_3277248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081328.1|3277569_3278772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081329.1|3279295_3280939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211029.1|3281015_3281378_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	7.6e-25
WP_155081330.1|3281591_3282023_+	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_016211034.1|3282034_3282214_-	rubredoxin	NA	NA	NA	NA	NA
WP_155081331.1|3283110_3283443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081332.1|3283623_3284913_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_155068622.1|3285112_3285565_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080389.1|3285932_3286235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081333.1|3287163_3287436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|3287479_3287866_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066936.1|3287937_3288288_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081465.1|3288319_3288772_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080275.1|3288819_3289323_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080879.1|3289319_3290087_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081334.1|3291373_3291727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081592.1|3292003_3292780_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_155081335.1|3292788_3294840_+	protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	3.9e-17
WP_155081336.1|3294873_3295173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079620.1|3295217_3296192_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155081337.1|3296188_3296914_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_155081338.1|3297013_3297421_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155081339.1|3297448_3297979_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_155081340.1|3298181_3298415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081341.1|3298622_3298898_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081593.1|3299928_3302106_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.7	3.5e-141
WP_016211609.1|3302138_3302447_-	double zinc ribbon family protein	NA	NA	NA	NA	NA
WP_155589600.1|3303461_3303911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081343.1|3304085_3304430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068097.1|3304767_3305118_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081491.1|3305149_3305602_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081594.1|3305759_3306242_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081345.1|3306256_3306820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066464.1|3306902_3307634_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_155068620.1|3307630_3308167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066463.1|3308220_3308985_-	TatD family deoxyribonuclease	NA	NA	NA	NA	NA
WP_155081346.1|3308988_3310566_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_155066461.1|3310572_3311049_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_155068619.1|3311024_3311429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066460.1|3311461_3312217_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016210632.1|3312391_3312679_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_155081347.1|3313100_3313313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081348.1|3313329_3314298_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081349.1|3315224_3316388_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081350.1|3316422_3317400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066456.1|3317393_3318080_-	HAD-IIIA family hydrolase	NA	NA	NA	NA	NA
WP_155066455.1|3318018_3319134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|3319398_3320373_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_155081351.1|3320824_3321796_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081352.1|3321940_3322147_-	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	71.1	5.7e-09
WP_155081353.1|3322062_3322347_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_155081354.1|3322648_3322966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066454.1|3323140_3323413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066453.1|3323668_3324196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081103.1|3324307_3324532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155589601.1|3324940_3326158_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_155081356.1|3326390_3326828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155589607.1|3327485_3328892_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_155081358.1|3329155_3330880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081359.1|3330881_3331088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081107.1|3332262_3332502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066739.1|3332428_3332779_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081360.1|3332833_3333859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081361.1|3334480_3336448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066438.1|3336545_3337655_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.1	1.0e-35
WP_155081362.1|3337710_3339192_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	27.6	3.7e-49
WP_155066436.1|3339619_3340066_+	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_016211800.1|3340379_3341165_-	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_155081363.1|3341161_3342145_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_155081364.1|3342201_3343473_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_155081365.1|3348848_3349454_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_155081595.1|3349516_3350878_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_155066432.1|3351151_3352432_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_155081366.1|3352449_3353106_+	DedA family protein	NA	NA	NA	NA	NA
WP_155081367.1|3353858_3354143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081368.1|3354618_3355473_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_155081369.1|3355771_3356584_+	trfA family protein	NA	NA	NA	NA	NA
WP_016210080.1|3356690_3356984_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_155067136.1|3357104_3357455_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081370.1|3357381_3357807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079593.1|3357822_3358029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|3358059_3358617_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|3358600_3358987_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081371.1|3359562_3360417_-	D-methionine-binding lipoprotein metQ	NA	NA	NA	NA	NA
WP_017377631.1|3360406_3361084_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_155081372.1|3361052_3362108_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.7	5.1e-29
WP_155081373.1|3362429_3363860_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_155081374.1|3363846_3364473_-	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_155081375.1|3364478_3364751_-	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_155081376.1|3364837_3366631_-	M24 family metallopeptidase	NA	A0A0P0I8D7	Acinetobacter_phage	40.9	7.7e-118
WP_155081596.1|3366956_3368519_+	amino acid permease	NA	NA	NA	NA	NA
WP_155066421.1|3368620_3369319_+	response regulator	NA	NA	NA	NA	NA
WP_155066420.1|3369486_3369984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080716.1|3371768_3372950_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081377.1|3374406_3375801_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_155081378.1|3375842_3377129_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_155081379.1|3377175_3378720_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.2	2.5e-64
