The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039868	Piscirickettsia salmonis strain Psal-113 chromosome, complete genome	3194954	31805	91594	3194954	transposase,tRNA	Staphylococcus_phage(28.57%)	52	NA	NA
WP_036772169.1|31805_32681_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378444.1|33039_34395_+	chloride channel protein	NA	NA	NA	NA	NA
WP_017378443.1|34486_34993_-	GrpB family protein	NA	NA	NA	NA	NA
WP_017378442.1|34989_35358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378441.1|36760_38545_+	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_017378440.1|39025_40153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378439.1|40225_40981_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_027242743.1|41017_43711_-	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	30.7	9.9e-69
WP_036771562.1|43742_44294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063736.1|44401_45415_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017378435.1|45535_45760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378434.1|46115_46877_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_144420740.1|47019_47814_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875841.1|47958_48711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378433.1|49022_50549_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_065653750.1|50687_51761_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_027242742.1|51800_53108_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.4	1.2e-24
WP_017378429.1|53082_54252_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_027242741.1|54306_55032_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_027242740.1|55497_57603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378426.1|57817_58282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420739.1|58301_58811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420738.1|59195_60137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856772.1|60418_61870_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773655.1|62336_62741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|63301_64276_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378420.1|65010_65388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|65977_66952_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036773242.1|66991_67546_-	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_017378416.1|67726_68626_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_080963576.1|68630_69257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242705.1|69201_71523_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.9	7.9e-99
WP_016210342.1|71669_72149_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_017378414.1|72145_73297_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_017378413.1|73431_73935_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	5.4e-13
WP_026063734.1|74028_75003_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	1.3e-10
WP_036773239.1|74992_76306_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_017378410.1|76346_77726_+	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_080963575.1|77732_79184_+	potassium transporter	NA	NA	NA	NA	NA
WP_016210352.1|79209_79578_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_017378407.1|79596_80664_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_027242707.1|80696_81593_-	DMT family transporter	NA	NA	NA	NA	NA
WP_047927132.1|81589_82426_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_017378404.1|82561_83014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378403.1|83152_83899_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_017378402.1|83879_84443_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_017378401.1|84451_84967_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017378400.1|85108_87187_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378399.1|87186_88137_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_017378398.1|89004_89403_+	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_075275373.1|89628_89958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875844.1|90574_91594_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP039868	Piscirickettsia salmonis strain Psal-113 chromosome, complete genome	3194954	123076	241144	3194954	protease,transposase,tRNA	Staphylococcus_phage(12.5%)	106	NA	NA
WP_075278722.1|123076_123952_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929698.1|124392_124686_+	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_017377396.1|124686_124941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242714.1|124957_127450_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_017377399.1|127442_128126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377400.1|128125_129169_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_017377401.1|129168_130398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377402.1|130399_130729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377403.1|130725_131925_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_144420824.1|132037_132427_+	signal peptidase, peptidase S26 family protein	NA	NA	NA	NA	NA
WP_026063632.1|132426_133371_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_017377406.1|133490_134888_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9KZD3	Tupanvirus	36.2	3.9e-77
WP_017377407.1|135213_135735_+	phospholipase D family protein	NA	E9P5Z4	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage	46.2	1.7e-30
WP_017377408.1|135858_136167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875847.1|136181_141404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242717.1|141794_143801_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377568.1|143931_146262_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_144420823.1|146437_147268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773453.1|147384_147780_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_027242719.1|147776_148310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242720.1|148306_148708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875848.1|149102_149423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377563.1|149432_150389_+	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.5	1.0e-12
WP_017377562.1|150898_151423_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_017377561.1|151523_152522_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_027242721.1|152610_153507_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080963593.1|153580_154867_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377557.1|155326_156643_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377556.1|156756_156927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|156946_157921_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377551.1|158047_158308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377550.1|158575_158866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377545.1|161404_162445_-	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_048875849.1|162547_163519_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377543.1|163641_164490_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_017377542.1|164641_164929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|165239_165611_+	isochorismatase	NA	NA	NA	NA	NA
WP_155052673.1|166671_166896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046561.1|167033_167171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377539.1|167184_167397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242723.1|167393_167693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377537.1|167920_168745_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_017377536.1|168883_170017_+	cation transporter	NA	NA	NA	NA	NA
WP_016210041.1|170076_171486_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_027242724.1|171633_173214_-	APC family permease	NA	NA	NA	NA	NA
WP_017377534.1|173971_174967_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_027242725.1|174972_177039_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_048875850.1|177096_178047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210045.1|178241_178568_+	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_026063646.1|178790_180050_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_036772663.1|180309_181185_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377528.1|181223_182186_+	hypothetical protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	28.1	7.0e-17
WP_017375799.1|187880_188225_-	DMT family protein	NA	NA	NA	NA	NA
WP_047927156.1|188321_189245_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375796.1|189744_190233_+	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.1	4.5e-28
WP_017375795.1|190335_191136_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.1	3.4e-33
WP_017375794.1|191146_192898_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_081000012.1|193787_194030_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420737.1|194033_194432_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772169.1|194663_195539_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375951.1|196257_196716_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420736.1|196897_197083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375949.1|197798_199613_-	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_017375948.1|200023_200692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375947.1|200701_202018_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_017375945.1|202177_203140_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210730.1|203220_203376_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_017375944.1|203389_203626_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_036773720.1|203818_205036_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.3	6.3e-39
WP_017375942.1|205013_205472_+	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	68.0	3.5e-51
WP_017375941.1|205499_206879_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	30.9	3.0e-53
WP_075275379.1|206915_207134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875852.1|207453_208749_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875853.1|208953_209145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|209343_210219_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378154.1|210406_211672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875854.1|211705_212581_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378152.1|212702_213161_-	NfeD family protein	NA	NA	NA	NA	NA
WP_017378151.1|213184_214105_-	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_017378150.1|214232_215015_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.0	1.8e-31
WP_017378149.1|215105_216605_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_027242686.1|216918_218802_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_027242685.1|219061_219724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242684.1|219790_220900_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.5	1.6e-17
WP_017378146.1|220911_221556_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_017378145.1|221574_222561_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017378144.1|222645_223722_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_017378143.1|223923_224748_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_017378142.1|225050_226016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378141.1|226334_227387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|227445_228420_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027242682.1|228755_229184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242681.1|229420_229903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378138.1|229958_231209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378137.1|231311_231530_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_017378136.1|232001_232856_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_017378135.1|232910_233381_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_026063709.1|233677_233914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063708.1|234060_234441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|234499_235375_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063707.1|236141_237053_+	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_017378132.1|237169_238018_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_065653735.1|238084_239095_+	lipase	NA	NA	NA	NA	NA
WP_017378129.1|239118_239442_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_017375571.1|239452_239854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875856.1|240124_241144_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP039868	Piscirickettsia salmonis strain Psal-113 chromosome, complete genome	3194954	314947	357306	3194954	transposase	Chrysochromulina_ericina_virus(20.0%)	54	NA	NA
WP_036772169.1|314947_315823_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378046.1|315903_316536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378045.1|316489_317935_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_051929544.1|317969_318389_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017378043.1|319162_319531_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_017378042.1|319540_320080_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_017378041.1|320240_320672_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_017378040.1|320675_321374_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_017378039.1|321621_322128_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_017378038.1|322170_322539_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_017378037.1|322809_326886_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.6	1.2e-22
WP_017378036.1|326949_331158_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	1.4e-69
WP_016209765.1|331319_331694_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_016209732.1|331798_332272_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_017378035.1|332287_334399_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	7.0e-54
WP_016209759.1|334426_335617_+	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	27.0	2.4e-14
WP_016209760.1|335623_335935_+	30S ribosomal protein S10	NA	NA	NA	NA	NA
WP_017378034.1|336057_336696_+	50S ribosomal protein L3	NA	NA	NA	NA	NA
WP_016209735.1|336711_337329_+	50S ribosomal protein L4	NA	NA	NA	NA	NA
WP_016209744.1|337325_337622_+	50S ribosomal protein L23	NA	NA	NA	NA	NA
WP_017378033.1|337636_338461_+	50S ribosomal protein L2	NA	NA	NA	NA	NA
WP_017378032.1|338477_338753_+	30S ribosomal protein S19	NA	NA	NA	NA	NA
WP_016209755.1|338758_339091_+	50S ribosomal protein L22	NA	NA	NA	NA	NA
WP_017378031.1|339103_339838_+	30S ribosomal protein S3	NA	NA	NA	NA	NA
WP_017378030.1|339851_340265_+	50S ribosomal protein L16	NA	NA	NA	NA	NA
WP_016209750.1|340264_340465_+	50S ribosomal protein L29	NA	NA	NA	NA	NA
WP_017378029.1|340464_340722_+	30S ribosomal protein S17	NA	NA	NA	NA	NA
WP_017378028.1|340843_341212_+	50S ribosomal protein L14	NA	NA	NA	NA	NA
WP_016209734.1|341229_341541_+	50S ribosomal protein L24	NA	NA	NA	NA	NA
WP_016209761.1|341556_342099_+	50S ribosomal protein L5	NA	NA	NA	NA	NA
WP_026063699.1|342111_342417_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_016209763.1|342445_342838_+	30S ribosomal protein S8	NA	NA	NA	NA	NA
WP_017378025.1|342850_343384_+	50S ribosomal protein L6	NA	NA	NA	NA	NA
WP_016209757.1|343393_343747_+	50S ribosomal protein L18	NA	NA	NA	NA	NA
WP_016209764.1|343757_344258_+	30S ribosomal protein S5	NA	NA	NA	NA	NA
WP_017378024.1|344263_344446_+	50S ribosomal protein L30	NA	NA	NA	NA	NA
WP_017378023.1|344448_344883_+	50S ribosomal protein L15	NA	NA	NA	NA	NA
WP_016209749.1|344883_346206_+	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
WP_016209752.1|346262_346376_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_017378021.1|346519_346876_+	30S ribosomal protein S13	NA	NA	NA	NA	NA
WP_016209730.1|346901_347291_+	30S ribosomal protein S11	NA	NA	NA	NA	NA
WP_017378020.1|347300_347921_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_016209739.1|347942_348920_+	DNA-directed RNA polymerase subunit alpha	NA	NA	NA	NA	NA
WP_017378019.1|348968_349367_+	50S ribosomal protein L17	NA	NA	NA	NA	NA
WP_017378018.1|349479_350727_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_027242670.1|350713_351370_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_036772490.1|351454_351733_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375625.1|351975_352203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875859.1|352335_353130_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_053856770.1|353438_354653_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420733.1|355050_355230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910654.1|355198_355852_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376985.1|356227_356476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771653.1|356565_357306_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.9e-09
>prophage 4
NZ_CP039868	Piscirickettsia salmonis strain Psal-113 chromosome, complete genome	3194954	366729	421642	3194954	protease,transposase,tRNA	uncultured_Caudovirales_phage(20.0%)	60	NA	NA
WP_017376975.1|366729_367281_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_017376974.1|367291_368659_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.9	1.6e-43
WP_017376973.1|368809_369046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376972.1|369104_369848_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_027242667.1|369847_370489_+	lipoprotein	NA	NA	NA	NA	NA
WP_017376970.1|370488_372153_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.8	6.4e-34
WP_017376969.1|372181_372517_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_027242666.1|372681_374280_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	7.1e-06
WP_017376966.1|374339_374630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772765.1|374830_375262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376964.1|375324_377805_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.8	3.8e-192
WP_017376963.1|377891_378371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772771.1|378343_379384_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_080963574.1|379320_380037_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_016210374.1|380049_380385_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_016210381.1|380421_380892_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_017376959.1|380934_382770_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_036818645.1|382814_383903_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_017376957.1|383924_384986_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_017376956.1|385063_385579_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376955.1|385619_386897_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_017376954.1|386911_387763_+	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_017376953.1|387791_388439_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026063584.1|388435_389395_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_048875861.1|389916_390786_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875862.1|390930_391185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856769.1|391329_391896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275367.1|392001_392442_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_051929598.1|392399_392657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242664.1|392953_394156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971662.1|394439_395414_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	9.5e-30
WP_155046563.1|395883_396021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910653.1|396037_396253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046564.1|396457_397069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376943.1|397065_397323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376942.1|397573_397966_-	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_016210000.1|398095_398644_+	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_026063583.1|398643_399471_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_017376940.1|399520_401206_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.9e-26
WP_017376939.1|401283_401745_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_026063582.1|401781_402345_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_016209991.1|402571_402901_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_017376937.1|402881_403106_-	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_017376936.1|403250_403841_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_017376935.1|403865_405137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063581.1|405154_406408_+	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_017376933.1|406404_407049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376932.1|407121_408171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376931.1|408272_409910_+	response regulator	NA	NA	NA	NA	NA
WP_017376930.1|409944_410274_-	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_017376929.1|410430_410718_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_017376927.1|411144_411282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376925.1|411787_413008_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1V0EEL7	Caulobacter_phage	28.7	4.2e-35
WP_017376924.1|413066_415865_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.1	1.1e-179
WP_017376923.1|416170_417337_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.3e-25
WP_036772950.1|417435_417972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376921.1|418033_418366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875863.1|418623_419526_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376920.1|419595_420093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|420238_421642_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP039868	Piscirickettsia salmonis strain Psal-113 chromosome, complete genome	3194954	451079	499218	3194954	transposase	Staphylococcus_phage(100.0%)	42	NA	NA