WP_016209851.1|3378842_3379085_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_155081380.1|3379077_3380064_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_155081381.1|3380125_3381031_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_155081382.1|3381030_3382377_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_155081383.1|3382470_3382935_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_155081597.1|3382999_3383455_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_016209850.1|3383680_3383971_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_155081384.1|3384043_3385705_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.5	3.5e-181
WP_155081385.1|3385868_3386090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081386.1|3387292_3387478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|3387539_3387890_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081387.1|3387816_3388263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|3388259_3388646_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|3388629_3389187_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066936.1|3389411_3389762_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081465.1|3389793_3390246_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081391.1|3391552_3392527_-	phospholipase	NA	NA	NA	NA	NA
WP_155068614.1|3392671_3394093_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.1	1.4e-45
WP_155081392.1|3394262_3396179_-	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_155081393.1|3396202_3398872_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_016209869.1|3399138_3400482_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_155069770.1|3400691_3402674_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	41.1	1.8e-115
WP_155066407.1|3402751_3403378_-	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_155066406.1|3403355_3403613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081394.1|3403667_3404111_+	CRS1 / YhbY domain protein	NA	NA	NA	NA	NA
WP_155081395.1|3404355_3405405_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079476.1|3405472_3405859_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|3405842_3406400_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081396.1|3406380_3406797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081397.1|3406902_3407130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155589602.1|3407186_3407435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155589603.1|3407579_3407840_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079815.1|3408034_3409009_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.2	4.0e-28
WP_155589604.1|3409032_3409350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066610.1|3409295_3409871_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081399.1|3409860_3410091_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_155079478.1|3410246_3410804_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081400.1|3410787_3411174_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155085165.1|3411329_3412217_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081402.1|3412467_3412659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|3412691_3413078_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|3413061_3413619_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081403.1|3413896_3415129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081404.1|3415304_3415466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066278.1|3415519_3416569_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081405.1|3417062_3417224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081406.1|3417265_3418663_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9KZD3	Tupanvirus	36.2	1.3e-77
WP_155068509.1|3418783_3419731_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_155068510.1|3419727_3420243_-	signal peptidase, peptidase S26 family protein	NA	NA	NA	NA	NA
WP_155068511.1|3420229_3421429_-	conjugal transfer protein TrbL	NA	NA	NA	NA	NA
WP_155081407.1|3421425_3421755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068792.1|3421756_3422986_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_155068513.1|3422985_3424029_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_155081408.1|3424028_3424724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081409.1|3424708_3427198_-	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_017377396.1|3427214_3427469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209715.1|3427469_3427826_-	trbC/VIRB2 family protein	NA	NA	NA	NA	NA
WP_155046733.1|3428582_3428720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155067541.1|3428656_3429655_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 41
NZ_CP039227	Piscirickettsia salmonis strain SR1 chromosome, complete genome	3562064	3451920	3504132	3562064	tRNA,transposase	Acinetobacter_phage(20.0%)	52	NA	NA
WP_155079478.1|3451920_3452478_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|3452461_3452848_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081419.1|3452863_3453598_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_054300641.1|3453849_3454215_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081420.1|3454271_3454472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|3454477_3455035_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|3455018_3455405_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081421.1|3455472_3455919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068015.1|3455927_3457081_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	3.4e-58
WP_017378398.1|3457657_3458056_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_017378399.1|3458921_3459872_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_155081422.1|3459871_3461950_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_155081423.1|3462097_3462613_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_155081424.1|3462621_3463185_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_155068540.1|3463165_3463912_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_155081425.1|3464050_3464503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081426.1|3464638_3465475_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_155068543.1|3465471_3466368_+	EamA family transporter	NA	NA	NA	NA	NA
WP_122941163.1|3466400_3467468_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_155068544.1|3467492_3467861_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_155081427.1|3467886_3469338_-	potassium transporter	NA	NA	NA	NA	NA
WP_155068546.1|3469344_3470724_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_155081598.1|3470764_3472078_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_155068548.1|3472067_3473042_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	2.2e-10
WP_155081599.1|3473135_3473639_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	1.4e-13
WP_155081428.1|3473773_3474925_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|3474921_3475401_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_155068550.1|3475547_3477869_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.5	6.7e-98
WP_155068551.1|3477813_3478440_+|tRNA	tRNA threonylcarbamoyladenosine biosynthesis protein RimN	tRNA	NA	NA	NA	NA
WP_155068552.1|3478444_3479344_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_155068793.1|3479440_3479995_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_155081429.1|3480277_3481402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081430.1|3481758_3482532_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155081431.1|3483986_3484277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|3484349_3484736_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080821.1|3484904_3485759_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155066610.1|3486548_3487124_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210338.1|3487158_3487296_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079445.1|3490058_3491033_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	4.4e-27
WP_032126718.1|3491316_3491697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081432.1|3491860_3492556_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_155081433.1|3492552_3493980_+	dihydrolipoamide dehydrogenase	NA	NA	NA	NA	NA
WP_155079826.1|3494061_3494948_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081434.1|3494908_3495499_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155068568.1|3495495_3496332_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_155068569.1|3496332_3496674_-	cytochrome C oxidase subunit IV	NA	NA	NA	NA	NA
WP_155081435.1|3496675_3497281_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_155068570.1|3497277_3499272_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_155068571.1|3499291_3500233_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_155081436.1|3500460_3501879_+	MFS transporter	NA	NA	NA	NA	NA
WP_155081437.1|3502033_3503185_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080005.1|3503246_3504132_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP039228	Piscirickettsia salmonis strain SR1 plasmid unnamed1, complete sequence	215583	1087	48885	215583	transposase,integrase	Indivirus(23.53%)	58	NA	NA
WP_155081606.1|1087_2125_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081607.1|2167_3109_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.1	2.4e-22
WP_155081608.1|3413_3932_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.4	1.4e-08
WP_155080208.1|3877_4243_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081609.1|4203_4389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081610.1|4412_4670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|4867_5425_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|5408_5795_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081611.1|6380_7610_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081611.1|8456_9686_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155589608.1|9785_10016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079478.1|10040_10598_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|10581_10968_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155589609.1|10986_11559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081615.1|11668_12046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081616.1|12556_12835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081617.1|12820_13795_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.6e-24
WP_155079826.1|14061_14947_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.4	9.0e-11
WP_155081618.1|15070_15499_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_155081619.1|15495_15795_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155081620.1|15837_16515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081621.1|16528_17569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155589610.1|18073_19429_-|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	37.4	8.9e-26
WP_155066936.1|19575_19926_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155068622.1|19957_20410_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.4	4.3e-09
WP_155079612.1|20490_21720_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081623.1|21856_22978_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081624.1|23135_23864_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.6	1.2e-37
WP_155081625.1|24230_25691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|25959_26934_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_155080257.1|26993_27173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081626.1|27937_28738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081627.1|28777_29308_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.6	1.6e-34
WP_155081628.1|29480_30164_+	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_155081629.1|30168_30738_+	recombinase family protein	NA	W6CWV1	Ralstonia_phage	36.4	8.6e-23
WP_155081630.1|30859_31762_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.5	7.2e-24
WP_155079476.1|31758_32145_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079476.1|32173_32560_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155589611.1|32621_32855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081686.1|32919_33498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085337.1|33549_34281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155589612.1|34423_34765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080275.1|34804_35308_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080216.1|35714_36797_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.7	3.8e-144
WP_155081632.1|38588_39059_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066936.1|39227_39578_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155080208.1|40000_40366_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155080171.1|40311_40887_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.2	1.6e-08
WP_155081633.1|41330_41510_+	hypothetical protein	NA	A0A0R6PJ17	Moraxella_phage	52.6	1.7e-09
WP_155081634.1|41511_41808_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_064006305.1|41804_42026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081635.1|42370_43669_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080267.1|43768_43924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081636.1|45015_45978_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_155081637.1|46001_46331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080442.1|46714_47842_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081638.1|47998_48229_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081639.1|48345_48885_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.7	4.5e-29
>prophage 2
NZ_CP039228	Piscirickettsia salmonis strain SR1 plasmid unnamed1, complete sequence	215583	52377	98744	215583	transposase,integrase	Acinetobacter_phage(20.0%)	55	58047:58106	85555:87087
WP_155081641.1|52377_53103_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.8	4.3e-11
WP_155079478.1|53373_53931_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|53914_54301_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079836.1|54922_55129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|55494_55881_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|55864_56422_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_047927838.1|56686_56932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081642.1|56928_57228_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_155081643.1|57337_58063_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.4	1.3e-44
58047:58106	attL	AGATTCAGGAATTTCAAAAAAATGATCCTGGCGGCAATGTTTAGGAGGATGTTAAATTCT	NA	NA	NA	NA
WP_155079612.1|58203_59433_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081644.1|59907_60882_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.3	1.1e-25
WP_155081645.1|60946_61333_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_155589613.1|61467_62166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081647.1|62755_62944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081648.1|63645_64353_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.0	3.0e-09
WP_155080068.1|65252_65735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080067.1|65893_66040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080066.1|66005_66590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122943230.1|68474_69410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080338.1|69780_70068_+|transposase	transposase	transposase	A9YX41	Burkholderia_phage	38.3	2.2e-06
WP_155079478.1|70092_70650_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|70633_71020_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081649.1|71073_71757_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.6	1.2e-42