WP_036774259.1|451079_452054_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420729.1|452401_453040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|453159_454563_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242658.1|455905_457369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420728.1|457444_458251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242656.1|458530_459349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046566.1|459366_459960_-	DedA family protein	NA	NA	NA	NA	NA
WP_017376894.1|460176_460410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242655.1|460633_461530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420727.1|461834_462605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376891.1|462774_463677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242654.1|463673_464897_+	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_027242653.1|464914_465841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242652.1|465856_466897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242651.1|467011_467422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376888.1|467474_467978_+	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_017376887.1|467970_468717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376886.1|468719_469850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420726.1|469854_470094_+	type IV secretion protein IcmT	NA	NA	NA	NA	NA
WP_027242650.1|472583_473072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242649.1|473074_474151_+	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_017376878.1|474143_474797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875870.1|474803_475229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242647.1|475265_478265_+	ATPase AAA	NA	NA	NA	NA	NA
WP_027242646.1|478326_479829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772357.1|480280_481900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376871.1|481941_484245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376870.1|484521_485418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242644.1|485420_488747_+	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_144420818.1|488948_489137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242642.1|489148_489625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772352.1|489667_489895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420817.1|490076_490610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242641.1|490640_490982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772347.1|490984_491401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876253.1|491562_492219_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	3.3e-10
WP_036771639.1|492215_493190_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_032126138.1|493631_493895_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_036771639.1|494322_495297_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_087910671.1|495684_496149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910670.1|496242_496428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875857.1|498243_499218_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
>prophage 6
NZ_CP039868	Piscirickettsia salmonis strain Psal-113 chromosome, complete genome	3194954	504022	558705	3194954	transposase	Streptococcus_phage(22.22%)	52	NA	NA
WP_048875872.1|504022_505306_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375570.1|505478_505616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875873.1|505612_507016_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927246.1|507129_507567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242638.1|507687_508116_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_017375827.1|508363_508801_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556626.1|509232_510621_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_017375825.1|511067_512561_+	amino acid permease	NA	NA	NA	NA	NA
WP_036773936.1|512755_513511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420725.1|514010_514241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420724.1|515345_516356_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375821.1|516352_516574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242636.1|517292_518234_-	DMT family transporter	NA	NA	NA	NA	NA
WP_026063480.1|518761_519160_+	MFS transporter	NA	S4TR35	Salmonella_phage	31.4	1.2e-07
WP_075275366.1|519099_519954_+	MFS transporter	NA	NA	NA	NA	NA
WP_017375815.1|520045_520327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242634.1|520412_521090_-	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_026063478.1|521135_522416_-	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	4.6e-24
WP_017375812.1|522591_523641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375811.1|523719_524520_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_017375810.1|524533_525328_+	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	1.1e-103
WP_017375809.1|525430_526450_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_017375808.1|526496_527108_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_017375807.1|527111_527798_+	acireductone synthase	NA	NA	NA	NA	NA
WP_017375806.1|527794_528337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375805.1|528629_529817_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_017375804.1|530061_530787_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_144420816.1|530972_531761_+	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_047927106.1|531757_532153_-	YchJ family protein	NA	NA	NA	NA	NA
WP_017375801.1|532545_533586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|533582_534986_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774495.1|537401_537659_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420723.1|537698_539084_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242633.1|539413_540511_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.9	3.5e-49
WP_017377120.1|540544_541795_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.4	2.7e-93
WP_017377119.1|541795_542428_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017377118.1|542717_543170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063598.1|543215_544058_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377116.1|544092_544584_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_017377115.1|544779_546747_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_017377113.1|546974_547379_+	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_047927448.1|547356_548385_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.4e-15
WP_027242632.1|548371_549160_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_053856766.1|549586_550990_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377110.1|551191_552202_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_075275363.1|552214_552682_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017377107.1|553011_554382_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.5e-110
WP_017377106.1|554684_555155_+	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	36.6	6.0e-22
WP_017377105.1|555432_555708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875878.1|555718_557122_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_069971661.1|557296_557734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|557730_558705_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
>prophage 7
NZ_CP039868	Piscirickettsia salmonis strain Psal-113 chromosome, complete genome	3194954	590496	723890	3194954	transposase,tRNA,plate	Staphylococcus_phage(13.64%)	111	NA	NA
WP_036772726.1|590496_591045_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.3	1.1e-06
WP_017377077.1|591797_593177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420815.1|593536_595000_+	nuclease	NA	NA	NA	NA	NA
WP_017377075.1|595183_595996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377074.1|596460_598455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377073.1|598849_600229_+	MFS transporter	NA	NA	NA	NA	NA
WP_036774567.1|600266_600704_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774569.1|600746_601463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242614.1|603009_603540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377070.1|603606_605427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377069.1|605991_606498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242613.1|606582_607986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377066.1|608100_608355_+	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_017377065.1|608507_608780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420722.1|609355_609538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377064.1|609654_610230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046568.1|610238_610397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242612.1|611297_611540_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_027242611.1|611842_612934_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_017377060.1|612914_613868_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	2.9e-31
WP_017377059.1|614091_615576_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	8.5e-46
WP_027242610.1|615615_616119_+	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	33.1	2.1e-09
WP_051929897.1|616378_617554_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_051929903.1|617701_618106_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_036772169.1|618262_619138_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242609.1|619172_619526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377052.1|622855_623281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772661.1|623511_624648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242608.1|624634_625957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377048.1|625949_627068_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017377047.1|627188_627722_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017377046.1|627860_629498_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	3.4e-88
WP_017377045.1|629502_629724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377044.1|629832_630846_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_017377043.1|631117_633346_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.8	1.7e-82
WP_026063593.1|633326_634031_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377041.1|634265_634595_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_017377039.1|635995_636214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|636272_637148_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377037.1|637140_638007_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	6.3e-25
WP_017377036.1|638074_639394_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_036772137.1|639863_640424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856764.1|640742_641669_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376601.1|642564_643473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376603.1|647169_648009_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	1.4e-45
WP_017376604.1|648195_648411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376605.1|648459_649035_-	ribonuclease HI	NA	M4QMN0	Micromonas_pusilla_virus	55.1	1.1e-33
WP_017376606.1|649031_649370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376607.1|649538_650528_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.4	4.5e-19
WP_051929685.1|651517_652420_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_048875883.1|652679_653216_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420814.1|653360_654278_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376610.1|654712_655723_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	40.6	9.5e-57
WP_017376611.1|656530_657067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376613.1|658279_658627_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275357.1|658771_659731_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	34.3	1.2e-13
WP_017376616.1|659832_660615_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243116.1|660747_661707_+	response regulator	NA	NA	NA	NA	NA
WP_017376619.1|661731_662136_-	RidA family protein	NA	NA	NA	NA	NA
WP_026063546.1|662164_662839_-|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_027243117.1|662938_664654_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_016209558.1|664650_665013_+	small Multidrug Resistance family protein	NA	NA	NA	NA	NA
WP_026063550.1|665027_666182_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	33.0	3.9e-38
WP_017376622.1|666185_667193_+	glycosyltransferase	NA	B9UDL7	Salmonella_phage	34.4	2.2e-37
WP_017376623.1|667195_668212_+	bifunctional UDP-4-keto-pentose/UDP-xylose synthase	NA	D5GW02	Campylobacter_virus	28.7	1.9e-12
WP_017376624.1|668427_669513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376625.1|669619_670012_-	RidA family protein	NA	NA	NA	NA	NA
WP_027243118.1|670144_671428_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_027243119.1|671443_672745_+	aspartate kinase	NA	NA	NA	NA	NA
WP_036772145.1|672762_674565_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420721.1|674569_675562_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017376630.1|675642_676719_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017376631.1|676816_677791_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	7.3e-14
WP_144420813.1|677858_678830_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.3	3.0e-15
WP_017376633.1|679013_679283_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_017376634.1|679884_681171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772149.1|681235_681916_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155052676.1|687571_687859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375775.1|687897_688092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275355.1|688139_689114_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_027242570.1|689327_690467_-	hypothetical protein	NA	A0A0F6YPT7	Sinorhizobium_phage	41.7	9.3e-61
WP_017376020.1|690675_692046_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_017376019.1|692424_693417_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_017376018.1|693420_693936_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_017376017.1|693932_694772_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_027242569.1|694804_696355_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_017376015.1|696462_696834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376011.1|698054_698216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|698796_700200_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375660.1|700234_700672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|700695_701670_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036774104.1|701728_702157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376321.1|702344_703151_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_017376322.1|703225_703618_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_017376323.1|703662_704484_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_017376324.1|704496_705480_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_017376325.1|705481_706750_-	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_048876074.1|706756_709261_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_017376328.1|709391_710417_+	phosphotransferase	NA	NA	NA	NA	NA
WP_017376329.1|710413_711124_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_080963653.1|711048_711879_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_017376331.1|712028_712412_+	response regulator	NA	NA	NA	NA	NA
WP_027242863.1|712446_713346_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_027242862.1|713391_714063_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_017376334.1|714145_714721_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.0	3.2e-57
WP_017376335.1|714819_715620_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_017376336.1|715761_716619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242861.1|717481_718618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242860.1|718684_721855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242859.1|721867_722578_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_027242858.1|722582_723890_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 8
NZ_CP039868	Piscirickettsia salmonis strain Psal-113 chromosome, complete genome	3194954	732532	778849	3194954	transposase,plate	Staphylococcus_phage(21.43%)	51	NA	NA
WP_017376356.1|732532_732931_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_027242851.1|732927_734616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242850.1|734597_735554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|735596_736112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376359.1|736216_737149_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_017376360.1|737368_737755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376361.1|737772_738417_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_017376362.1|738567_739407_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	26.6	3.9e-16
WP_017376363.1|739482_740085_+	signal peptidase I	NA	NA	NA	NA	NA
WP_017376364.1|740085_740940_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_017376365.1|741297_741609_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017376366.1|741633_743022_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|743177_743909_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_027242849.1|743905_744433_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|744464_745022_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_027242848.1|745027_746008_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	3.5e-32
WP_016209539.1|746147_746948_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_017376369.1|746951_747719_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_017376370.1|747715_748180_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_017376371.1|748202_748856_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017376372.1|748859_749207_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_017376373.1|749240_749492_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|749569_750838_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_027242847.1|750840_751599_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_017376376.1|751660_752551_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|752601_753285_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_017376377.1|753294_753642_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_027242846.1|753914_756035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376379.1|756026_756899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376380.1|757066_758896_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_017376381.1|759063_759705_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_144420811.1|760029_760476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210404.1|760493_760667_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_017376383.1|760725_761775_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_017376384.1|761781_762732_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_017376385.1|762786_763731_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_017376386.1|763758_764496_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|764584_764827_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|764901_766125_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_017376387.1|766156_767005_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_017376388.1|767001_768054_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_017376389.1|768190_768811_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	43.7	2.7e-38
WP_087910645.1|769036_770189_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_036771330.1|771209_772184_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046570.1|772180_772351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971647.1|773319_773916_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876071.1|773884_775045_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_017377691.1|775555_775897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377690.1|776000_777035_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|777031_777742_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_036771330.1|777874_778849_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 9
NZ_CP039868	Piscirickettsia salmonis strain Psal-113 chromosome, complete genome	3194954	787009	841320	3194954	protease,transposase,tRNA	Prochlorococcus_phage(33.33%)	49	NA	NA
WP_017377942.1|787009_787516_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_027243058.1|787597_788014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243057.1|788105_788966_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420810.1|789063_789609_+	chorismate lyase	NA	NA	NA	NA	NA
WP_017377937.1|789691_790543_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_048876070.1|790584_793491_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|793551_793749_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_017377935.1|793755_794766_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_017377934.1|794762_795821_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_087910662.1|795835_796615_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027243055.1|796617_797430_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_017377933.1|797441_798389_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.6	3.5e-37
WP_144420809.1|798399_799692_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_017377931.1|799870_800974_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_017377930.1|800970_801363_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_027243054.1|801375_802752_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_017377929.1|802745_804215_+	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.7	2.7e-84
WP_053856762.1|804408_804843_+	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	38.0	7.7e-16
WP_087910651.1|805138_805315_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	46.2	5.5e-05