WP_155080546.1|71786_72515_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155081650.1|72622_73510_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080557.1|73711_74050_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|74033_74591_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081651.1|74571_74808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081652.1|75198_77472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081653.1|77556_77913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081654.1|77950_78091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079868.1|78056_79212_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_155081655.1|79209_79347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081656.1|79406_79994_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.7	2.3e-31
WP_155081657.1|80118_80847_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.6	1.2e-37
WP_155081731.1|80981_81488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|81549_81900_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155081465.1|81931_82384_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.4	3.3e-09
WP_155066739.1|82536_82887_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155081107.1|82813_83053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081658.1|83617_84211_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.2	9.6e-09
WP_155081607.1|84170_85112_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.1	2.4e-22
WP_155081659.1|85154_85604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079612.1|85711_86941_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081660.1|87166_87979_+	AAA family ATPase	NA	Q7M293	Enterobacteria_phage	24.4	2.4e-10
85555:87087	attR	AGATTCAGGAATTTCAAAAAAATGATCCTGGCGGCAATGTTTAGGAGGATGTTAAATTCTGGTCAGTATTGCTGTGGCCATTACCGAATATAATGCCTGCAGGCGGTTTTTTAGGTGAAAATAGGCGAATTCTCTAATTTCTGGCGGAGTTATCCTACTAAAAGCCTCTAAATCGGCTGGTTGCTAGCTCTTCATAGTAACTGTACTTTTCCCTAAGAGTCAGACCAAATTGGGTGCTTATCCTTCTTAACTGACTGCCGCACAAGATGCATTTAAGAGGGTTGTAGTTGAAATTACTTTTCATCAGTGAAACAAACGTGACCTGGTTATATGCCTCAATAGTTTGCCCGACTAAATCATAAATTTTTGGTAGTATTATTGTCCGAGTGCGATAGCTTAGAAATCCATAGTAGCGGATCATTTTAAAGAACTTGTCCGGGATGTGTTGGGTAAGGCGATCAATAAAATCGTCGATACTCTGCTTTTTCATTTTCTGCTGTTTGGTTTTGTGATCCAGGTAACGAAAGATCACAACATTACCATCATAGTGCTCCATTCTGGCGTTGGCGAGAGCCGGGCGTTTAATGTAGCGGCCGAGGTAATCGACATTGTGCTGGTGATTTTCTTTGGGTTGAGCAAAGTGGACTTTCCAAAATTTCTGGTATTCACGATTTAAAAATCGATTGAAGGTTGTAAGGTCACTGATTTCACTCTGGTATTCATCAGGAATAGTCAACTCCCCAGCTTTGTAGGTTTGCCTAAGCAGGTTGGTGACGGCATAGCGCCACATTGGCATAATAACTTTGCGAGTAAAATAAATCTCACACCAAGAATCATTAGCTTCGTCATAACCTCCACGTGTGACGGAGATATGAACATGTACATTCCATTTCAGATCTCGACCAAATGTATGTAAAGCGGCGAAAATGCCAATGATAAGGCCTTTCTTCTTTGCGGTTTCTAGTAACGTATTGGCTGCAGTCCTAAAGATTATATTGAGTAATTCACGATTGAATAAGAAAAATGCCCAGAATTTTCTAGGCATAGTAAATGTGATGTGTTGCCATTTGCACTGTGGGAGAGTGGCGTTTTGCTCTTCGATCCATTGCTCTGTTGCTTTTTTTCCACAGGTTGAGCAAAAGCGGGACTTGCATGTGAAACAAACGACCTTGGTATGTTCGCAGTTTGGATTGGAACAACCGTAAACATCACACCCCATTAACTTGGTGCGACAACCGAGCACTTTGAGAACATTTTCATCAACGGCAGGTCGAATGGAATCAGCGTGTTTAGCGCGATAGTTCCACCAAGCACTTCGATATTGAAGTACGTGCTTCAGTGTGAATTGAATTTGATAGGTTTCATCTTTCTGCCGCTGGATCACCATTGAGAACAAATTACCATATTAAACAACGAATCAGGATAACAAGGTTAGATCAGATCTAACAAGACTAATGTGAGTTAATAAGCGGTAAAGTGACGGGTGTTAGCAGGGACATCCGAAAGTCGCGAGCTGTGCGAGCCTATTCTTGA	NA	NA	NA	NA
WP_155081661.1|87971_88916_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_155081662.1|89151_89799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155080444.1|90174_91656_-|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	37.0	6.7e-27
WP_155079959.1|91698_92049_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	39.2	4.5e-14
WP_155079958.1|92045_92354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081663.1|92427_93105_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.0	6.4e-09
WP_155081664.1|93909_94512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081665.1|94963_95833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081666.1|96222_97266_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080444.1|97262_98744_-|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	37.0	6.7e-27
>prophage 3
NZ_CP039228	Piscirickettsia salmonis strain SR1 plasmid unnamed1, complete sequence	215583	102644	195298	215583	capsid,tail,head,transposase,integrase	unidentified_phage(21.74%)	121	128625:128684	175127:176236
WP_155066936.1|102644_102995_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155079958.1|103255_103564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081670.1|103743_104043_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	38.6	1.8e-11
WP_155079476.1|104125_104512_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081671.1|104495_105041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155589614.1|105043_106630_+|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	36.6	1.0e-25
WP_155081673.1|107177_107873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081674.1|107893_108130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|108230_109205_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_155081675.1|109228_110233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|110298_110649_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155068622.1|110680_111133_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.4	4.3e-09
WP_155589615.1|111535_112402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081678.1|112981_113197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081679.1|113379_113691_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	2.5e-08
WP_155081680.1|113687_114011_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.0	6.0e-13
WP_155081681.1|114351_114612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|114635_115610_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_155081733.1|116180_116738_-	helix-turn-helix domain-containing protein	NA	A0A1S6L009	Salmonella_phage	56.2	5.1e-52
WP_155081682.1|116737_117055_-	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_155081683.1|117009_117270_-	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_155081684.1|117704_118025_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	40.4	5.9e-13
WP_155081685.1|118244_118469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081686.1|118625_119204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081687.1|119675_120275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081688.1|120349_120667_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081689.1|120970_121774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155589616.1|121763_121910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155589617.1|122054_122198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081690.1|122470_123040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122942947.1|123165_123444_+	peptidase	NA	A0A2L1IV28	Escherichia_phage	52.2	4.9e-24
WP_122942945.1|123454_123760_+	HigA family addiction module antidote protein	NA	A0A2I7RCV5	Vibrio_phage	39.7	1.1e-05
WP_155589618.1|123914_125009_-	hypothetical protein	NA	A0A2I7RG64	Vibrio_phage	32.5	1.7e-35
WP_155079478.1|125052_125610_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|125593_125980_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155589619.1|125976_126486_-	DEAD/DEAH box helicase	NA	A0A0K0MD54	Pseudoalteromonas_phage	38.4	3.9e-19
WP_155068933.1|126527_126881_-	hypothetical protein	NA	NA	NA	NA	NA
128625:128684	attL	CGCCCTCCGTCATATGAAGTGCAACACCCAGTAGAGAGTTCACTCCCATAAAGATAAACT	NA	NA	NA	NA
WP_155079741.1|128717_129692_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	2.4e-25
WP_155081692.1|130323_130896_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	45.6	4.0e-36
WP_155081693.1|131288_131429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155068941.1|131963_132419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081694.1|133167_133539_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_155079868.1|133546_134703_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_155081695.1|134820_135429_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.0	2.6e-09
WP_155079478.1|135409_135967_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|135950_136337_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079741.1|136500_137475_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	2.4e-25
WP_155081964.1|137904_138327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081931.1|138328_138652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081930.1|138708_138972_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_155081929.1|138975_141054_+|tail	phage tail tape measure protein	tail	A0A1J0GWA6	Alteromonas_phage	32.8	6.7e-57
WP_155081928.1|141046_141388_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_155066936.1|141991_142342_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155081465.1|142373_142826_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.4	3.3e-09
WP_155081926.1|142922_143687_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	41.1	1.7e-42
WP_155081925.1|143739_144552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066440.1|144867_145842_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	4.9e-26
WP_155081924.1|145902_146460_+|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	35.6	9.3e-22
WP_155081923.1|146456_149075_+	hypothetical protein	NA	A0A0R6PIC0	Moraxella_phage	32.8	1.2e-108
WP_155079478.1|149055_149613_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|149596_149983_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081921.1|150048_150702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081920.1|150701_151178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081918.1|151448_152129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081917.1|152138_152792_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_155081916.1|152791_153229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081963.1|153228_153657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081915.1|153850_154468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081914.1|154561_154792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081913.1|154859_155588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929651.1|155591_156644_-	ParA family protein	NA	NA	NA	NA	NA
WP_155081961.1|157454_158540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081960.1|158627_159878_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377663.1|160130_160460_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	44.9	6.1e-13
WP_017377662.1|160470_160785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081959.1|161105_161903_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155081958.1|161891_162932_-	alkene reductase	NA	NA	NA	NA	NA
WP_155080465.1|163027_163348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155589620.1|163366_163531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079612.1|163676_164906_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081956.1|165042_165474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081955.1|165503_165971_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081954.1|165970_166429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081953.1|166768_167071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081952.1|167148_167310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081951.1|167568_167736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081950.1|167843_168962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079476.1|168958_169345_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|169328_169886_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081949.1|170120_170459_+	hypothetical protein	NA	R9TNL4	Vibrio_phage	53.8	3.5e-24
WP_155081948.1|170451_170622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081450.1|170681_171656_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_155081947.1|171902_172133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081946.1|172136_172607_+	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	63.4	5.8e-33
WP_155081945.1|172755_173121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242932.1|173268_173496_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210974.1|173504_173912_+	DUF4411 family protein	NA	NA	NA	NA	NA
WP_155081944.1|173923_174709_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	41.8	4.5e-38
WP_155081943.1|174929_175160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079741.1|175219_176194_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	2.4e-25
WP_155081938.1|176231_177425_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
175127:176236	attR	CGCCCTCCGTCATATGAAGTGCAACACCCAGTAGAGAGTTCACTCCCATAAAGATAAACTCTCTAGTTCGCCTTTTTGACTTAGAGGGTACAAATGGCTTATCGGCACTTAAATGAAAAAGATCGTTTTTATATCGAACAACGTTTATCAGAAGGGGACTCCATGAGATCAATTGCTAGAGCACTTGGCTTTGCTCCTAGCACAGTCAGTCGTGAGACTAAACGGCATACCCCAAGCGATTTTAACGGTCTTTATTGCCATCGCTTGGCCTCGTGTTGTGCGCAAGAAAAACGGTCTAATGCTAAGCAAGGGCAGGATTTTCAGAAAATTTCAGAGAAAGCAAAAGTATTAATTCATGAGCGGTTAAGCACCCATACGTCACCCGATGTTATTAGTAAAGAGCTTATACAGGAGCATAATATCCAAGTGAGTGAGAGCACCATCTACCGTTATATTCATGAGGATCGAGAGAAAGGAGGAGAGCTTTACAAAAGCCTGCCCCACTCTGGAAAACCTTATAAGAAGAAGGTGAAAAGTGGTGATAAAACTAAAATACCGAACCGCGTTGGTATTGAACAAAGGCCCGCTATTGCTGACGAAAAGACTGAATTTGGACATTTTGAAATTGATACCATAGTAGGTCGAGATCACAAATCTTACTTGTTAACCCTTGTTGATAAAGCCAATAAGATGTGTTGTATAAGGAAAATGGCTAACAAATGTGCAGAAACCGTTGTTGAGACCTTCAGAAGTATAGTCGCCTCAACTTTCTTTGACTTTAAAACGATTACCTCAGATAACGGGACAGAATTCGCTGGTCATGAGGATATTTCAAAGATTACTGATGCTGATTTCTACTTTGCTAGACCTTATCGCTCTTGCGACAGAGGCCTAAATGAGCACACGAATGGTTTGATTAGGCGTTTTCTTCCTAAAGGAACAGACTTTAATGAAATAAGTGATGCTAAAATAGCAAAAATAGAGCATACATTGAATGCGAGAAGAAGGGCGAGTTTAGATTATCGCGCACCTAATCATGTTTTTTTAGAGAATTTAATGGCGGCTTAGTGTAGAGTGGTGTTGCACTTCATATGACGGAGGGCGAATTCA	NA	NA	NA	NA
WP_155081937.1|177570_178428_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	46.3	6.4e-62
WP_155081936.1|178582_179167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081935.1|179549_179966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081934.1|180154_180466_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	35.6	1.0e-09
WP_155081933.1|180462_180786_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	38.8	6.0e-13
WP_155081932.1|180778_181174_+	hypothetical protein	NA	Q7Y404	Yersinia_phage	38.4	3.7e-09
WP_155079445.1|181403_182378_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_155081710.1|182715_183696_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.2	1.7e-23
WP_155079476.1|183847_184234_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|184217_184775_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079612.1|184989_186219_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081711.1|186464_186665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081712.1|186770_188636_+	AAA family ATPase	NA	A0A2I7R5Z1	Vibrio_phage	30.7	8.7e-56
WP_155081713.1|189939_190668_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	6.0e-37
WP_032126138.1|191158_191422_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_155079445.1|191622_192597_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_155081714.1|192727_193393_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.3	9.0e-40
WP_155079445.1|193570_194545_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_155081715.1|194564_194963_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	32.3	1.1e-08
WP_155080338.1|195010_195298_-|transposase	transposase	transposase	A9YX41	Burkholderia_phage	38.3	2.2e-06
>prophage 1
NZ_CP039229	Piscirickettsia salmonis strain SR1 plasmid unnamed2, complete sequence	167241	1560	50364	167241	transposase	Streptococcus_phage(50.0%)	55	NA	NA
WP_155068622.1|1560_2013_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.4	4.3e-09
WP_155066936.1|2044_2395_-|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155085363.1|2480_3839_+	hypothetical protein	NA	A0A1X9I6W8	Streptococcus_phage	29.7	3.7e-40