WP_027243053.1|806349_807375_+	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	30.5	4.5e-30
WP_017377925.1|807876_808269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774583.1|809661_810312_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_155046574.1|811010_811805_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876067.1|811984_812629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|812803_813778_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377920.1|814178_814436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420808.1|816113_816791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243155.1|817024_817849_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377914.1|817942_818656_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_017377913.1|818745_819837_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_017377912.1|819908_820490_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_017377911.1|820495_821122_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_026063691.1|821218_822166_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.3	3.4e-40
WP_065653730.1|822512_823175_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_017377908.1|823345_824005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377907.1|824173_825433_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_017377906.1|825429_826515_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_017377905.1|826507_827389_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_027243154.1|827377_828628_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_144420719.1|830013_830334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|830592_830859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275437.1|831349_831568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420718.1|832553_832775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|832771_833854_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063690.1|833864_834236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773050.1|834232_834412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375695.1|837115_837391_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_065653755.1|838226_839684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420716.1|840111_841320_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP039868	Piscirickettsia salmonis strain Psal-113 chromosome, complete genome	3194954	885000	947520	3194954	transposase,tRNA	Staphylococcus_phage(28.57%)	53	NA	NA
WP_048875904.1|885000_885876_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376744.1|886132_886570_-	DUF1841 family protein	NA	NA	NA	NA	NA
WP_017376743.1|886630_887263_-	endonuclease III	NA	NA	NA	NA	NA
WP_017376742.1|887278_887926_-	RnfABCDGE type electron transport complex subunit B	NA	NA	NA	NA	NA
WP_027242971.1|887928_889992_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.2	5.5e-35
WP_027242972.1|890318_891611_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242973.1|891999_894210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242974.1|894226_894883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242975.1|897268_898144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420805.1|898402_899014_+	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_027242976.1|899441_902030_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	37.1	4.3e-122
WP_017375712.1|902132_902894_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_027242977.1|902890_903427_-	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	39.9	1.3e-20
WP_017375710.1|903475_904432_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.3	3.6e-50
WP_027242978.1|904509_907695_-	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_017375707.1|907698_908754_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.7	1.5e-49
WP_027242979.1|908983_909586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375705.1|909629_910292_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017375704.1|910326_910674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375702.1|911142_912174_-	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|912636_914040_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242980.1|915158_915503_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027242981.1|915594_916050_+	glyoxalase/bleomycin resistance protein/dioxygenase	NA	NA	NA	NA	NA
WP_144420715.1|916298_916433_-	VOC family protein	NA	NA	NA	NA	NA
WP_017377756.1|916425_917067_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017377755.1|917063_917780_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_017377754.1|917783_919103_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_155051395.1|919784_919928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773644.1|920907_923544_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	1.5e-98
WP_036773645.1|923585_924671_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	9.8e-76
WP_017377749.1|924670_925354_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_017377748.1|925414_927076_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_017377747.1|927228_927483_+	LapA family protein	NA	NA	NA	NA	NA
WP_017377746.1|927561_927879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377745.1|928031_928430_+	VOC family protein	NA	NA	NA	NA	NA
WP_027242983.1|928511_929150_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_036771330.1|929306_930281_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420804.1|930653_930929_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375618.1|931478_931763_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772261.1|933579_934173_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243172.1|935260_936142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376527.1|936253_937933_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.6	3.0e-39
WP_017376526.1|938059_939310_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	2.4e-102
WP_017376525.1|939385_939847_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_017376524.1|939843_940992_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.8	4.7e-44
WP_017376523.1|940997_941672_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	6.0e-31
WP_017376522.1|941668_942325_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.8e-40
WP_017376521.1|942450_942924_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	2.4e-26
WP_017376520.1|942925_943348_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_047927196.1|943334_944354_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_155046578.1|944513_944693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243174.1|944911_945193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|946644_947520_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP039868	Piscirickettsia salmonis strain Psal-113 chromosome, complete genome	3194954	951422	1018385	3194954	protease,transposase,tRNA	Bacillus_phage(20.0%)	56	NA	NA
WP_048876012.1|951422_952826_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377823.1|953184_953952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|954065_955469_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046579.1|955465_955627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|955942_956917_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376505.1|957157_958441_-	MFS transporter	NA	NA	NA	NA	NA
WP_017376506.1|958507_959431_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.4	4.3e-24
WP_017376509.1|961626_963771_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.0e-12
WP_016210310.1|963792_963999_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_017376510.1|964059_964680_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.5	1.4e-18
WP_017376511.1|964720_965614_-	YicC family protein	NA	NA	NA	NA	NA
WP_016210308.1|965699_966425_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_016210305.1|966486_966891_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_027243115.1|967053_969162_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_017376514.1|969285_970335_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376515.1|970331_971798_+	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_017376516.1|971940_973278_+	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_047927029.1|973345_974836_-	nuclease	NA	NA	NA	NA	NA
WP_017376518.1|975064_975436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243113.1|975586_976414_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_027243112.1|976716_977373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927028.1|977320_978244_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036774751.1|978257_979181_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027243109.1|979455_980112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|981811_982039_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017376989.1|982363_982912_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_017376990.1|982992_983268_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_027242882.1|983267_984317_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_017376991.1|984429_986367_-	AsmA family protein	NA	NA	NA	NA	NA
WP_080963631.1|986514_988227_+	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_017376994.1|988295_989015_+	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_017376995.1|989011_989614_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_017376996.1|989728_990616_-	ROK family protein	NA	NA	NA	NA	NA
WP_016210463.1|990806_991154_+	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_017376997.1|991204_992044_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	1.0e-32
WP_017376998.1|992139_992886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063589.1|993082_993709_+	porin family protein	NA	NA	NA	NA	NA
WP_017377000.1|994024_994594_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017377001.1|994737_995436_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_017377003.1|996142_996766_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_052106204.1|996875_997769_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_017377006.1|997875_999486_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_027242880.1|999482_1000778_-	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_027242879.1|1000799_1002722_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_017377007.1|1002832_1003135_+	DUF2835 family protein	NA	NA	NA	NA	NA
WP_017377008.1|1003229_1008116_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_047927528.1|1008163_1009486_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.9	7.3e-65
WP_036771855.1|1009610_1010705_+	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_027242877.1|1010756_1011695_+	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	30.1	4.9e-15
WP_026063591.1|1011775_1012360_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_027242876.1|1012744_1013635_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_017377014.1|1013837_1014329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242875.1|1014468_1014960_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209885.1|1015128_1015842_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_065653747.1|1015904_1017245_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_048875904.1|1017509_1018385_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP039868	Piscirickettsia salmonis strain Psal-113 chromosome, complete genome	3194954	1023998	1086525	3194954	transposase	Staphylococcus_phage(33.33%)	57	NA	NA
WP_017377787.1|1023998_1024226_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377021.1|1024252_1025293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377022.1|1025359_1025929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377023.1|1026159_1026564_+	SufE family protein	NA	NA	NA	NA	NA
WP_017377024.1|1026576_1026717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929560.1|1026811_1028011_+	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.2	2.7e-42
WP_016211971.1|1028031_1028643_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_027242871.1|1028844_1029606_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_080963583.1|1029901_1030828_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_144420803.1|1030988_1031945_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999998.1|1032089_1032359_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1032625_1033600_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375625.1|1033753_1033981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420711.1|1034097_1034523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377031.1|1034679_1035609_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.6	2.2e-31
WP_027242870.1|1036055_1036586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420710.1|1036907_1037213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377033.1|1037690_1038002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963609.1|1038341_1039508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|1041695_1042667_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046581.1|1043269_1043443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376283.1|1043838_1044756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376284.1|1044756_1045608_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016211518.1|1046048_1047095_+	glutathione synthase	NA	NA	NA	NA	NA
WP_144420802.1|1047084_1049076_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_036773579.1|1049185_1049560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420801.1|1049813_1049996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376289.1|1050257_1050959_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_027242868.1|1050959_1051427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376293.1|1053065_1055816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376294.1|1056051_1057344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876055.1|1057830_1058736_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376296.1|1059513_1060230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420658.1|1060515_1061277_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_048876053.1|1061309_1062713_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046582.1|1062709_1062874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377223.1|1062933_1063221_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017375910.1|1063965_1064694_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_048876052.1|1064662_1065409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420708.1|1065489_1065879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1065875_1066850_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036772454.1|1067006_1067324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772457.1|1069799_1070108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377865.1|1070183_1070456_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_017377863.1|1072989_1073427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377862.1|1074028_1075216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963626.1|1075486_1077121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|1077171_1077900_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377858.1|1079327_1080290_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377857.1|1080513_1081509_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_017377856.1|1081536_1082472_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_017377855.1|1082515_1082977_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_080963625.1|1082955_1083573_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|1083602_1084577_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377852.1|1084631_1085099_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377851.1|1085111_1085756_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|1085796_1086525_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
>prophage 13
NZ_CP039868	Piscirickettsia salmonis strain Psal-113 chromosome, complete genome	3194954	1095225	1144793	3194954	transposase	Acinetobacter_phage(22.22%)	39	NA	NA
WP_082300708.1|1095225_1095786_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017378014.1|1097110_1097506_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017378015.1|1097514_1097871_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.0	3.5e-22
WP_048876047.1|1097863_1098739_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420706.1|1098824_1099403_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.8	1.1e-28
WP_048876046.1|1099360_1099654_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.4	4.1e-05
WP_047927811.1|1100614_1102126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1102373_1103777_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999997.1|1103982_1104417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275341.1|1104499_1105204_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080999996.1|1105462_1105951_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	30.9	7.4e-15
WP_051929548.1|1105979_1106654_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875904.1|1106894_1107770_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_075275340.1|1108300_1108909_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375723.1|1109179_1109638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375724.1|1109916_1110306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963658.1|1110491_1111307_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_017375727.1|1111529_1112435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211119.1|1112598_1113360_+	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_017375728.1|1113363_1114230_+	OmpA family protein	NA	NA	NA	NA	NA
WP_017375729.1|1114315_1114927_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_017375730.1|1115305_1116553_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.4e-14
WP_144420800.1|1116704_1117406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420799.1|1117703_1117877_-	phosphatase	NA	NA	NA	NA	NA
WP_048876044.1|1118366_1118867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1119945_1120173_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_144420705.1|1120258_1120459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378184.1|1120487_1121168_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_027242790.1|1121190_1123365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378188.1|1123610_1124681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1124677_1126081_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_146619408.1|1126229_1126715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242789.1|1126786_1127608_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_017378192.1|1128274_1129774_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_017378193.1|1130077_1132771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242788.1|1132767_1136169_+	AAA family ATPase	NA	S5M596	Bacillus_phage	23.3	4.5e-10
WP_048875961.1|1137756_1139160_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378201.1|1140238_1140910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1143818_1144793_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
>prophage 14
NZ_CP039868	Piscirickettsia salmonis strain Psal-113 chromosome, complete genome	3194954	1169516	1225926	3194954	transposase,tRNA	Staphylococcus_phage(28.57%)	51	NA	NA
WP_053093677.1|1169516_1170236_-|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_155046584.1|1170463_1170640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375975.1|1170888_1171212_+	YqcC family protein	NA	NA	NA	NA	NA
WP_036771316.1|1171300_1173319_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_017375977.1|1173341_1174295_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375978.1|1174460_1175648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876036.1|1176361_1177000_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	2.1e-09
WP_036771312.1|1177297_1178293_-	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_027242772.1|1178433_1179480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375767.1|1179472_1180498_+	FUSC family protein	NA	NA	NA	NA	NA
WP_017375766.1|1180564_1182595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1183901_1184129_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017375561.1|1185472_1185616_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_062365727.1|1185612_1186305_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876033.1|1186574_1186889_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_027242770.1|1187031_1187442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242769.1|1187598_1187925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963649.1|1188071_1189109_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_027242767.1|1189150_1189396_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_027242766.1|1189376_1189835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242765.1|1189842_1191417_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_027242764.1|1191571_1192141_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_027242763.1|1192450_1194253_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	5.1e-21
WP_087910649.1|1194249_1195191_+	signal peptidase I	NA	NA	NA	NA	NA
WP_036771308.1|1195218_1195440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242761.1|1195602_1196277_+	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.2	2.2e-25
WP_144420798.1|1196282_1197182_+	GTPase Era	NA	NA	NA	NA	NA
WP_027242759.1|1197195_1197939_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_027242758.1|1197941_1198673_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_027242757.1|1198669_1199053_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_027242756.1|1199190_1200438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242755.1|1200848_1201994_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_027242754.1|1201986_1202340_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_027242753.1|1202620_1203163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927692.1|1203807_1203996_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1204015_1204990_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420702.1|1205033_1205909_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.3	1.4e-19
WP_036815628.1|1206262_1207090_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080963648.1|1207189_1207351_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375762.1|1208001_1209342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1210393_1210621_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027243003.1|1210762_1212124_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_027243002.1|1212219_1212879_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_144420701.1|1213719_1214076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375757.1|1214672_1216232_-	APC family permease	NA	NA	NA	NA	NA
WP_017375893.1|1218776_1219847_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017375892.1|1219904_1220111_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_017375891.1|1220117_1221593_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_017375890.1|1221728_1222292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1222461_1223865_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242999.1|1224831_1225926_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 15
NZ_CP039868	Piscirickettsia salmonis strain Psal-113 chromosome, complete genome	3194954	1242168	1289893	3194954	transposase	Staphylococcus_phage(50.0%)	42	NA	NA
WP_036772169.1|1242168_1243044_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876030.1|1243113_1244217_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774087.1|1244284_1244608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242984.1|1244764_1245547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063491.1|1245682_1246660_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_047927375.1|1246733_1248725_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_017375900.1|1248780_1249062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375899.1|1249315_1250515_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_051929862.1|1252946_1253459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1253645_1254521_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375562.1|1254557_1254722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929523.1|1255930_1256344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774270.1|1256354_1256690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420796.1|1256834_1257953_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876026.1|1258182_1258449_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1259731_1259959_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036773258.1|1259969_1260476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243127.1|1260553_1261171_-	VOC family protein	NA	NA	NA	NA	NA
WP_017376680.1|1261302_1262535_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.3	8.2e-95
WP_017376681.1|1262524_1263187_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_026063554.1|1263461_1264718_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_087910647.1|1264855_1265515_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376683.1|1265589_1266291_+	cyclase family protein	NA	NA	NA	NA	NA
WP_036771330.1|1267038_1268013_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376688.1|1269221_1269575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107517381.1|1269788_1269983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376690.1|1270050_1270563_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376691.1|1270700_1271555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376692.1|1271603_1272248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376693.1|1272281_1272926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243125.1|1273448_1273742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376695.1|1273840_1274623_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_017376696.1|1274705_1275656_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_027243124.1|1277698_1280539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376700.1|1280561_1281143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376701.1|1281262_1281991_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_036771330.1|1282136_1283111_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027243123.1|1283226_1284132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376705.1|1284730_1285477_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376706.1|1285729_1286122_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017376707.1|1286159_1286807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999995.1|1288522_1289893_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP039868	Piscirickettsia salmonis strain Psal-113 chromosome, complete genome	3194954	1313712	1354922	3194954	transposase	Enterobacteria_phage(16.67%)	37	NA	NA
WP_048876023.1|1313712_1314816_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.0e-25
WP_087910645.1|1314906_1316059_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_048876022.1|1316472_1317324_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420700.1|1317461_1317611_-	phosphatase	NA	NA	NA	NA	NA
WP_017377952.1|1318235_1320602_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_017377953.1|1320649_1321846_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_027242965.1|1322414_1324847_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_036773041.1|1325168_1326668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242964.1|1326776_1327349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242963.1|1327663_1329133_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_017377960.1|1329205_1329955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876021.1|1329958_1330732_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_027242961.1|1330830_1331781_-	DMT family transporter	NA	NA	NA	NA	NA
WP_017377963.1|1331920_1333363_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.2	3.5e-20
WP_027242960.1|1333578_1334763_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377966.1|1334886_1335573_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.0	2.8e-28
WP_026063694.1|1335708_1336293_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_144420699.1|1336382_1336712_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017377969.1|1337047_1337287_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_017377970.1|1337335_1337527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275334.1|1338301_1338595_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420698.1|1338743_1338905_-	phosphatase	NA	NA	NA	NA	NA
WP_017378162.1|1339419_1339959_-	porin family protein	NA	NA	NA	NA	NA
WP_017378161.1|1340297_1340942_-	porin family protein	NA	NA	NA	NA	NA
WP_017378160.1|1341275_1341926_-	porin family protein	NA	NA	NA	NA	NA
WP_017378159.1|1342449_1343502_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017378158.1|1343519_1346600_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_027242571.1|1346765_1347014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|1347079_1347955_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036772025.1|1348877_1349384_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_027243218.1|1349401_1349599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420794.1|1349617_1349761_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_155046586.1|1349828_1350002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|1350206_1351520_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_081000010.1|1351529_1351793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1351851_1352826_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377787.1|1354694_1354922_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 17
NZ_CP039868	Piscirickettsia salmonis strain Psal-113 chromosome, complete genome	3194954	1386139	1439873	3194954	transposase,tRNA	Bacillus_thuringiensis_phage(25.0%)	45	NA	NA
WP_036772026.1|1386139_1387015_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242912.1|1387119_1390422_-	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_017376668.1|1390418_1392242_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_017376669.1|1392281_1392680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242911.1|1392788_1393805_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_027242910.1|1394239_1395694_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017376672.1|1395775_1398832_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_081329473.1|1400222_1400642_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376676.1|1401014_1401479_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_075275332.1|1401551_1402553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771585.1|1405445_1405778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420693.1|1406139_1406283_-	phosphatase	NA	NA	NA	NA	NA
WP_048876152.1|1406270_1407215_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420692.1|1407218_1407608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275328.1|1407426_1407765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376273.1|1408139_1408739_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_017376274.1|1408738_1409086_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_026063520.1|1409236_1410220_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	1.3e-34
WP_017376276.1|1411129_1411444_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.9e-06
WP_144420691.1|1411592_1411751_-	phosphatase	NA	NA	NA	NA	NA
WP_144420690.1|1411722_1412652_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	2.2e-60
WP_026063521.1|1413566_1413983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929528.1|1415111_1415828_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376099.1|1416576_1416735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420689.1|1416783_1417359_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_075275424.1|1417503_1417782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376100.1|1417846_1418722_-	ParA family protein	NA	NA	NA	NA	NA
WP_048876018.1|1418887_1422754_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.5	1.6e-51
WP_017376103.1|1422909_1423719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376104.1|1423768_1424590_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376105.1|1424789_1426022_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.2	8.9e-33
WP_017376106.1|1426192_1426918_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_017376107.1|1426960_1428499_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	22.4	2.6e-05
WP_017376108.1|1428505_1429891_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.7	3.4e-49
WP_048876011.1|1430204_1431254_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929549.1|1431813_1432191_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420688.1|1432382_1433258_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1434239_1434467_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876149.1|1434519_1435038_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_146619432.1|1435293_1435485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420793.1|1435893_1436667_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243181.1|1436780_1437752_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017376772.1|1437733_1438705_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420687.1|1439140_1439326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1439336_1439873_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP039868	Piscirickettsia salmonis strain Psal-113 chromosome, complete genome	3194954	1458808	1518718	3194954	transposase,tRNA	Staphylococcus_phage(17.65%)	49	NA	NA
WP_051929845.1|1458808_1459633_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1460036_1461011_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927610.1|1461196_1461790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876013.1|1461970_1462435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910660.1|1462829_1463111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1463107_1464511_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377324.1|1465162_1465543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420686.1|1465782_1466439_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.8	4.7e-41
WP_036773200.1|1466583_1466880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|1466939_1467227_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_036772296.1|1468416_1468794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876011.1|1468993_1470043_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377209.1|1470019_1471837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243049.1|1472107_1472686_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	37.7	2.3e-15
WP_065653751.1|1472713_1473178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377206.1|1473214_1474672_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_027243048.1|1474733_1476221_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_017377202.1|1476990_1477593_-	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_017377201.1|1478154_1478625_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_036772316.1|1480272_1481016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275422.1|1481167_1481599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243044.1|1484236_1485583_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_036772310.1|1485670_1487476_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_017378301.1|1487941_1488739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378302.1|1489123_1489585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1489807_1490782_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963614.1|1490824_1490947_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376833.1|1491018_1492974_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016212182.1|1493363_1493549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376832.1|1493870_1494860_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_027243043.1|1495272_1496898_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.3	3.9e-28
WP_017376830.1|1497006_1497321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876010.1|1497616_1499002_+	protein kinase family protein	NA	A0A1M7XTW9	Cedratvirus	27.7	1.4e-05
WP_017376829.1|1499166_1499394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376828.1|1499534_1499993_-	amino acid permease	NA	NA	NA	NA	NA
WP_144420685.1|1500193_1500379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376827.1|1500447_1501275_-	DsbA family protein	NA	NA	NA	NA	NA
WP_144420792.1|1501729_1502254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376824.1|1502526_1502685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243041.1|1502854_1503808_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_036771330.1|1504002_1504977_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876009.1|1505104_1506130_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1506782_1507070_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_051929542.1|1507129_1507462_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081377820.1|1507666_1508227_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.2	1.6e-37
WP_017376814.1|1510821_1511547_-	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_026063564.1|1511921_1514741_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.3	5.2e-312
WP_048876146.1|1515590_1516724_+	MFS transporter	NA	S4TR35	Salmonella_phage	23.0	2.6e-15
WP_017376809.1|1516948_1518718_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	40.7	4.9e-08
>prophage 19
NZ_CP039868	Piscirickettsia salmonis strain Psal-113 chromosome, complete genome	3194954	1541078	1576519	3194954	protease,transposase,integrase	Staphylococcus_phage(33.33%)	36	1562419:1562478	1572880:1573170
WP_048876008.1|1541078_1542053_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	8.1e-29
WP_144420681.1|1542096_1542282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046590.1|1542461_1542626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774017.1|1542627_1543503_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420680.1|1543818_1544739_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_017375696.1|1544754_1545138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420679.1|1545464_1546421_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_144420678.1|1546688_1546967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243017.1|1547465_1548809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378522.1|1548982_1549162_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_048876007.1|1549205_1550180_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927346.1|1550327_1552199_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_075275322.1|1552231_1552330_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017378518.1|1552565_1553195_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017378517.1|1553178_1553601_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017378516.1|1553607_1555347_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.2	5.8e-54
WP_017378515.1|1555347_1556412_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|1556415_1556769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378514.1|1556881_1557850_+	ferrochelatase	NA	NA	NA	NA	NA
WP_017378513.1|1557859_1558171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|1558186_1558756_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_017378512.1|1559019_1560348_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_036771639.1|1560388_1561363_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420677.1|1561949_1562351_-|transposase	transposase	transposase	NA	NA	NA	NA
1562419:1562478	attL	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTT	NA	NA	NA	NA
WP_146619459.1|1562870_1565327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773893.1|1565529_1566381_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_075275420.1|1566426_1568133_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_069971648.1|1569604_1570579_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_047927336.1|1570941_1571187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065653736.1|1571550_1572579_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_017375591.1|1572709_1572913_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420676.1|1573197_1574154_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.8e-49
1572880:1573170	attR	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTTAGCAGAGCGGAGTTGCGAAAGGCCGTTAGGTCTGTAGCAAGCGTAACGAGTGTCTAAAAATCTATACGAACCGTAGAGTCATGTGAGAGCACAGTAGTGGAGTGTGCCGCTTCAAGGCACGTAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGTCT	NA	NA	NA	NA
WP_047927838.1|1574446_1574692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|1574688_1574988_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_036774927.1|1575210_1575681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|1576291_1576519_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 20
NZ_CP039868	Piscirickettsia salmonis strain Psal-113 chromosome, complete genome	3194954	1581971	1624902	3194954	transposase	Staphylococcus_phage(20.0%)	41	NA	NA
WP_053856766.1|1581971_1583375_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772872.1|1583562_1584420_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243025.1|1584544_1585180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772860.1|1585228_1585480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243027.1|1585735_1586635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375996.1|1586771_1587845_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_017375995.1|1587945_1588359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375994.1|1588379_1589093_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	1.7e-36
WP_027243028.1|1589280_1590693_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243029.1|1590902_1591871_+	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_075275321.1|1592604_1592973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420675.1|1592976_1593294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1593369_1594344_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375989.1|1594863_1595364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243163.1|1595434_1596763_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_036773519.1|1596898_1598287_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_027243165.1|1598434_1599745_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_017375983.1|1600085_1601369_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_017375982.1|1601442_1602063_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_051929832.1|1602261_1602522_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_155046592.1|1602724_1602871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876006.1|1602846_1603440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816364.1|1605303_1605522_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772303.1|1606774_1607545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420790.1|1607631_1607847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376496.1|1607943_1609065_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_036771330.1|1609331_1610306_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771628.1|1610568_1611690_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_017376491.1|1611982_1612270_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420674.1|1612242_1612746_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.7	3.0e-19
WP_053093673.1|1612826_1613486_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876005.1|1613827_1614745_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.4	4.6e-26
WP_075275317.1|1614874_1615048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376487.1|1615713_1617072_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_017376486.1|1617146_1617710_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376485.1|1617904_1619134_-	hypothetical protein	NA	B2YG43	Musca_hytrovirus	21.9	2.6e-08
WP_017376484.1|1619179_1619806_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.2e-33