WP_155081791.1|3835_4036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081790.1|4916_5345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081789.1|5475_6204_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.3	4.1e-09
WP_155079478.1|6184_6742_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|6725_7112_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081788.1|7404_8109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081787.1|8724_9420_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	47.2	5.2e-46
WP_155081786.1|9512_10217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080320.1|10290_11346_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079476.1|12654_13041_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081739.1|13153_13888_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	35.7	2.0e-27
WP_016211671.1|15084_15822_+	ParA family protein	NA	E5FFJ3	Burkholderia_phage	25.8	1.7e-10
WP_122942012.1|15814_16180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081783.1|16197_16392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081784.1|16520_17330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079612.1|17521_18751_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_080664873.1|19256_19571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081764.1|19942_21193_-	MFS transporter	NA	NA	NA	NA	NA
WP_155081763.1|21280_21529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081762.1|22876_23542_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.6	3.6e-36
WP_155081761.1|23968_25705_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	43.2	2.1e-24
WP_155081760.1|26220_27243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081759.1|27367_27538_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081739.1|27665_28400_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	35.7	2.0e-27
WP_155589621.1|28399_28573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081779.1|28919_30203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155589622.1|30592_31459_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081777.1|31570_31888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081739.1|31845_32580_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	35.7	2.0e-27
WP_017377658.1|32940_33627_+	Fic family protein	NA	NA	NA	NA	NA
WP_054300664.1|33630_34197_+	recombinase family protein	NA	I1ZBD6	Salisaeta_icosahedral_phage	35.0	1.4e-20
WP_155081832.1|34286_35645_+	DEAD/DEAH box helicase	NA	D2J050	Enterococcus_phage	50.5	1.4e-127
WP_155081776.1|35721_36378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081775.1|36377_37088_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	35.7	1.9e-27
WP_155081774.1|37894_38230_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_155081773.1|38266_38587_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	40.7	1.5e-11
WP_155081772.1|38725_39388_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_155081739.1|39968_40703_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	35.7	2.0e-27
WP_155081771.1|40775_41015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081770.1|42151_42505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211674.1|42706_42988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081769.1|42977_43256_+	antitoxin	NA	NA	NA	NA	NA
WP_155079478.1|44109_44667_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080557.1|44650_44989_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081739.1|45041_45776_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	35.7	2.0e-27
WP_155081758.1|45807_46827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081739.1|47070_47805_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	35.7	2.0e-27
WP_155079730.1|47944_48106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079731.1|48370_48619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155080256.1|48602_49160_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	23.2	7.9e-05
WP_155085373.1|49140_49575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081739.1|49629_50364_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	35.7	2.0e-27
>prophage 2
NZ_CP039229	Piscirickettsia salmonis strain SR1 plasmid unnamed2, complete sequence	167241	54569	108561	167241	transposase	Streptococcus_phage(30.43%)	55	NA	NA
WP_155080567.1|54569_55589_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155066610.1|55592_56168_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.2	1.6e-08
WP_155081755.1|56233_56401_+	phosphatase	NA	NA	NA	NA	NA
WP_155080251.1|57187_57334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081830.1|57500_57827_-	mRNA-degrading endonuclease	NA	A9D9Y1	Lactobacillus_prophage	36.6	1.9e-11
WP_122943070.1|57828_58071_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155066936.1|58473_58824_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155068622.1|58855_59308_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.4	4.3e-09
WP_155081754.1|59365_60097_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	31.1	1.0e-07
WP_155079476.1|60939_61326_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|61309_61867_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079612.1|62484_63714_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155079487.1|64185_65235_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079487.1|65505_66555_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081753.1|66627_67290_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	36.1	8.2e-25
WP_155081752.1|67941_69666_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_080664873.1|71365_71680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081751.1|71682_71883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081750.1|72003_72369_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	47.1	7.2e-23
WP_155081611.1|72574_73804_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081749.1|74040_75015_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	7.1e-25
WP_155081748.1|75011_75404_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.5	5.0e-14
WP_155081747.1|75766_76033_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079478.1|76080_76638_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|76621_77008_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081746.1|77155_77299_+	phosphatase	NA	NA	NA	NA	NA
WP_155080821.1|77802_78657_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.0	3.1e-08
WP_155081465.1|81907_82360_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.4	3.3e-09
WP_155066936.1|82391_82742_-|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155068802.1|83236_83617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126138.1|83864_84128_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_155081745.1|84447_85422_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	9.2e-25
WP_155081744.1|85498_86143_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.9	2.4e-37
WP_155081743.1|86189_86384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|87387_88362_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_155081701.1|88995_89685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036775032.1|89732_90548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081829.1|90769_91084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081742.1|91495_92230_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	35.7	1.5e-27
WP_155081741.1|92282_92705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155589623.1|92602_93982_+	hypothetical protein	NA	A0A1X9I6W8	Streptococcus_phage	30.0	1.7e-40
WP_155079476.1|93978_94365_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|94348_94906_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155589624.1|95938_96526_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	40.1	2.5e-25
WP_155081739.1|97718_98453_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	35.7	2.0e-27