WP_027242833.1|1619955_1621143_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.3	5.2e-22
WP_048876004.1|1621151_1621844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910642.1|1621965_1623118_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	6.8e-59
WP_048876002.1|1623918_1624902_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.0	4.5e-27
>prophage 21
NZ_CP039868	Piscirickettsia salmonis strain Psal-113 chromosome, complete genome	3194954	1683237	1773552	3194954	protease,transposase,tRNA	Burkholderia_phage(14.29%)	82	NA	NA
WP_036774017.1|1683237_1684113_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377182.1|1684502_1684841_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_026063604.1|1684837_1685434_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_027242821.1|1685436_1687431_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_017377185.1|1687494_1688433_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_036771332.1|1688781_1689756_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_080999986.1|1689959_1690157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000007.1|1690318_1690723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816928.1|1692306_1692747_+	universal stress protein	NA	NA	NA	NA	NA
WP_048875996.1|1693073_1693949_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420669.1|1693961_1694204_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275315.1|1694610_1694865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875874.1|1696076_1697042_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420668.1|1697134_1697446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772584.1|1697646_1698423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816899.1|1699252_1699444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377573.1|1700172_1701222_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	30.8	1.7e-29
WP_017377574.1|1701392_1702166_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	6.5e-66
WP_017377575.1|1702226_1703816_-	APC family permease	NA	NA	NA	NA	NA
WP_017377576.1|1704006_1705098_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_017377577.1|1705120_1705438_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_017377578.1|1705524_1706802_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	9.6e-139
WP_017377579.1|1706823_1707660_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_017377580.1|1707666_1709301_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.5	1.7e-143
WP_026063647.1|1709732_1710092_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_017377583.1|1710373_1711732_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.9	3.1e-71
WP_017377584.1|1711757_1712000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|1712493_1712673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875994.1|1712928_1714185_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377585.1|1714298_1714556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420667.1|1714700_1715711_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.5	2.5e-25
WP_144420786.1|1716087_1716942_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_027242597.1|1716971_1717805_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_036773204.1|1718381_1719155_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_047927606.1|1719236_1719557_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	36.6	3.1e-06
WP_144420665.1|1719775_1720681_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.3e-49
WP_048875992.1|1720766_1721165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856757.1|1721309_1721807_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242786.1|1723479_1724571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929549.1|1724669_1725047_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|1725126_1726101_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_080999985.1|1727645_1728365_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1728448_1728736_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420664.1|1729020_1729893_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.8e-49
WP_048875990.1|1729849_1730626_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036816484.1|1730830_1731166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963600.1|1731564_1731921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377440.1|1732082_1732358_-	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	50.6	6.6e-13
WP_017377441.1|1732467_1732815_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_017377442.1|1732832_1733612_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_017377443.1|1733611_1734121_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_016211283.1|1734156_1734405_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_017377444.1|1734716_1735052_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_017377445.1|1735351_1736602_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242820.1|1736683_1738711_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_017377447.1|1739256_1739475_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_027242819.1|1739646_1740009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875989.1|1740157_1741561_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242818.1|1741842_1743018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377453.1|1743035_1745033_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_027242817.1|1745013_1745994_-	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075275308.1|1746049_1746892_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_036772544.1|1746891_1747308_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_075275307.1|1747288_1747708_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017377459.1|1747730_1748360_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017377460.1|1748928_1751118_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_017377461.1|1751129_1752335_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_080963599.1|1752319_1754167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106215.1|1754151_1755390_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242814.1|1755376_1757245_+	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_027242813.1|1757278_1758532_+	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017377465.1|1758537_1759395_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.3	5.3e-16
WP_017377694.1|1759413_1760142_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_081078114.1|1761280_1762072_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.4	1.9e-44
WP_017376231.1|1762437_1762725_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017376477.1|1764847_1765237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376476.1|1765413_1766172_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_036772166.1|1766168_1768568_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	5.2e-69
WP_027242812.1|1768581_1769859_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.1	7.5e-51
WP_017376475.1|1769948_1771247_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	34.1	2.4e-65
WP_017376474.1|1771444_1772338_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_027242811.1|1772337_1773552_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
>prophage 22
NZ_CP039868	Piscirickettsia salmonis strain Psal-113 chromosome, complete genome	3194954	1784251	1834736	3194954	transposase,tRNA	Vibrio_phage(14.29%)	46	NA	NA
WP_069971651.1|1784251_1785127_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376461.1|1785499_1785763_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_017376460.1|1786069_1788664_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	2.4e-88
WP_017376459.1|1788660_1789143_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_017376458.1|1789120_1790161_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	5.8e-118
WP_017376457.1|1790335_1790821_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.9	8.0e-38
WP_017376456.1|1790928_1793499_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	23.0	3.5e-31
WP_017376455.1|1793532_1793994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773947.1|1794330_1795206_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376452.1|1795483_1797244_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_017376451.1|1797337_1798003_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_017376450.1|1798015_1799521_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.4	7.7e-87
WP_017376449.1|1799542_1800073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376448.1|1800146_1801409_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_017376447.1|1801595_1802468_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_026063532.1|1802569_1803358_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_017376445.1|1803450_1804776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376444.1|1805129_1806305_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_017376443.1|1806473_1807127_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_017376442.1|1807282_1809223_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_036773538.1|1809219_1809843_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036773116.1|1810007_1810982_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_075275305.1|1811253_1811874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|1811870_1813274_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_087910640.1|1813341_1813758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875986.1|1814165_1814663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1814659_1815634_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048875985.1|1815677_1816283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1816427_1816964_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375549.1|1816968_1817265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875983.1|1817273_1817879_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	49.5	6.3e-48
WP_017378212.1|1818064_1818463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420662.1|1818653_1818857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046599.1|1819001_1819157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378213.1|1819281_1819734_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017378214.1|1819850_1821323_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	3.3e-98
WP_016211840.1|1821761_1822226_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_144420785.1|1822914_1824165_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	27.4	1.7e-15
WP_017378219.1|1824274_1824745_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_047927040.1|1824767_1825361_-	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	29.6	1.2e-14
WP_027242798.1|1825498_1826548_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_017378221.1|1826571_1827495_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211418.1|1827511_1827973_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_017378223.1|1828080_1828899_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_155046600.1|1829508_1829652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378228.1|1833815_1834736_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 23
NZ_CP039868	Piscirickettsia salmonis strain Psal-113 chromosome, complete genome	3194954	1897057	1912373	3194954	transposase	Staphylococcus_phage(50.0%)	16	NA	NA
WP_017378288.1|1897057_1897279_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1897337_1898312_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046582.1|1898510_1898675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875973.1|1898671_1899307_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046602.1|1899583_1900363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420658.1|1900395_1901157_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_075275303.1|1901133_1902123_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378290.1|1902258_1903134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242792.1|1903152_1903812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378292.1|1903841_1904048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927801.1|1904053_1904500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1904496_1905900_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378294.1|1906013_1906859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378295.1|1907003_1908653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378296.1|1908743_1909529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875980.1|1910969_1912373_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP039868	Piscirickettsia salmonis strain Psal-113 chromosome, complete genome	3194954	1941046	1982803	3194954	transposase,tRNA	uncultured_Mediterranean_phage(40.0%)	39	NA	NA
WP_144420657.1|1941046_1942108_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420656.1|1942819_1942981_+	phosphatase	NA	NA	NA	NA	NA
WP_017376418.1|1943897_1944437_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_017376419.1|1944819_1945236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376420.1|1945331_1946147_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_017376421.1|1946279_1947773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420655.1|1947958_1948384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376423.1|1948380_1950441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376424.1|1950724_1951540_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_017376425.1|1951640_1952459_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_027242802.1|1952455_1952824_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_075275409.1|1953005_1953833_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|1953896_1954625_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|1955027_1955756_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017376428.1|1956145_1956871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875975.1|1956905_1960778_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_017376430.1|1960978_1962112_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_026063530.1|1962125_1962314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376433.1|1962537_1963896_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.0	3.9e-37
WP_036773947.1|1965502_1966378_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875973.1|1966889_1967525_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999981.1|1967537_1968011_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.0	2.9e-32
WP_155046603.1|1967938_1968091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929627.1|1968284_1968635_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1968694_1968982_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420654.1|1969034_1969814_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376416.1|1969933_1970104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376415.1|1970238_1971156_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_017376414.1|1971207_1971963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242801.1|1972030_1973305_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	1.7e-90
WP_017376412.1|1973425_1974103_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_017376411.1|1974303_1975728_+	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	33.4	3.9e-40
WP_016209938.1|1975702_1976341_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017376410.1|1976703_1976982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376409.1|1977215_1978160_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	2.4e-38
WP_017376408.1|1978181_1980050_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_017376407.1|1980070_1980424_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.5	1.1e-07
WP_026063528.1|1980462_1981578_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.2	2.2e-94
WP_017376405.1|1981762_1982803_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
>prophage 25
NZ_CP039868	Piscirickettsia salmonis strain Psal-113 chromosome, complete genome	3194954	1987146	2043216	3194954	transposase,tRNA	Klosneuvirus(22.22%)	49	NA	NA
WP_017376399.1|1987146_1989918_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.4	6.9e-150
WP_017376398.1|1990074_1991307_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|1991548_1992211_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_017376397.1|1992670_1994152_+	MFS transporter	NA	NA	NA	NA	NA
WP_036773116.1|1994349_1995324_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376395.1|1995847_1998574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|1999461_2000436_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_051929562.1|2000686_2001391_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377436.1|2002630_2003149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242883.1|2004116_2005601_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_017377433.1|2005725_2007261_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017377432.1|2007283_2007613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963636.1|2007509_2007725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910639.1|2009708_2010908_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_017377428.1|2011117_2011978_-	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_017377427.1|2012093_2012672_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_017377426.1|2012828_2013470_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.5	3.3e-07
WP_017377425.1|2013508_2013730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377424.1|2013722_2014706_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	6.2e-53
WP_080963565.1|2015099_2015597_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_026063633.1|2015741_2016017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377423.1|2016168_2017851_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.0	2.1e-24
WP_017377422.1|2017858_2018881_-	YHYH protein	NA	NA	NA	NA	NA
WP_017377421.1|2019049_2020051_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_017377420.1|2020164_2020503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377419.1|2020978_2022238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|2022446_2022674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420653.1|2022702_2022921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772807.1|2023058_2023424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772810.1|2023491_2023734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242887.1|2023748_2024084_-	flagellar protein FliT	NA	NA	NA	NA	NA
WP_017377418.1|2024088_2024526_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_036772812.1|2024551_2025937_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_036772815.1|2026047_2026479_-	flaG family protein	NA	NA	NA	NA	NA
WP_144420782.1|2026584_2028096_-	B-type flagellin	NA	NA	NA	NA	NA
WP_017377414.1|2028386_2029979_-	flagellin	NA	NA	NA	NA	NA
WP_027242888.1|2030179_2032375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772819.1|2032468_2033902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927084.1|2033944_2034460_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036772822.1|2034459_2035407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242892.1|2035390_2036056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242893.1|2036052_2036781_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_047927085.1|2036770_2037517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963566.1|2037500_2038565_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_017377789.1|2038769_2039957_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377788.1|2040013_2041132_-	hypothetical protein	NA	A0A1V0SIK8	Klosneuvirus	29.3	1.0e-11
WP_047927086.1|2041579_2041837_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.8	4.1e-09
WP_144420652.1|2042116_2042794_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	2.6e-34
WP_017375591.1|2043012_2043216_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP039868	Piscirickettsia salmonis strain Psal-113 chromosome, complete genome	3194954	2062916	2112450	3194954	protease,transposase,tRNA	Burkholderia_virus(20.0%)	42	NA	NA
WP_017377787.1|2062916_2063144_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377765.1|2063233_2063989_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377764.1|2064402_2064999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377763.1|2065078_2067883_+	response regulator	NA	A0A1V0SGX0	Hokovirus	31.8	6.9e-57
WP_017377762.1|2067863_2068817_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377761.1|2068809_2070180_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_080999971.1|2070350_2071754_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275295.1|2072525_2072852_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420651.1|2073056_2073710_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	33.1	5.8e-15
WP_017376600.1|2074029_2074209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420650.1|2074464_2075721_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999979.1|2075959_2076106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081049196.1|2076188_2076545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774918.1|2077040_2077400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375623.1|2077409_2077793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420649.1|2078681_2078822_+	phosphatase	NA	NA	NA	NA	NA
WP_048875965.1|2078966_2079887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377998.1|2082044_2082575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243145.1|2082585_2083641_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_036773465.1|2083656_2085696_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.9	7.1e-128
WP_017378003.1|2085682_2086513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378004.1|2086579_2090119_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_017378005.1|2090232_2090952_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_017378006.1|2091190_2091820_+	response regulator	NA	NA	NA	NA	NA
WP_048875961.1|2091939_2093343_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378007.1|2093488_2095432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243143.1|2095949_2096810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155589445.1|2097245_2097485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155589446.1|2098081_2098990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420648.1|2099392_2100865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053093668.1|2101047_2101647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420647.1|2101784_2101982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046604.1|2102182_2102323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875964.1|2102390_2103170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376708.1|2103734_2104136_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773793.1|2104280_2104658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242834.1|2105117_2106425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619530.1|2107173_2107431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|2107482_2108886_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377869.1|2109126_2110836_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017377870.1|2111005_2111368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875960.1|2111475_2112450_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 27
NZ_CP039868	Piscirickettsia salmonis strain Psal-113 chromosome, complete genome	3194954	2127019	2175713	3194954	protease,transposase,tRNA	unidentified_phage(15.38%)	50	NA	NA
WP_017377892.1|2127019_2128441_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_026063687.1|2128530_2130129_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_017377894.1|2130285_2130912_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_027242839.1|2130992_2133665_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_017377896.1|2134147_2135104_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_017377897.1|2135156_2135576_+	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.2e-05
WP_048875958.1|2135602_2136466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377899.1|2136455_2137247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|2137551_2138523_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375746.1|2138871_2139180_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	41.4	1.7e-09
WP_048875957.1|2139176_2139833_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	9.6e-10
WP_017375749.1|2139966_2140452_-	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_017375750.1|2140529_2141051_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017375751.1|2141096_2141990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242840.1|2141986_2142808_-	ParA family protein	NA	H7BUL8	unidentified_phage	33.0	3.9e-16
WP_155046605.1|2143002_2143152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275292.1|2143379_2144210_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046606.1|2145615_2145786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242841.1|2145938_2147342_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_144420645.1|2147451_2148708_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_080963644.1|2148679_2149411_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_017376088.1|2149422_2150700_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	3.6e-21
WP_017376087.1|2150799_2151174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376086.1|2151258_2152146_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376085.1|2152203_2152932_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_036771725.1|2152928_2154038_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_017376083.1|2154189_2154618_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.8e-17
WP_144420777.1|2154712_2155069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376081.1|2155061_2156273_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376080.1|2156269_2157058_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_017376079.1|2157220_2158015_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_017376078.1|2158464_2159205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376077.1|2159208_2161707_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	42.9	2.4e-85
WP_017376076.1|2161969_2162926_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_036771709.1|2162909_2163671_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_048875955.1|2163878_2164853_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_048875954.1|2164961_2165717_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211259.1|2165841_2166087_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_017376072.1|2166146_2168420_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.3e-167
WP_036772670.1|2168474_2168777_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	7.5e-10
WP_016211261.1|2169017_2169311_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_065653731.1|2169481_2169661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420644.1|2169736_2170348_-	DedA family protein	NA	NA	NA	NA	NA
WP_017376068.1|2170594_2171911_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211263.1|2171921_2172290_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_017376067.1|2172320_2172983_-	adenylate kinase	NA	NA	NA	NA	NA
WP_144420776.1|2173405_2173984_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.3	6.9e-20
WP_017376065.1|2173963_2174371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999977.1|2174494_2174791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2174837_2175713_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP039868	Piscirickettsia salmonis strain Psal-113 chromosome, complete genome	3194954	2182658	2327674	3194954	transposase,tRNA,integrase	Staphylococcus_phage(20.83%)	116	2274559:2274618	2324980:2325740
WP_144420643.1|2182658_2183972_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046586.1|2184176_2184350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773960.1|2184619_2185093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420642.1|2185237_2185432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063502.1|2185696_2186572_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016210558.1|2186758_2187514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376051.1|2187587_2189240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376050.1|2189279_2190818_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.4	2.1e-71
WP_087910638.1|2190817_2192518_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_075275404.1|2192606_2193782_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_017376046.1|2193820_2194783_-	formimidoylglutamase	NA	NA	NA	NA	NA
WP_017376045.1|2195060_2195483_-	universal stress protein	NA	NA	NA	NA	NA
WP_017376044.1|2195788_2196430_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_017376043.1|2196558_2197893_+	dihydroorotase	NA	NA	NA	NA	NA
WP_048875952.1|2198007_2198643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771517.1|2199387_2200524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771498.1|2200707_2202438_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_017376037.1|2202427_2203636_+	MFS transporter	NA	NA	NA	NA	NA
WP_075275290.1|2203734_2204736_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420641.1|2204979_2205615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2205634_2206609_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048875951.1|2206652_2207489_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376035.1|2207634_2208054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420640.1|2208330_2209011_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875949.1|2208976_2209327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376032.1|2209359_2210571_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017376031.1|2210911_2211541_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_017376030.1|2211589_2212606_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	1.8e-100
WP_016211035.1|2212852_2213068_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_017376029.1|2213120_2213570_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.9	1.4e-20
WP_027243175.1|2213649_2215395_+	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	36.7	7.6e-46
WP_017376026.1|2215486_2217358_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	28.4	1.4e-34
WP_053093667.1|2217802_2218519_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378197.1|2219956_2220826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2220782_2221010_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017378198.1|2221978_2222893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875948.1|2222938_2223961_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.4	3.9e-135
WP_048875947.1|2224029_2225079_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155052687.1|2225707_2225878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243219.1|2226162_2226471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2226637_2228041_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376857.1|2228067_2228298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771959.1|2228619_2228844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875946.1|2228854_2230066_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.8e-25
WP_036774710.1|2230460_2231360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375571.1|2231533_2231935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275287.1|2232181_2233225_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376859.1|2233344_2233581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376860.1|2234369_2235923_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_082300723.1|2238103_2238331_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971648.1|2239201_2240176_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_017375736.1|2240902_2241985_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_017375735.1|2242027_2242678_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375734.1|2242900_2243272_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_027243178.1|2243382_2244744_+	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	35.5	4.3e-12
WP_155046609.1|2246464_2246671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|2246981_2248064_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2248060_2248372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2249417_2250392_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999976.1|2251398_2252178_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_048875943.1|2252639_2253857_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275285.1|2254032_2255469_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211781.1|2255691_2256939_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_036773927.1|2257429_2258065_-	peroxiredoxin C	NA	NA	NA	NA	NA
WP_017377683.1|2258616_2260119_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_144420775.1|2260177_2263942_+	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_017377681.1|2264090_2265269_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	31.6	7.7e-50
WP_027243160.1|2265556_2266087_-	prokaryotic cytochrome b561 family protein	NA	NA	NA	NA	NA
WP_017377679.1|2266184_2266391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|2266706_2267789_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2267785_2268097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243152.1|2269594_2270530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774146.1|2271122_2272268_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_048875940.1|2274510_2275674_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
2274559:2274618	attL	GTCTTAGAGGTCATTGAAGGAGATCAGACGCTCAACCAAATATGCTCGAAATATGAGCTA	NA	NA	NA	NA
WP_144420637.1|2275702_2275927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815620.1|2277274_2278450_-	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_144420636.1|2278795_2281306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420635.1|2281364_2282177_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377669.1|2282617_2283322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2283371_2284346_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420634.1|2284450_2285782_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420774.1|2285980_2286049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375857.1|2286180_2287623_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420773.1|2288014_2289427_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_017375855.1|2290116_2290563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875936.1|2291157_2292006_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.4	1.4e-16
WP_017376916.1|2292259_2293318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927497.1|2293309_2295016_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.3	3.6e-24
WP_036774028.1|2295087_2296821_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.0	1.6e-32
WP_017376912.1|2297117_2297684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376911.1|2297808_2298462_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_027243158.1|2298488_2299949_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017376909.1|2300045_2301023_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_048875878.1|2301492_2302896_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063577.1|2303421_2303715_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_026063576.1|2303941_2304706_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	6.3e-29
WP_017376905.1|2304913_2305141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243159.1|2305204_2305387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376903.1|2305949_2306129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376902.1|2306192_2306504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929562.1|2307358_2308063_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376899.1|2308260_2308401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772665.1|2308805_2309330_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_144420633.1|2309476_2310733_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875935.1|2310800_2311280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2311720_2313124_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243186.1|2313538_2315920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377475.1|2316426_2318319_-	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.3	3.6e-81
WP_036771639.1|2318490_2319465_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377472.1|2319768_2320575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377471.1|2320643_2321255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377467.1|2322736_2323033_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_075275282.1|2323029_2323872_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420631.1|2324262_2325048_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	29.7	1.2e-06
WP_080999974.1|2325052_2326456_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
2324980:2325740	attR	TAGCTCATATTTCGAGCATATTTGGTTGAGCGTCTGATCTCCTTCAATGACCTCTAAGACTAATGGCACTACCTTAAGGAGCGGATGAACATTTTTTATTGCTATTTTTCTTCATTCTTTTAGTTATTTCTGCCTTTTCCAATTCCCTGCTTTTATTCAGTCGCCTGAATGCTTTGGGACGTTTTTTAACAGCCCGAGGTTCAATCCGTCCAGGCCTATTCCCAACCTTGTTTTTTATGATTGCATGCAACAATATTGCATGGGCTTTATTACAGTCTGCCGAGAAACTGAGTAATGACACAAAGCTATTAAATAACTGTATTACATCCTTGAAACTAACCTGTATAGGAAGGCGTTCAGTATTACGACAAGCTTCTGCAATAAGCGTTCTAATTAAGTTGTATGCTAAAAAGTGTACTGCAATTTCTTTATGTACCATGTCAGGTGTCTTACTTCTTAAATGATCCATTGACATAATGGTTTTTAAGCTGTTGAAATTGATTTCAATGTGCCACCTTTGTTTGTAATGATTAGCCAATGCAACTTTATTGTATTTTTTATGATCTTGAAAAGTTGTTACATAAACCTCCCCTTTGATTTTGAACTCTCTTACCGTCATTTGATCAGGATAACTATCGTATGTTTCTTGTGTCATCCAGTCAGGTTTGTGAGGCTTTTTCCAAATGACAAGGTGATTTTTTGAACCCAACTTCCTTCCTTTACGAAAGTCATACTTCCTCTGTGAATGTGCTTTAAAAATA	NA	NA	NA	NA
WP_048875933.1|2326729_2327674_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP039868	Piscirickettsia salmonis strain Psal-113 chromosome, complete genome	3194954	2348516	2376169	3194954	protease,transposase	Staphylococcus_phage(25.0%)	28	NA	NA
WP_017377305.1|2348516_2349818_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	6.5e-135
WP_016209647.1|2349899_2350505_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_017377304.1|2350617_2351922_-	trigger factor	NA	NA	NA	NA	NA
WP_017377303.1|2352522_2353398_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	9.8e-34
WP_075275279.1|2353513_2354185_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_017377301.1|2354364_2355720_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_017377300.1|2355840_2356578_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_144420629.1|2356656_2357373_-	aldolase	NA	NA	NA	NA	NA
WP_036771756.1|2358021_2359296_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209646.1|2359326_2359902_+	VOC family protein	NA	NA	NA	NA	NA
WP_017377295.1|2359946_2360912_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.1	1.8e-44
WP_027243030.1|2361375_2362284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875931.1|2362671_2362923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377293.1|2363067_2363496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875930.1|2363481_2364426_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046611.1|2364630_2364783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910637.1|2364811_2365546_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.3	2.0e-24
WP_017377288.1|2365640_2365901_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080999973.1|2366119_2367085_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.6	2.0e-48
WP_146619452.1|2367061_2367358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875928.1|2367548_2367998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376821.1|2368257_2368686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999972.1|2368781_2369282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000005.1|2369218_2369380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420627.1|2370260_2370482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093666.1|2371980_2372658_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.4	1.4e-48
WP_081377824.1|2373972_2374311_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2375194_2376169_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 30
NZ_CP039868	Piscirickettsia salmonis strain Psal-113 chromosome, complete genome	3194954	2415413	2448862	3194954	transposase,tRNA	Burkholderia_virus(33.33%)	23	NA	NA
WP_080999971.1|2415413_2416817_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377224.1|2416930_2417506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|2418751_2418979_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377221.1|2419268_2419808_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_027243151.1|2420117_2421605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300719.1|2421656_2422082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2422300_2423704_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377217.1|2423700_2424078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243150.1|2424037_2424583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927663.1|2424978_2426205_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377214.1|2426805_2428458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046613.1|2428394_2428589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963645.1|2428921_2430112_-	MFS transporter	NA	NA	NA	NA	NA
WP_027243147.1|2430360_2433033_-	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_027243146.1|2433321_2434158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420769.1|2434818_2435709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2436177_2437152_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876012.1|2437636_2439040_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876012.1|2439185_2440589_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420624.1|2440673_2442488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999970.1|2444399_2445803_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376197.1|2445836_2447366_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.6	1.1e-85
WP_017376198.1|2447401_2448862_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
>prophage 31
NZ_CP039868	Piscirickettsia salmonis strain Psal-113 chromosome, complete genome	3194954	2484313	2542877	3194954	transposase,tRNA	Burkholderia_virus(28.57%)	55	NA	NA
WP_036773116.1|2484313_2485288_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_048875923.1|2485340_2486336_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2486378_2487353_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376319.1|2487977_2488658_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_017376318.1|2488657_2489467_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_027242903.1|2489540_2493221_-	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_026063524.1|2493230_2494718_-	ribonuclease G	NA	NA	NA	NA	NA
WP_017376313.1|2494727_2495345_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_017376312.1|2495414_2495933_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_017376311.1|2495929_2496829_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210526.1|2496844_2497888_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_017376309.1|2498085_2498373_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_017376308.1|2498493_2499954_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_027242902.1|2500033_2501470_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_036771325.1|2501594_2502569_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420621.1|2504759_2505521_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|2506678_2506906_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377706.1|2507859_2508072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875919.1|2508089_2508407_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242901.1|2508433_2509123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377709.1|2509463_2509667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420768.1|2509798_2510734_+	EamA family transporter	NA	NA	NA	NA	NA
WP_047927332.1|2510746_2511529_-	lipoprotein	NA	NA	NA	NA	NA