WP_155081738.1|98465_98624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155589625.1|98741_99437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079612.1|99582_100812_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081828.1|100948_101125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148037451.1|101117_101318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155068622.1|102999_103452_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.4	4.3e-09
WP_155066936.1|103483_103834_-|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155081835.1|104394_104709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081827.1|105299_107486_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.9	4.6e-72
WP_155081739.1|107826_108561_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	35.7	2.0e-27
>prophage 3
NZ_CP039229	Piscirickettsia salmonis strain SR1 plasmid unnamed2, complete sequence	167241	112097	162375	167241	integrase,transposase	Indivirus(19.05%)	59	129375:129434	159485:160477
WP_155080821.1|112097_112953_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.0	3.1e-08
WP_155081824.1|113276_113459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081823.1|113587_114202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081739.1|114198_114933_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	35.7	2.0e-27
WP_155085386.1|115031_115262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085385.1|115211_115409_+	hypothetical protein	NA	A0A023NGQ0	Nitrincola_phage	42.9	6.6e-07
WP_155079476.1|115405_115792_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|115775_116333_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155085384.1|116355_116760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085383.1|116913_117204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085031.1|117200_117455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155589627.1|117984_118455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155589628.1|118578_118725_-	phosphatase	NA	NA	NA	NA	NA
WP_155079868.1|119182_120338_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.4	8.9e-51
WP_155589629.1|120266_120983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066936.1|121108_121459_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155081465.1|121490_121943_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.4	3.3e-09
WP_155080182.1|122142_122538_-|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	6.4e-09
WP_155085029.1|122909_123257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155085028.1|123261_123600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155589630.1|123853_124678_-	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_155081465.1|125272_125725_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.4	3.3e-09
WP_155066936.1|125756_126107_-|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155079826.1|127117_128003_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.4	9.0e-11
129375:129434	attL	AGATTCAGGAATTTCAAAAAAATGATCCTGGCGGCAATGTTTAGGAGGATGTTAAATTCT	NA	NA	NA	NA
WP_155079612.1|129531_130761_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081617.1|131305_132280_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.6e-24
WP_155589631.1|132572_132821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|132844_133819_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_155081822.1|135258_135708_+	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_155081821.1|135782_137012_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081820.1|137171_137471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081819.1|137486_138023_+	MFS transporter	NA	NA	NA	NA	NA
WP_155081818.1|138261_138474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081817.1|138526_138802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081816.1|139316_142661_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_155085388.1|142760_142964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081815.1|143014_144262_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_155081814.1|144870_145344_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	45.1	4.3e-28
WP_155081813.1|145293_145491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212298.1|146051_146378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081812.1|146977_147673_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	47.2	8.8e-46
WP_155081811.1|147898_148873_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	1.7e-23
WP_155081810.1|149079_149868_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_155081809.1|150205_150805_+	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_155081808.1|151378_151696_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_155081834.1|151673_151847_+	phosphatase	NA	NA	NA	NA	NA
WP_155080256.1|152249_152807_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	23.2	7.9e-05
WP_155079445.1|154301_155276_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_155081807.1|155460_155928_+	tryptophan-rich sensory protein	NA	A0A1V0S976	Catovirus	35.0	1.4e-07
WP_155081806.1|155937_156552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079996.1|156629_157043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081805.1|157626_157887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081804.1|157803_158457_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.6	2.1e-09
WP_155081803.1|158502_159387_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081802.1|159519_159810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081801.1|159900_160203_-	hypothetical protein	NA	A0A219YB42	Aeromonas_phage	37.4	2.0e-10
WP_155081833.1|160385_160607_-	hypothetical protein	NA	A0A0A7NPV4	Enterobacteria_phage	60.7	7.4e-15
159485:160477	attR	AGAATTTAACATCCTCCTAAACATTGCCGCCAGGATCATTTTTTTGAAATTCCTGAATCTCTAGAGATTATATTTGCTGTCCAATATAAGCCATTAAGATCAATCCTATAACTATTATATTTAGCAGAAAAACTTCCTAAAGGAATAATCTTATAGTTTTTACTACCAGGATATTTTGGCGCTGCTCCACCACCAAAAGATAACGAGTAATTCCAAGTGCTTCTATTTGCTGGCTTTATCCTCGTTTCTGCCGTTGTAATTAACGACCAAACACTACCAGTGGTTGTAAAAAAACCAATTACGGTTACTAACAATATTTTTTTCATAGTACTAACAATATTTTTTATTCTTGTAAGCAGTATAGTCAAATGCTTGTTGCCCTTTAAGCTAGATGGGTTACAAAATCTCAACTAAAGCTAAATTTTTAAATATCTATATAACATTGCCTTTGAAATTTTCATTTTTTGACATATTTCAGCAATAGACATGTTGTGATCTCTATGTAATGCCTTTGCTGTAATTACATTTGAATCCATTGGCGATAAACGAGGCCGCCCACCTTTTTTGCCTCTCGATCTTGCAGATTTTAAACCCGCATTCACCCGTTCTTGAATTAATCTCCTTTCGAATTGAGCCAGTGAAGCGAAAAGGTTAAACATAAGCTCACCAGAGGTGGTGGTCGTGTTAATGCAACCATCTGACAGTGATTTAAAATGTATATCAGGACTTACGCATTGACAGCTGTTTTAAAACATGAAAGCTAGTGACATCAATAGATCTAGCCTTTTAATCACTTTTTTACAAACTCTCTGAAGAGAGCAAAAGTATGAGTTTATGACAAAAATTCATACAAGTTATGAAAAAAATGTACTGAAAATACCAATTTTTTGTGGGTGCATAACTAGATTTTGTTGTCAATGCGTAAGTCCTGTATATGTTGTTCTTTTAGCTCATTAACTGTACTGACCAAGTGTGAAATCGAACGACCAAGAC	NA	NA	NA	NA
WP_155081800.1|160692_161322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066278.1|161325_162375_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP039230	Piscirickettsia salmonis strain SR1 plasmid unnamed3, complete sequence	64745	3613	43804	64745	transposase,integrase	unidentified_phage(25.0%)	51	NA	NA
WP_155080408.1|3613_4843_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155081838.1|4979_5129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081873.1|5358_6231_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155081839.1|6497_6638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122943008.1|6637_7435_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_155081840.1|9116_9983_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155080469.1|10094_10478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066278.1|10892_11942_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079445.1|12537_13512_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_155081161.1|13535_13751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081841.1|13918_14386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081842.1|14564_14879_-	universal stress family protein	NA	NA	NA	NA	NA