WP_017377712.1|2511658_2511970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242900.1|2512313_2512640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377714.1|2512664_2513120_-	arginine repressor	NA	NA	NA	NA	NA
WP_017377715.1|2513109_2514162_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	3.1e-10
WP_017377716.1|2514164_2515628_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_017377787.1|2515762_2515990_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377718.1|2517406_2517871_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_036773913.1|2518127_2518943_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377721.1|2519071_2521384_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_017377722.1|2521500_2522028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377723.1|2522719_2523997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377724.1|2524007_2524259_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.6	3.9e-20
WP_017377725.1|2524292_2524814_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_017377726.1|2524983_2525970_-	transaldolase	NA	V5UTB0	Synechococcus_phage	33.5	1.3e-13
WP_017377727.1|2526060_2526876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773915.1|2527304_2527700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2527672_2527900_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_047927746.1|2528868_2529456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046614.1|2530058_2530730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875918.1|2530874_2531456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420767.1|2531498_2532176_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027243185.1|2532454_2533411_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.6	6.3e-34
WP_017377736.1|2533470_2534136_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017377737.1|2534169_2534715_-	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_155046615.1|2534994_2535156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774946.1|2535852_2536467_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	35.1	3.8e-16
WP_144420620.1|2536393_2537596_+	MFS transporter	NA	NA	NA	NA	NA
WP_048875923.1|2537581_2538577_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875916.1|2538580_2538985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2539952_2540180_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971647.1|2541148_2541745_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046616.1|2541713_2542877_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	31.4	2.1e-20
>prophage 32
NZ_CP039868	Piscirickettsia salmonis strain Psal-113 chromosome, complete genome	3194954	2552598	2604012	3194954	transposase,tRNA	Bacillus_phage(20.0%)	55	NA	NA
WP_048876031.1|2552598_2554002_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963580.1|2554107_2554332_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243133.1|2554514_2555336_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377842.1|2555481_2555736_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377841.1|2556124_2557909_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_017377840.1|2557997_2558717_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_027243134.1|2558878_2559085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243135.1|2559084_2559321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420766.1|2559333_2559687_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243136.1|2560224_2561058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377835.1|2561150_2561348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063682.1|2561445_2562831_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_017377833.1|2562957_2563548_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_017377223.1|2564579_2564867_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_155046582.1|2564926_2565091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910635.1|2565087_2566458_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963670.1|2566824_2568237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875909.1|2568306_2569077_+|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_027243138.1|2569569_2569857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377700.1|2571333_2571627_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_144420618.1|2571584_2572406_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	1.2e-41
WP_026063680.1|2572550_2572775_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_155046618.1|2573029_2573557_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.9	3.8e-33
WP_080999968.1|2573733_2573994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420617.1|2573912_2574068_+	phosphatase	NA	NA	NA	NA	NA
WP_036771330.1|2574166_2575141_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999967.1|2576469_2576619_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377700.1|2576735_2577029_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_017376598.1|2577837_2578413_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_017376597.1|2578490_2579366_-	hypothetical protein	NA	A0A140B3P3	Vibrio_phage	24.0	1.8e-11
WP_017376596.1|2579430_2580051_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027243040.1|2580035_2581118_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.2	1.4e-18
WP_017376593.1|2581351_2581756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376591.1|2583246_2584548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376590.1|2584694_2585363_+	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	4.7e-28
WP_144420764.1|2586295_2586859_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017376588.1|2586915_2588112_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.8	2.8e-07
WP_017376587.1|2588236_2589601_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_017376586.1|2589597_2590689_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_017376585.1|2590943_2591594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927249.1|2591786_2591981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963588.1|2592088_2592241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376583.1|2592507_2593635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063543.1|2593724_2594558_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_017376581.1|2594561_2595212_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.9e-19
WP_017376580.1|2595201_2596041_-	hypothetical protein	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.2	4.2e-10
WP_016210074.1|2596046_2596673_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_017376579.1|2596833_2597376_+	septation protein A	NA	NA	NA	NA	NA
WP_017376578.1|2597459_2597762_+	YciI family protein	NA	NA	NA	NA	NA
WP_144420763.1|2597779_2598022_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_017376576.1|2598120_2598393_+	DUF1315 family protein	NA	NA	NA	NA	NA
WP_017376575.1|2598431_2599070_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376574.1|2599102_2600194_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376573.1|2600365_2602108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2603037_2604012_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 33
NZ_CP039868	Piscirickettsia salmonis strain Psal-113 chromosome, complete genome	3194954	2613306	2657021	3194954	transposase,tRNA	Staphylococcus_phage(30.0%)	41	NA	NA
WP_080999966.1|2613306_2614656_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242585.1|2614953_2615511_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376558.1|2615604_2616111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376557.1|2616615_2617311_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	1.2e-10
WP_144420615.1|2617441_2618230_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_048876031.1|2618263_2619667_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875857.1|2620090_2621065_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017377787.1|2621321_2621549_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377821.1|2622636_2623167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377820.1|2623163_2624696_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|2624692_2625643_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|2626063_2626696_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|2626938_2627136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|2627485_2627914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377819.1|2627991_2628987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856754.1|2629131_2629383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377818.1|2629487_2630132_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|2630367_2630865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2631376_2632351_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017377700.1|2632721_2633015_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_017375632.1|2633827_2634163_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017377815.1|2634483_2636022_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_144420614.1|2636174_2637273_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_036773165.1|2637511_2638711_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_027243005.1|2638741_2639368_+	ribonuclease T	NA	NA	NA	NA	NA
WP_017377811.1|2639396_2640281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275272.1|2640414_2640645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243006.1|2640782_2642024_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_144420613.1|2642303_2642675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377803.1|2644806_2644968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377802.1|2645343_2646471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377801.1|2646587_2647250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377800.1|2647335_2647596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875907.1|2648014_2648776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377799.1|2650837_2651497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377798.1|2651597_2652248_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_075275388.1|2652395_2653085_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377795.1|2653107_2654271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377794.1|2654475_2654727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046691.1|2655250_2655847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2656046_2657021_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
>prophage 34
NZ_CP039868	Piscirickettsia salmonis strain Psal-113 chromosome, complete genome	3194954	2671698	2731767	3194954	transposase,tRNA	Staphylococcus_phage(26.67%)	56	NA	NA
WP_048875904.1|2671698_2672574_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420759.1|2672694_2673195_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376501.1|2673191_2673458_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_048875903.1|2673623_2674598_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_075275269.1|2674777_2675398_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|2675704_2677108_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771922.1|2677942_2679133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377263.1|2679699_2680167_-	DoxX family protein	NA	NA	NA	NA	NA
WP_017377264.1|2680668_2680923_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377265.1|2681124_2681628_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_036771941.1|2681844_2682450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210168.1|2682610_2683294_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017377268.1|2683369_2684149_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_017377269.1|2684135_2684996_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_017377270.1|2685119_2685485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377271.1|2685870_2686200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875901.1|2686610_2687585_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_144420611.1|2688119_2688320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155052690.1|2688352_2689684_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	45.7	2.4e-36
WP_017377275.1|2690766_2691489_+	aquaporin family protein	NA	M1H9L8	Acanthocystis_turfacea_Chlorella_virus	37.6	1.6e-26
WP_017377276.1|2691480_2691849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243089.1|2692111_2693413_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377277.1|2693508_2693952_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_017377278.1|2693955_2694465_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_017377279.1|2694457_2697271_-|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	26.8	1.0e-76
WP_048875900.1|2697767_2698700_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.4e-27
WP_017377282.1|2698804_2699731_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	1.6e-10
WP_017377283.1|2699909_2701448_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_016210764.1|2701621_2701882_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_017377686.1|2703156_2703765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|2703811_2704540_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_155046620.1|2704786_2704924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377696.1|2706086_2706626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420758.1|2706860_2707772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377698.1|2708031_2708328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910634.1|2708672_2709826_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	2.3e-59
WP_017377702.1|2710422_2710971_-	DUF2058 family protein	NA	NA	NA	NA	NA
WP_144420757.1|2711074_2711638_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_017377704.1|2711855_2712614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927402.1|2713889_2714117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|2714339_2714519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971672.1|2714774_2716031_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875897.1|2716098_2716743_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.2	2.7e-09
WP_017378393.1|2717547_2717754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816949.1|2718754_2719153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378390.1|2719346_2720924_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_017378389.1|2721057_2721999_+	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	1.7e-20
WP_017378388.1|2722000_2722774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963621.1|2724382_2724589_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_016211707.1|2724855_2725143_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_017378384.1|2725148_2727530_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378383.1|2727542_2728538_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	36.5	3.2e-33
WP_016210495.1|2728669_2729029_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_017378382.1|2729071_2729266_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_075273353.1|2729300_2729831_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_017378381.1|2729835_2731767_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.0	3.1e-117
>prophage 35
NZ_CP039868	Piscirickettsia salmonis strain Psal-113 chromosome, complete genome	3194954	2769545	2822574	3194954	transposase	Staphylococcus_phage(50.0%)	45	NA	NA
WP_048875857.1|2769545_2770520_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017378343.1|2770676_2772251_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	21.3	9.4e-11
WP_017378342.1|2772475_2772754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378341.1|2772823_2773699_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_016210208.1|2773708_2774869_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_017378340.1|2774983_2776132_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_017378339.1|2776142_2778944_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_017378338.1|2779050_2779749_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_017378337.1|2779761_2781525_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_016210223.1|2781528_2781876_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_017378336.1|2781869_2782244_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_017378335.1|2783191_2784475_+	citrate synthase	NA	NA	NA	NA	NA
WP_017378334.1|2784884_2786180_+	MFS transporter	NA	NA	NA	NA	NA
WP_017378333.1|2786535_2787081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242732.1|2787668_2788190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420607.1|2788201_2789581_-	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
WP_017378329.1|2789816_2790251_-	flagellar export protein FliJ	NA	NA	NA	NA	NA
WP_017378328.1|2790247_2791600_-	flagellar protein export ATPase FliI	NA	NA	NA	NA	NA
WP_027242734.1|2791599_2792715_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_017378326.1|2792715_2793732_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_017378325.1|2793721_2795392_-	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_017378324.1|2795411_2795747_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_036772382.1|2795774_2797214_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_047927447.1|2797210_2798257_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017378320.1|2798399_2799896_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_017378319.1|2800191_2801193_+	glucokinase	NA	NA	NA	NA	NA
WP_080963617.1|2801298_2801910_-	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_144420755.1|2802030_2802408_-	DUF1425 domain-containing protein	NA	NA	NA	NA	NA
WP_027242736.1|2802458_2803865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378315.1|2803858_2804926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378314.1|2805032_2806634_-	APC family permease	NA	NA	NA	NA	NA
WP_027242737.1|2806882_2807800_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027242738.1|2807868_2809563_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.3	5.3e-20
WP_017378310.1|2809797_2810727_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_048876031.1|2810757_2812161_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378308.1|2812391_2813096_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_017378307.1|2813162_2813819_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_036774478.1|2813829_2814711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242739.1|2814881_2817551_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.5	5.5e-19
WP_036771639.1|2817911_2818886_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_036771744.1|2818965_2819937_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2819990_2820965_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036772729.1|2821084_2821306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420754.1|2821369_2821678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772743.1|2821602_2822574_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 36
NZ_CP039868	Piscirickettsia salmonis strain Psal-113 chromosome, complete genome	3194954	2837140	2891401	3194954	transposase	Staphylococcus_phage(37.5%)	51	NA	NA
WP_026063658.1|2837140_2837869_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	1.3e-44
WP_027243070.1|2838178_2838433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420605.1|2839146_2841801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378171.1|2841839_2842130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963628.1|2842246_2843545_+	MFS transporter	NA	NA	NA	NA	NA
WP_036772686.1|2844115_2844604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420604.1|2844584_2844887_+	VUT family protein	NA	NA	NA	NA	NA
WP_075275265.1|2845133_2845622_+	VUT family protein	NA	NA	NA	NA	NA
WP_027243073.1|2845655_2846294_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243074.1|2846415_2846955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243075.1|2847044_2848271_-	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_155046619.1|2848883_2849141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420603.1|2849227_2850127_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420602.1|2850271_2850538_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046623.1|2850529_2850679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971671.1|2850906_2851782_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375625.1|2851911_2852139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815640.1|2852205_2852400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774259.1|2852458_2853433_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963634.1|2853470_2853659_+	DUF4286 family protein	NA	NA	NA	NA	NA
WP_017376778.1|2853659_2855432_-	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_144420601.1|2855421_2856414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376776.1|2857021_2857714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376774.1|2858200_2858770_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	40.3	4.5e-32
WP_036771639.1|2858766_2859741_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_080999963.1|2859780_2860284_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_053856766.1|2860374_2861778_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420600.1|2862476_2862662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|2862767_2864171_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420599.1|2864175_2864748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375939.1|2864781_2866209_-	amino acid permease	NA	NA	NA	NA	NA
WP_036772717.1|2867494_2869864_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.4	3.7e-160
WP_017375937.1|2869939_2870758_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_027243188.1|2871109_2871655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971669.1|2872137_2873376_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2873352_2874327_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017375625.1|2874419_2874647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376551.1|2874651_2875143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243039.1|2875815_2876703_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_027243038.1|2876792_2878283_-	sodium:solute symporter	NA	A0A219Y9P9	Aeromonas_phage	23.8	8.0e-20