WP_155081843.1|16159_16456_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081844.1|16683_17910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081845.1|18159_18732_-	hypothetical protein	NA	A0A1P8DTK0	Proteus_phage	51.0	2.5e-30
WP_155079476.1|18967_19354_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|19337_19895_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155589632.1|19953_20781_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155589633.1|20843_21002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085410.1|21016_21154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081847.1|21364_21811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081848.1|21956_22976_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155079478.1|23455_24013_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155080557.1|23996_24335_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155589634.1|24377_25097_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.5	1.4e-06
WP_155066936.1|25164_25515_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155081465.1|25546_25999_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.4	3.3e-09
WP_155081850.1|26087_26297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081851.1|26433_27249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079445.1|27419_28394_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_080963620.1|28580_28937_-	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	36.4	1.7e-16
WP_027242953.1|28920_29175_-	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_155079478.1|29760_30318_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|30301_30688_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081739.1|30814_31549_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	35.7	2.0e-27
WP_155081852.1|32246_33038_+	AAA family ATPase	NA	K7PHD1	Enterobacteria_phage	55.6	2.9e-77
WP_155080444.1|33029_34511_-|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	37.0	6.7e-27
WP_155079959.1|34553_34904_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	39.2	4.5e-14
WP_155079958.1|34900_35209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155589635.1|35330_35879_+	hypothetical protein	NA	K7PK19	Enterobacteria_phage	40.8	1.2e-32
WP_155079445.1|35898_36873_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_155081874.1|37202_37532_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|37624_38182_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155079476.1|38165_38552_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155081854.1|38570_38864_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_155081855.1|38960_39326_-|integrase	tyrosine-type recombinase/integrase	integrase	K4K327	Caulobacter_virus	33.0	4.2e-07
WP_155079476.1|39479_39866_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079478.1|39849_40407_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155081856.1|40524_41238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079826.1|41259_42145_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.4	9.0e-11
WP_155079445.1|42829_43804_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
>prophage 1
NZ_CP039231	Piscirickettsia salmonis strain SR1 plasmid unnamed4, complete sequence	56994	12693	46861	56994	transposase	unidentified_phage(30.0%)	38	NA	NA
WP_155079741.1|12693_13668_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	2.4e-25
WP_155081889.1|13873_14140_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155589637.1|14435_16343_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_155081891.1|16528_18580_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_155081892.1|19035_19269_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155079741.1|19605_20580_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	2.4e-25
WP_155081893.1|20624_21113_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_155079741.1|21377_22352_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	2.4e-25
WP_155081894.1|22592_23306_-	acid phosphatase	NA	NA	NA	NA	NA
WP_155079445.1|23710_24685_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	5.4e-25
WP_122942818.1|24909_25164_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_155081895.1|25153_25441_+	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	49.5	9.6e-15
WP_155079454.1|25764_25956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081491.1|26883_27336_-|transposase	transposase	transposase	A0A1V0SCG6	Indivirus	28.4	9.6e-09
WP_155068097.1|27367_27718_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155079983.1|28683_29472_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.4	3.8e-13
WP_155080231.1|29475_29724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155079958.1|29779_30088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155079959.1|30084_30435_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	39.2	4.5e-14
WP_155080444.1|30477_31959_+|transposase	IS66 family transposase	transposase	S5VTP8	Leptospira_phage	37.0	6.7e-27
WP_155066936.1|32107_32458_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155068622.1|32489_32942_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.4	4.3e-09
WP_155589638.1|32950_34165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155081897.1|34418_35804_+	hypothetical protein	NA	M1I670	Acanthocystis_turfacea_Chlorella_virus	25.3	2.1e-06
WP_155081911.1|35793_35979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155085400.1|36006_36819_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.6	2.2e-48
WP_155068889.1|36842_37157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081899.1|37562_38555_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	1.4e-23
WP_155589639.1|39956_40940_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.0	6.0e-24
WP_155066936.1|41136_41487_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155081901.1|41413_41572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155081465.1|41566_42019_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	28.4	3.3e-09
WP_155066936.1|42050_42401_-|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	37.6	4.3e-09
WP_155067991.1|42470_42887_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155081902.1|42873_43461_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.0	6.8e-07
WP_155080102.1|43476_43929_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_155081903.1|44620_45490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066610.1|46285_46861_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.2	1.6e-08
>prophage 1
NZ_CP039233	Piscirickettsia salmonis strain SR1 plasmid unnamed6, complete sequence	40972	17451	27915	40972	portal,head,terminase,tail,capsid	Erysipelothrix_phage(30.0%)	14	NA	NA
WP_155589668.1|17451_18450_+	DNA-processing protein DprA	NA	S6BFL3	Thermus_phage	34.7	1.7e-21
WP_155589669.1|18460_19717_+	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_155589670.1|19908_20292_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	47.2	1.1e-26
WP_155589671.1|20365_20860_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	32.7	1.6e-12
WP_155589672.1|20843_22277_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.7	1.7e-123
WP_155589673.1|22194_22536_+	hypothetical protein	NA	A0A2K5B285	Erysipelothrix_phage	50.0	3.2e-17
WP_155589674.1|22532_23774_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	46.6	7.0e-86
WP_155589675.1|23721_24165_+	hypothetical protein	NA	K7PKX4	Enterobacterial_phage	53.2	6.4e-34
WP_155589676.1|24145_24391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155589677.1|24446_24830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155589678.1|24781_25639_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	45.0	1.7e-59
WP_155589679.1|25759_27115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155589680.1|27283_27595_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	31.7	1.1e-08
WP_155589681.1|27591_27915_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.0	6.0e-13