WP_017376549.1|2878306_2879188_-	ROK family protein	NA	NA	NA	NA	NA
WP_017376548.1|2879184_2879907_-	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_017376547.1|2880606_2881398_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_016210862.1|2881584_2881830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420598.1|2881981_2882212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376543.1|2882241_2883021_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_047927468.1|2883046_2883352_-	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_144420752.1|2883348_2884242_-	DNA polymerase III subunit delta'	NA	S5WKH4	Pseudomonas_phage	33.8	2.3e-14
WP_027243035.1|2884597_2885896_+	MFS transporter	NA	NA	NA	NA	NA
WP_017376538.1|2888498_2889680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999962.1|2889973_2891401_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 37
NZ_CP039868	Piscirickettsia salmonis strain Psal-113 chromosome, complete genome	3194954	2898987	2948664	3194954	transposase,tRNA	Bodo_saltans_virus(14.29%)	43	NA	NA
WP_062312049.1|2898987_2900355_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243033.1|2900847_2901327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875888.1|2901506_2903570_-	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	3.9e-17
WP_144420751.1|2903578_2904304_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_017375919.1|2904931_2905645_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017375920.1|2905649_2906180_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_017375921.1|2906414_2906648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971668.1|2906760_2907009_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	56.1	2.9e-07
WP_144420596.1|2907816_2910009_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.9	3.5e-141
WP_017375924.1|2910026_2910335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963635.1|2910988_2912698_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017378284.1|2912891_2913047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875887.1|2914449_2915325_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027243077.1|2915650_2916412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376853.1|2916636_2917368_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_017376852.1|2917364_2917901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376851.1|2917954_2918719_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_017376850.1|2918721_2920299_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_017376849.1|2920305_2920782_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774056.1|2920757_2921189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376847.1|2921221_2921977_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016210632.1|2922151_2922439_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_027243078.1|2922821_2923046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376846.1|2923385_2924549_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_027243079.1|2924583_2925561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963586.1|2925554_2926241_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_017376843.1|2926179_2927295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376842.1|2927574_2928180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420595.1|2928417_2928897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999961.1|2930719_2931373_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_027243083.1|2931485_2932037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2932136_2933111_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027243084.1|2933396_2933921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376838.1|2934618_2935443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875886.1|2935698_2936055_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_053856766.1|2936051_2937455_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243085.1|2937574_2938135_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_017376236.1|2938292_2938859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243087.1|2941655_2942351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376234.1|2942391_2942604_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376229.1|2944176_2945286_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	1.7e-35
WP_017376228.1|2945341_2946823_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	5.3e-48
WP_048876031.1|2947260_2948664_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 38
NZ_CP039868	Piscirickettsia salmonis strain Psal-113 chromosome, complete genome	3194954	3076346	3141595	3194954	protease,transposase	Hokovirus(14.29%)	55	NA	NA
WP_017376170.1|3076346_3077447_-|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.3	1.4e-21
WP_017376171.1|3077804_3078779_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771588.1|3078915_3079794_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.9	2.0e-39
WP_016209597.1|3079801_3080032_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	40.7	1.0e-06
WP_036771607.1|3080085_3081090_-	OmpA family protein	NA	NA	NA	NA	NA
WP_036771589.1|3081308_3082136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420747.1|3082217_3083606_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_017376176.1|3083893_3085294_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.1	4.0e-53
WP_017376177.1|3085388_3086315_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	44.2	3.0e-57
WP_027242699.1|3086311_3087448_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_027242700.1|3087444_3088452_-	glycosyltransferase family 4 protein	NA	B6EFC4	Stygiolobus_rod-shaped_virus	35.1	3.4e-06
WP_027242701.1|3088448_3089612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376183.1|3089621_3090473_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027242702.1|3090504_3091677_-	glycerophosphotransferase	NA	NA	NA	NA	NA
WP_065653741.1|3091673_3093062_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_017376186.1|3093090_3093498_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.4	1.3e-28
WP_017376187.1|3093517_3094525_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	49.7	3.0e-79
WP_017376188.1|3094521_3095394_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	58.7	1.6e-92
WP_036771610.1|3095390_3096251_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.1	1.3e-67
WP_065653742.1|3096252_3098523_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_017376192.1|3098524_3099670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376193.1|3099716_3100202_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_027242703.1|3100241_3100865_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_017376237.1|3106544_3107297_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027243062.1|3108628_3109252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243063.1|3109356_3110145_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_027243064.1|3110144_3110876_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376241.1|3110909_3112637_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_017376242.1|3112650_3113712_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_017376243.1|3114026_3115241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376244.1|3115373_3115898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063518.1|3116515_3117364_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	4.3e-26
WP_017376247.1|3117350_3118049_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_017376248.1|3118103_3118865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376249.1|3118857_3119280_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_017376250.1|3119409_3119961_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_017376251.1|3120016_3120979_-	TonB family protein	NA	NA	NA	NA	NA
WP_144420746.1|3120979_3121195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376253.1|3121381_3122191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376254.1|3122170_3123013_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_017376255.1|3123009_3124254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376256.1|3124392_3125481_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_017376257.1|3125498_3125999_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.5	1.2e-20
WP_017376258.1|3126186_3126786_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_017376259.1|3126791_3127955_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_017376260.1|3127987_3128941_+	glutathione synthase	NA	NA	NA	NA	NA
WP_017376261.1|3129304_3130369_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_027243065.1|3130365_3133428_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.3	1.0e-61
WP_144420745.1|3133580_3134033_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_027243066.1|3134064_3134421_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772645.1|3134839_3135613_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376269.1|3138236_3138527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|3138751_3139627_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876179.1|3139623_3140181_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|3140191_3141595_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP039869	Piscirickettsia salmonis strain Psal-113 plasmid unnamed1, complete sequence	164167	0	42864	164167	transposase	Streptococcus_phage(47.06%)	46	NA	NA
WP_027243191.1|0_708_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	40.0	1.2e-34
WP_048876212.1|661_1540_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_144420840.1|1570_2002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876211.1|2384_3089_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.7	7.9e-10
WP_036772541.1|3100_3829_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_051929563.1|3858_4248_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	40.0	1.1e-10
WP_017375910.1|4270_4999_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036815979.1|5001_5610_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	8.9e-10
WP_144420841.1|5981_6206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243184.1|6198_6537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052133264.1|6550_6955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375840.1|6999_7218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275474.1|8186_9299_+	replication initiation protein	NA	A0A218MNI2	uncultured_virus	29.8	2.1e-25
WP_017377655.1|9640_9886_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_017377656.1|9882_10269_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_036772434.1|10356_11085_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	9.3e-38
WP_080963659.1|11063_11684_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377658.1|12029_12716_+	Fic family protein	NA	NA	NA	NA	NA
WP_082304501.1|13665_14028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|14030_15770_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155046629.1|16171_16324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929558.1|16351_17035_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	33.3	5.1e-22
WP_036771347.1|17116_18094_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_081000019.1|18169_18340_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876210.1|18380_19109_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	4.6e-37
WP_036771293.1|19654_19921_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772437.1|20216_22115_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_017377694.1|22536_23265_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_082884401.1|23362_23485_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155046630.1|23901_24066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375754.1|24086_25373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771359.1|25555_26284_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.7	3.5e-37
WP_036771347.1|26411_27389_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155046631.1|27463_28114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126795.1|30745_31006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772441.1|31009_31282_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_017375910.1|31357_32086_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_048876229.1|32654_33626_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_048876208.1|34490_35318_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.1	1.2e-17
WP_036771289.1|36171_36642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046633.1|37535_37679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242940.1|38885_39485_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_017375850.1|39838_40615_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_036771279.1|40975_41704_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_155046634.1|41773_41974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876229.1|41892_42864_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP039869	Piscirickettsia salmonis strain Psal-113 plasmid unnamed1, complete sequence	164167	55705	109407	164167	terminase,integrase,transposase,portal	Streptococcus_phage(43.75%)	55	60740:60799	99127:99786
WP_027242929.1|55705_56089_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	9.5e-26
WP_075278733.1|56175_56658_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	33.3	8.1e-14
WP_048876205.1|56660_57992_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	6.1e-112
WP_047927581.1|58196_58631_+	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.8	1.3e-26
WP_087910668.1|58717_59104_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	50.0	2.1e-25
WP_036771649.1|59141_59876_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
WP_048876202.1|59922_60636_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	3.2e-11
60740:60799	attL	TGAAAGAGGTCTTGAGATTGAGCGTTCAACCATTTGTCGTTGGGTGCACGAGTATGGCTC	NA	NA	NA	NA
WP_144420848.1|62014_62200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243190.1|62203_65548_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_017377509.1|65728_66457_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_075275482.1|66550_67525_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.8e-28
WP_027242596.1|67838_68201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242595.1|68240_68750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420849.1|68981_69962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|70427_71405_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771347.1|71885_72863_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155046636.1|72877_73039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243211.1|73256_73511_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_027243212.1|73500_73788_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	9.6e-15
WP_036771347.1|74282_75260_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_027243215.1|75371_76394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774350.1|76876_77605_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	6.4e-39
WP_048876194.1|78844_79378_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	33.3	1.1e-19
WP_080963665.1|79558_79900_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	54.3	4.3e-22
WP_080963664.1|80080_80347_+|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	46.7	2.5e-09
WP_027243206.1|80419_82285_-	AAA family ATPase	NA	V5K3E8	Pseudomonas_phage	32.7	7.9e-57
WP_047927778.1|82452_82737_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|83080_83809_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155046637.1|83890_84382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|85114_85342_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876191.1|86893_87322_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_081000015.1|87257_87644_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|87673_88402_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_017375663.1|88413_88563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|88809_89538_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036774388.1|90915_91878_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_027242592.1|91901_92231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774385.1|92297_93338_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_144420833.1|93351_93543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774378.1|93747_94317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774316.1|94359_94659_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036774376.1|94655_95084_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_036774373.1|95393_96122_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_048876188.1|96295_97069_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.6	3.9e-10
WP_027243202.1|97782_98718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|98992_99721_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_027243201.1|99886_100126_-	hypothetical protein	NA	NA	NA	NA	NA
99127:99786	attR	TGAAAGAGGTCTTGAGATTGAGCGTTCAACCATTTGTCGTTGGGTGCACGAGTATGGCTCGCAGATCGCCAAACGGCTGAGGCCCCACTTTCGTCAAACGTGTGCCTCTTGGCGGTTAGATGAAACGTTGGTGAAAATTAAAGGTCGTTGGTATTACCTTTATCGAGCCATTGATAAATATGGCAATACTTTGGACTGGATGCTCAGCCGACAGCAAAATGCCAAAGCGGCGATGCGCTTTTTCAAAAAGGCAATCGCCCAACCTTATGTGAAATCACCGCGTGTTGTGAATGTCGACAAGCACGCTTCATTTCCACCCGCTCACCAAAAAGCCAAAGATGAAGGTCTCTTTTCTAGTCAGTGTAAACTCAGGCGAGTGAAGTATTTAAACAACTGCATTGAAAATGATCACAAAGCGGTAAAGCGCAAATCCCGTTTCCGCCAATGGTACCAATCACTTTCTACAGCACGGCCTACCATTGACATAATGGAAGCGATGCGCATGGTTCAAAAAGGTCAATTACGTTATATTAAAAAACAGAATATCTGTGCCCAAAATCAGCTCATTGATAAATTATTTGGATTAGCTGCTTAATTCTAAGCAGAGAGCACAAGAAAATAACCTTTCTGAAGCTCACTATAATTTTTCGCAACAGTGCC	NA	NA	NA	NA
WP_051929623.1|100189_103531_+	DEAD/DEAH box helicase	NA	C3VNU0	Bombyx_mandarina_nucleopolyhedrovirus	28.7	2.6e-50
WP_036772541.1|103688_104417_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_144420834.1|104710_105106_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	46.2	4.9e-09
WP_036815648.1|105158_105887_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036772541.1|106370_107099_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_027243197.1|107269_107839_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.1	2.2e-26
WP_087910667.1|107843_108527_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_036772541.1|108678_109407_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
>prophage 1
NZ_CP039871	Piscirickettsia salmonis strain Psal-113 plasmid unnamed3, complete sequence	50691	2917	16713	50691	capsid,transposase,head,tail	Moraxella_phage(18.18%)	18	NA	NA
WP_036771347.1|2917_3895_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_017375652.1|3922_4351_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242568.1|4409_7100_-	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	32.9	6.1e-111
WP_017375789.1|7096_7654_-|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	35.6	2.7e-21
WP_144420832.1|7643_8429_-	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	41.1	5.1e-42
WP_017375787.1|8358_9030_-|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	33.6	1.4e-27
WP_017375786.1|9026_9368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771950.1|9360_11439_-|tail	phage tail tape measure protein	tail	A0A1J0GWA6	Alteromonas_phage	31.2	1.6e-50
WP_017375784.1|11442_11709_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_017375783.1|11765_12089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375782.1|12090_12513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375781.1|12512_12863_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017375780.1|12859_13255_-	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	39.6	4.3e-05
WP_017375779.1|13433_13859_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	37.9	3.9e-12
WP_017375778.1|13855_14167_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	5.6e-08
WP_027242598.1|14551_15136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275454.1|15149_15689_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	44.2	9.3e-35
WP_036771639.1|15738_16713_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
>prophage 1
NZ_CP039872	Piscirickettsia salmonis strain Psal-113 plasmid unnamed4, complete sequence	33555	3402	19424	33555	transposase,terminase,tail,capsid,integrase,head	unidentified_phage(35.71%)	21	NA	NA
WP_036771330.1|3402_4377_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016212329.1|4912_5503_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	35.3	3.2e-20
WP_027242955.1|5733_5994_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016211078.1|5986_6340_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.8	6.5e-13
WP_069971681.1|6516_7491_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.7e-26
WP_027242954.1|8023_8389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242953.1|8533_8788_+	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_080963620.1|8771_9128_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	36.4	1.7e-16
WP_036771330.1|9225_10200_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242951.1|10825_11692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242950.1|11904_12288_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	4.3e-26
WP_027242949.1|12374_12857_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	34.0	3.6e-14
WP_027242948.1|12859_13045_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	47.3	9.0e-06
WP_036771330.1|13064_14039_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_075275490.1|14135_14528_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	45.0	7.0e-24
WP_027242946.1|14563_15145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|15525_16500_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_144420855.1|16573_16789_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_027242945.1|17592_18108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242944.1|18453_19011_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	7.9e-21
WP_027242943.1|19007_19424_+	hypothetical protein	NA	A0A2R3UA88	Siphoviridae_environmental_samples	41.7	2.2e-20
